CN103361342A - Method for positioning and integrating transgenosis and application thereof - Google Patents
Method for positioning and integrating transgenosis and application thereof Download PDFInfo
- Publication number
- CN103361342A CN103361342A CN 201210090470 CN201210090470A CN103361342A CN 103361342 A CN103361342 A CN 103361342A CN 201210090470 CN201210090470 CN 201210090470 CN 201210090470 A CN201210090470 A CN 201210090470A CN 103361342 A CN103361342 A CN 103361342A
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- loxp
- plasmid
- construction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for positioning and integrating transgenosis and an application of the method, and particularly provides a variant loxP element. The method is characterized in that a sequence 'ATAAC' of an inverted repeat sequence in a wild type loxP locus mutates into 'CACCT', and thus the variant loxP element can be obtained. The variant loxP element can greatly improve the integration specificity and integration efficiency of a cre-loxP system, and therefore, efficient local integration of genes can be realized.
Description
Technical field
The invention belongs to biological technical field, particularly, the present invention relates to a kind of method and application thereof of transgenosis positioning integration.
Background technology
The method for preparing transgenic animal has very important effect in fundamental research and applied research.At present scientists has been carried out multiple transgenic technology, with the targeting that improves transgenic animal and integration efficiency.But in large animal, genetically modified integration efficiency and expression rate are all not satisfactory at present.
Current international transgenic method is microinjection, and this method cost is higher, and success ratio is very low, with regard to transgenic animal-galactophore biological reactor, and its success ratio only about 3%.Microinjection causes foreign gene random integration on karyomit(e), and genetically modified expression greatly is subjected to the impact of host genome on every side.The random integration of foreign gene may cause following problems: 1. transgenosis is integrated into the non-probability of enlivening in the chromosome sequence and enlivens the chromosomal region height, affected by integration site, and most of genetically modified expression lowly or are not expressed; 2. when transgenosis was integrated into the high frequency recombination site, Genomic instability can occur; 3. exogenous origin gene integrator often causes the native gene sudden change or expresses change at random, affects normal development and the health of transgenic animal; 4. the transgenic animal of multidigit point integration cause the transgene expression proterties to change and the breeding difficulty because integration site separates in the offspring; 5. integrating the too high or too low transgene expression that easily causes of copy number lowly or not expresses.
Above problem is the research gene function, creates animal disease model, develops the key obstacle that commercial value model and initiative transgenic breeding novel material are arranged.Develop genetically modified positioning integration method and might remove costly that conventional art causes, the negative effect of inefficiency promotes the industrialized development of breeding transgenic livestock.But also do not control goal gene in the method for genome specific position high effective integration at present, so this area is in the urgent need to developing a kind of method of efficient transgenosis positioning integration.
Summary of the invention
Purpose of the present invention just provides a kind of method and application thereof of transgenosis positioning integration.
In a first aspect of the present invention, a kind of loxP element of variation is provided, the loxP element of described variation has the sequence shown in the SEQ ID NO.:30.
In a second aspect of the present invention, a kind of construction is provided, described construction from 5 ' to 3 ' contains following element successively:
(a) the loxP element of the described variation of first aspect present invention; (b) exogenous gene expression box and/or selection markers expression cassette; (c) has the wild-type loxP element of sequence shown in the SEQ ID NO.:28;
Wherein, element (a) and element (c) can exchange.
In another preference, described selection markers is because neomycin gene or puromycin resistance gene.
In another preference, described foreign gene is selected from lower group: lysozyme gene, salmon's calcitonin gene or Serum Albumin Gene.
In another preference, element (a) and element (c) are for arranging in the same way.In another preference, described element (a) and element (c) are incorgruous arrangement.
In a third aspect of the present invention, a kind of carrier is provided, described carrier contains the described construction of second aspect present invention.
In a fourth aspect of the present invention, a kind of host cell is provided, described host cell contains the described construction of second aspect present invention, or its chromosomal integration has the described construction of one or more second aspect present invention.
In another preference, the cell of described host cell behaviour or non-human mammal.In another preference, described non-human mammal is selected from: goat, sheep, pig, ox, dog and rabbit preferably are goat.
In another preference, described host cell is goat adult somatocyte or Goat Fetus somatocyte or Goat Embryos stem cell.
In another preference, described host cell is with being selected from lower group method with the described construction transfered cell of second aspect present invention: homologous recombination method, microinjection, electroporation, liposome transfection method, calcium phosphate precipitation method, virus infection method or sperm vector method.
In a fifth aspect of the present invention, a kind of method for preparing transgenic animal is provided, comprise step:
(i) under the condition that the Cre recombinase exists, transform the described cell of fourth aspect with the described carrier of a third aspect of the present invention; Be animal body with the cell regeneration that transforms (ii), thereby obtain transgenic animal.
In another preference, step (i) comprises step: (i-1) the described cell of the described carrier cotransformation of Cre expression of enzymes carrier and a third aspect of the present invention fourth aspect; Or (i-2) under the effect of the TAT-Cre recombinant protein with cell-penetrating activity, with the described carrier of a third aspect of the present invention the karyomit(e) of the described cell of fourth aspect is carried out gene integration.
In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and can making up mutually between specifically described each technical characterictic in below (eg embodiment), thus consist of new or preferred technical scheme.As space is limited, this tired stating no longer one by one.
Description of drawings
Following accompanying drawing is used for specific embodiments of the present invention is described, limits the scope of the invention that is defined by claims and be not used in.
Fig. 1 has shown that to the fibroblastic sex identification result of Goat Fetus, M is the DL2000 molecular weight standard, and band is respectively 100,250,500,750,1000 from bottom to top, 2000bp; N5, N4-A, N37-A and N37-B are the fetus that separates;-negative sheep contrast; + positive sheep contrast; Water is the contrast of PCR system.
Fig. 2 shown the fibroblastic transgenosis of Goat Fetus integrated qualification result, and M is the DL2000 molecular weight standard, and band is respectively 100,250,500,750,1000 from bottom to top, 2000bp; N5, N4-A, N37-A and N37-B are the fetus that separates;-negative sheep contrast; + positive sheep contrast; Water is the contrast of PCR system.
Fig. 3 has shown the qualification result of TAT-Cre recombinant protein, M is marker, and SF is the supernatant after the ultrasonication of TAT-Cre thalline, and FT is that the stream of SP-sepharoseTM pillar is worn liquid, E1 is the elutriant of SPsepharoseTM pillar, and E2 is the elutriant of source 15s pillar.
Fig. 4 is the structure schematic flow sheet of salmon calcitonin see calcimar positioning integration plasmid pTM-sCT2.
Fig. 5 has shown two loxp gene orders of synthetic.
Fig. 6 has shown the structure synoptic diagram of pBLG-sct plasmid.
Fig. 7 has shown the salmon calcitonin see calcimar sequence that total man worker synthesizes.
Fig. 8 shows that puro expresses framework amplification electrophorogram, and wherein, M is D2000marker; 1,2 are puro expression framework amplification electrophorogram.
Fig. 9 has shown PCR method evaluation plasmid pMD-Puro; M is D2000marker; 11-20 is for transforming the picking clone; 11,12,13,14,16,17,18,19,20 positive clones; 21 negative contrasts.
Figure 10 has shown to cut with the NotI enzyme and has identified plasmid pMD-Puro electrophorogram; M:1kb marker; 11-20 is for transforming the picking clone; 16,17,18,19,20 positive clones wherein.
Figure 11 has shown that the PCR of pTM-sCT2 identifies collection of illustrative plates; Wherein, M is D2000marker; 1-23 is the picking mono-clonal: 2,19,20 positive clones; 24 negative contrasts.
Figure 12 has shown to cut with the NotI enzyme and has identified plasmid pTM-sCT2 electrophorogram; M is D2000marker; 2,19,20 positive clones.
Figure 13 has shown that the enzyme of pTM-sCT2 cuts the evaluation collection of illustrative plates; Wherein 1 is the dna molecular amount Marker of DL5000, and 2 is the electrophoretogram of Not I digested plasmid pTM-sCT2.
Figure 14 has shown that screening and cloning 5 ' end detects electrophorogram; M is D2000, and 66-69,71,73-85,93 are screening and cloning 5 ' end and detect electrophorogram, and 67,73,74,78,81,85 is positive, 0 negative contrast
Figure 15 has shown that screening and cloning 3 ' end detects electrophorogram; M is 1kb DNA Marker, and 20,23,24,34,41,47,50 is that screening and cloning 3 ' end detects electrophorogram, 0 negative contrast.
Figure 16 has shown that the salmon calcitonin see calcimar functional gene detects electrophorogram; M is D2000, and 10,14,20,23,24,34,41,47,54,59,67,73,74,79,81,85,89 are functional gene neo detection electrophorogram, 1 positive contrast, 2 negative contrasts.
Figure 17 has shown that screening-gene neo detects electrophorogram; M is D2000, and 20,23,24,34,41,47,54,59,67,73,74,79,81,85 is that screening and cloning marker gene neo detects electrophorogram, and 79 is the neo gene masculine, 1 positive contrast, 2 negative contrasts.
Figure 18 has shown pBS185 gene test electrophorogram; M is D2000; 23,24,34,47,59,74,78,81,85 is screening and cloning pBS185 gene test electrophorogram, and wherein 24,34,81 is this gene masculine; 0 negative contrast.
Figure 19 has shown salmon calcitonin see calcimar positioning integration clone 5 ' sequencing analysis collection of illustrative plates.
Figure 20 has shown salmon calcitonin see calcimar positioning integration clone 3 ' sequencing analysis collection of illustrative plates.
Figure 21 has shown salmon calcitonin see calcimar location recombinant clone 5 ' the theoretical sequence of recombinating.
Figure 22 has shown salmon calcitonin see calcimar location recombinant clone 3 ' the theoretical sequence of recombinating.
Figure 23 has shown that screening and cloning cell strain 5 ' end detects electrophorogram; M is D2000marker; 1-12 is that picking clonal cell line 5 ' end detects electrophorogram, No. 10 positive clones.
Figure 24 has shown that screening and cloning cell strain 3 ' end detects electrophorogram; M is D2000marker; 1-12 is that picking clonal cell line 3 ' end detects electrophorogram, No. 10 positive clones.
Figure 25 has shown that functional gene detects electrophorogram; M is D2000marker, and 10,14 is that screening and cloning functional gene sct detects electrophorogram.
Figure 26 has shown pTM-sCT2 plasmid framework recovery figure; M is 1kb DNA Ladder; 1pTM-sCT2 plasmid framework reclaims figure.
Figure 27 has shown that hsA expresses framework recovery figure; M is 1kb DNA Ladder; 1 is hsA expression framework recovery figure.
Figure 28 has shown plasmid pTM-hSA2 electrophorogram; M is 1kb DNA Ladder; 1-12 is by being extracted the plasmid electrophorogram; 3,5 positive plasmids wherein; 13 is plasmid pTM-sCT2 electrophorogram.
Figure 29 has shown that plasmid pTM-hSA2 enzyme cuts the evaluation electrophorogram; M is 1kb DNA Ladder; 3 oppositely insert plasmid pTM-sCT2 framework electrophorogram for hsA expresses framework; 5 are hsA expression framework forward insertion plasmid pTM-sCT2 framework electrophorogram; 10 negative contrasts.
Figure 30 has shown plasmid pTM-hSA2 direction evaluation figure; M is 1kb DNA Ladder; 1 is plasmid pTM-hSA2 direction primers designed amplification electrophorogram.
Figure 31 has shown pTM-hSA2 part of theory sequence.
Figure 32 has shown plasmid pTM-hSA2 direction evaluation sequencing sequence analysis collection of illustrative plates.
Figure 33 has shown picking clonal cell line 5 ' end electrophoresis detection figure; M1 is D2000marker; 1,2,8-24 is picking clone 5 ' end electrophoresis detection figure, wherein 11,12,14,20,21,1,2 is positive; 26,5 positive contrasts; 27,6 negative contrasts.
Figure 34 has shown picking clonal cell line 3 ' end electrophoresis detection figure; M1 is D2000; 1-4,8-25 are picking clone 3 ' end electrophoresis detection figure, and wherein 11,14,17,20,21,1 is positive; 26,5 positive contrasts; 27,6 negative contrasts.
Figure 35 has shown that screening and cloning cell strain functional gene detects collection of illustrative plates; M is 1kb DNA Ladder; 1 is screening and cloning marker gene detection collection of illustrative plates.
Figure 36 has shown that screening and cloning cell strain marker gene detects collection of illustrative plates; M is D2000; 1,2 are screening and cloning marker gene detection collection of illustrative plates, 1 positive clone; 3: positive control; 4: negative control.
Figure 37 has shown the theoretical sequence of human serum albumin location recombinant clone 5 ' end restructuring.
Figure 38 has shown the theoretical sequence of human serum albumin location recombinant clone 3 ' end restructuring.
Figure 39 has shown human serum albumin positioning integration clone 5 ' end sequencing result collection of illustrative plates.
Figure 40 has shown human serum albumin positioning integration clone 3 ' end sequencing result collection of illustrative plates.
Figure 41 has shown efficient location of the present invention recombination method schematic flow sheet.
Figure 42 has shown the qualification result of human serum albumin mammary gland-specific expression vector.
Embodiment
The inventor is through extensive and deep research, be surprised to find that first, " ATAAC " of inverted repeats in the loxp site of wild-type sported " CACCT ", unexpectedly can greatly improve integration specificity and the integration efficiency of the integration system of cre-loxp.Particularly, in the inverted repeats of loxp site one side, introduce this sudden change, when importing altogether the plasmid that contains in the opposite side inverted repeats with same sudden change loxp site, under the effect of Cre enzyme, foreign gene can be inserted into, forming one at two ends is the loxp site of wild-type, another is the structure in bilateral sudden change loxp site, because the loxp site of bilateral sudden change is not the good substrates of Cre enzyme, therefore stoped the deletion reaction, improve stable integration efficient, can realize accordingly high efficiency gene site-directed strategy.Finished on this basis the present invention.
Term
The Cre-LoxP system
Cre recombinase gene coding region sequence total length 1029bp (EMBL database login X03453), coding 38kDa protein.The Cre recombinase is a kind of monomeric protein that is comprised of 343 amino acid.Belong to λ Int enzyme supergene family, it not only has catalytic activity, and similar to restriction enzyme, can identify special dna sequence dna, and namely the loxP site makes the deleted or restructuring of gene order between the loxP site.
LoxP (locus of X-over P1) sequence derives from the P1 phage, jointly is comprised of the 8bp sequence of two 13bp inverted repeats and midfeather, and the intervening sequence of 8bp has also been determined the direction of loxP simultaneously.The Cre enzyme in catalytic dna chain exchange process with the DNA covalent attachment, the inverted repeats of 13bp be the Cre enzyme in conjunction with the territory.
Wild-type loxP site sequence is as follows: 5 '-ATAACTTCGTATA-ATGTATGC-TATACGAAGTTAT-3 ' (SEQ ID NO.:28),
Its complementary sequence is: 3 '-TATTGAAGCATAT-TACATACG-ATATGCTTCAATA-5 ' (SEQ ID NO.:29).
As used herein, term " loxP element " refers to and can be repeated in the same way the site by two that the Cre recombinant protein is identified.The invention provides a kind of loxP element of sudden change, the nucleotide sequence of described element is as follows: CACCTTTCGTATAATGTATGC TATACGAAGTTAT (SEQ ID NO.:30).
As used herein, term " Cre enzyme " refers to mediate the proteolytic enzyme of specificity restructuring between 2 loxP sites, and it can cause the deleted or restructuring of nucleotide sequence between the loxP site.
As used herein, " foreign gene " refers to act on is the exogenous DNA molecule of interim effect.The foreign gene that can be used for the application is not particularly limited, and comprises the various foreign genes that the transgenic animal field is commonly used.Representative example comprises (but being not limited to): lysozyme gene, salmon's calcitonin gene or Serum Albumin Gene.
As used herein, " selection markers gene " refers to be used in the transgenosis process genes of screening transgenic cell or transgenic animal, the selection markers gene that can be used for the application is not particularly limited, comprise the various selection markers genes that the transgenosis field is commonly used, representative example comprises (but being not limited to): neomycin gene or puromycin resistance gene.
The present invention also provides a kind of construction, and described construction from 5 ' to 3 ' contains following element successively:
(a) the loxP element of the present invention's variation;
(b) exogenous gene expression box and/or selection markers expression cassette;
(c) has unmanifest (wild-type) loxP element of sequence shown in the SEQ ID NO.:28;
Wherein, element (a) and element (c) can exchange.
In a preference of the present invention, the direction of element (a) and element (c) is identical or opposite.
As used herein, term " expression cassette " refers to one section polymerized nucleoside acid sequence of the module that contains gene to be expressed and express required element.For example, in the present invention, term " selection markers expression cassette " refers to contain the encode sequence of selection markers and the polymerized nucleoside acid sequence of expressing the module of required element.Express required assembly and comprise promotor and polyadenylation signal sequence.In addition, the selection markers expression cassette can also contain or not contain other sequences, comprises (but being not limited to): enhanser, secretion signal peptide sequence etc.
In the present invention, the promotor that is applicable to exogenous gene expression box and selection markers expression casette can be any common promotor, and it can be constitutive promoter or inducible promoter.Preferably, this promotor is the strong promoter of composing type, and other is applicable to the promotor of eukaryotic expression such as bovine beta-lactoglobulin promotor etc.
As used herein, " operationally being connected in " refers to a kind of like this situation: namely some part of linear DNA sequence can affect the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.
Used various elements all are as known in the art in the construction of the present invention, therefore those skilled in the art can use ordinary method, obtain corresponding element such as PCR method, total man worker's chemical synthesis, enzyme blanking method, then link together by the DNA interconnection technique of knowing, just formed construction of the present invention.
Construction of the present invention is inserted foreign vector (carrier that especially is fit to the transgenic animal operation), just consisted of carrier of the present invention.
With carrier of the present invention and Cre expression of enzymes carrier cotransformation host cell; Or mediate carrier of the present invention with the TAT-Cre recombinant protein with cell-penetrating activity host cell chromosome is integrated.
The present invention also provides a kind of method of positioning integration foreign gene, comprises step: under the condition that the Cre enzyme exists, transform cell of the present invention with carrier of the present invention; Be animal body with the cell regeneration that transforms, thereby obtain transgenic animal.
In a preference of the present invention, comprise the steps:
(1) utilize method of gene introduction, the loxp sequence of will suddenling change is integrated into the genomic specific position of domestic animal, obtains the cell of loxp positioning integration; (2) will treat that the transgene framework places between a plurality of in the same way loxp site, is built into transgene carrier; (3) utilize method of gene introduction that transgene carrier is imported loxp positioning integration cell, by introducing the loxp site of Cre enzyme gene transfer framework integration in loxp positioning integration cell, obtain transgenosis positioning integration cell; (4) utilize modern biotechnology, transgenosis positioning integration cell is prepared the transgenosis positioning integration animal that survives.
Major advantage of the present invention is:
(1) the inventive method can be efficiently with exogenous origin gene integrator at the genomic specific position of domestic animal, the integration site of avoiding the foreign gene random integration to cause is indefinite, the shortcoming that interference of transgene is expressed;
(2) the inventive method will contain the plasmid direct transfection cell of foreign gene, need not enzyme cut, the complex process such as gel electrophoresis, recovery and purifying, greatly improve the operability of plasmid construction, save human and material resources and financial resources;
(3) the inventive method obtains in the transgenosis positioning integration cell, the gene integration position is clear, gene integration detects simple, has avoided the complex detection of traditional transgenosis integrator cell and the problem that excessively goes down to posterity between detection period, and has made the cell of genetic modification be more suitable for somatic cell clone;
(4) the inventive method can significantly be simplified the authentication step in transgenic animal safety evaluation and the industrialization process, and efficient is high, high conformity, and the transgenic fragment size has no significant effect positioning integration efficient, is easy to amplify;
(6) the inventive method can be integrated with the reversibility that knocks out transgenosis and process, and the research that is not only applicable to gene function and does mutually also can be used for harmful genetically modified removing deletion.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
1. the separation of human lysozyme transgenic goat fetal fibroblast
Normal commercially available she-goat and rear 32-40 days of ram (this ram the is disclosed in patent ZL200510110772.1) breeding that contains wild-type Loxp element, take out fetus with surgical method, transfer in the Bechtop, the fetus that obtains is washed 2 times with the PBS damping fluid that contains 1% pair anti-(penicillin 100U/ml, Streptomycin sulphate 0.1mg/ml), remove head, four limbs and internal organ, remaining being organized in 75% ethanol soaked 30s; Do not wash fetal tissue 3-5 time with not containing two anti-PBS again, then be cut into 1mm
3The tissue block of size, be tiled on the 100mm Tissue Culture Dish, equably tissue block is spread out, use the GMEM nutrient solution (being purchased from American I nvitrogen company) be added with 10%FBS, mycillin and non-essential amino acid in 37 ℃, 5%CO2 incubator, to leave standstill 4h.Added the GMEM nutrient solution on the 2nd day around tissue block, liquid is observed and changed to the submergence tissue block every 2～3d.Digestion collecting cell when primary cell culture to cell 80% converges, the cultivation of going down to posterity, cell counting, and place the freezing preservation of liquid nitrogen.
2. human lysozyme transgenic goat fetal fibroblast is identified
Obtained altogether 4 fetuses, the fetus situation is as follows: N5 is 32 days sheep placenta; N4-A is 37 days fetuses; N37-A is 37 days fetuses; N37-B is 37 days fetuses.
According to the sequence of goat Y chromosome, the design pair of primers:
SRY16f(5’-caatcgtatgcttctgctatgttc-3’SEQ ID NO.：1)；
SRY654r(5’-caatgttaccctatcgtggcc-3’SEQ ID NO.：2)。
Specific amplification Y chromosome the preceding paragraph 638bp distinguished sequence carries out accordingly sex of fetus and identifies that the sample that can amplify this 638bp distinguished sequence comes from ram, otherwise is ewe.
Result (Fig. 1) shows: N5, N37-B are ram, and N4-A and N37-A are ewe.
According to human lysozyme gene group sequence, the design pair of primers:
Lyz983(5’-tacatttgaggacctggcagagc-3’SEQ ID NO.：3)；
Lyz 1412(5’-tcctaccactttgggaggctga-3’SEQ ID NO.：4)。
In order to the human lysozyme gene group fragment of specific amplification 429bp, to integrate evaluation, the sample that amplifies this 429bp distinguished sequence is integrated fetus.
Result (Fig. 2) shows: N5 and N37-B are for integrating positive type fetus.
The expression and purification of embodiment 2 TAT-Cre enzymes
Picking contain TAT-Cre recombinase expression plasmid pET 28.2TAT-Cre (this carrier public all can freely obtain from Howard Hughes Medical Institute, carrier structure, multiple clone site, complete information such as nucleotide sequence from
Http:// cmm.ucsd.edu/Lab_Pages/dowdy/Vectors/ Vector_seq/pET28.2bTATCRE.txt).The colony inoculation that contains TAT-Cre recombinase expression plasmid contains in the LB substratum of kantlex in 20ml, and 37 ℃ are shaken bacterium and spend the night.In 2L kana LB substratum, 37 ℃, shake bacterium 3h according to 1: the 100 bacterium liquid that contains the purpose plasmid that spends the night of inoculation.Add IPTG and carry out induced expression, making its final concentration is 1mmol/L, 37 ℃, shakes bacterium 3h.3000 * g, centrifugal 10min, results thalline.With the resuspended thalline of 100ml precooling PBS, 5000 * g, centrifugal 10min, results thalline, so repeat three times, thalline can be stored in-80 ℃ for subsequent use.
The thalline that will contain target protein is resuspended with the tropina lysate of precooling, is placed on ice, and is ultrasonic, intensity 10, and ultrasonic 10s places 30s to 1min on ice, repeatedly, until the whole cracking of thalline.15000 * g, centrifugal 30min,, get supernatant, place on ice.SB buffer (Na with 30%
2HPO
410mmol/L, glycerine 2.5%, beta-mercaptoethanol 10mmol/L, NaCl 1mol/L, pH7.4) balance SP sepharoseTM pillar, 4ml/min, 30min.Loading after getting supernatant behind the cellular lysate and filtering with the strainer of 0.22 μ m, loading speed 4ml/min.Behind the end of the sample, with 30% SB buffer, 4ml/min washes pillar, until ultraviolet absorption value is steady, no longer descends.From 30% to 100%SB buffer gradient elution, 2ml/min, wash-out cumulative volume are 100ml, and fluid collection device is collected all elutriants automatically.100%SB buffer continues wash-out until ultraviolet absorption value drops to below the 100mAU, merges the elutriant greater than 250mAU, wherein is target protein TAT-Cre recombinase.
SA buffer (the Na that this elutriant and diploid are long-pending
2HPO
410mmol/L, glycerine 2.5%, beta-mercaptoethanol 10mmol/L, pH7.4) at careful mixing on ice, on a small quantity precipitation appears, after the strainer filtration with 0.22 μ m, place for subsequent use on ice.With 30%SB buffer balance source 15s pillar, 4ml/min, 30min.The supernatant loading of gained, loading speed 4ml/min will be filtered.With 30% to 100%SB buffer gradient elution pillar, until go out the peak, collect all elutriants greater than 250mAU, wherein namely contain target protein.With target protein loading HiPrepTM 26/10Desalting pillar, buffer replaces liquid 10ml/min wash-out, collects eluted protein peak solution.
Protein peak solution is put into the centrifugal 30min of super filter tube 3000 * g of millipore MWCO 30000, in the pipe behind approximately remaining original volume 1/4 protein solution, sucking-off protein solution ,-80 ℃ of preservations.Because each freeze thawing has certain influence to concentration, the TAT-Cre recombinase is quantitatively determined concentration by DC before use.
Fig. 3 has shown the SDS-Page electrophoresis result of TAT-Cre recombinase, M is marker, and SF is the supernatant after the ultrasonication of TAT-Cre thalline, and FT is that the stream of SP-sepharoseTM pillar is worn liquid, E1 is the elutriant of SPsepharoseTM pillar, and E2 is the elutriant of source 15s pillar.The result shows, the contriver successfully purifying the TAT-Cre recombinase.
The synthetic side of total man worker is for there being sudden change Loxp site, and opposite side is in the same way Loxp site of wild-type, and the centre is the complete sequence (sequence is shown in SEQ ID NO.:31) of the expression framework of selection markers gene neo and TK.It is cloned into the SalI site of commercially available pGEM-7Z carrier, recombinant plasmid called after pGEM-2loxp '.Utilize the loxp recombination method of the TAT-Cre mediation that obtains among the embodiment 2, this element is introduced in the human lysozyme transgenic goat fetal fibroblast, replace the in the same way selection markers of Loxp site span of intracellular wild-type.The human lysozyme transgenic goat fetal fibroblast in this kind band sudden change loxp site is all used in the following transgenosis member positioning integration research of carrying out of this paper.
The structure of embodiment 4 salmon calcitonin see calcimar positioning integration plasmid pTM-sCT2
1. the overall plan of vector construction
According to the flow process of Fig. 4, make up the mammary gland-specific expression vector pTM-sCT2 of the salmon calcitonin see calcimar that contains two loxp sequences.Wherein pbLGpA is that our unit makes up voluntarily, and the preparation method is open in patent ZL200510110772.1, contains the beta-lactoglobulin promotor of ox and the mammary gland specifically expressing regulation and control framework of Trobest polyA sequence composition in this plasmid.
2. contain two loxp sites Vector construction
The synthetic pair loxp site sequences (sequence is seen Fig. 5) that contain of total man worker enter sequence clone in the commercially available pUC18 carrier this plasmid called after pUC18-2loxp.
Between two loxp sites, add the multiple clone site that SacI, a SalI and NotI form, be convenient to follow-up gene clone.
3. the structure of salmon calcitonin see calcimar mammary gland-specific expression vector
According to the flow process of Fig. 6, make up the mammary gland-specific expression vector pBLG-sCT of salmon calcitonin see calcimar.Wherein contain the beta-lactoglobulin promotor of ox and the mammary gland specifically expressing regulation and control framework of Trobest polyA sequence composition among the pbLGpA.Fig. 6 has shown the structure synoptic diagram of pBLG-sct plasmid.
The encoding sequence (Fig. 7) of salmon calcitonin see calcimar (sCT) of having entrusted Shanghai Jierui Biology Engineering Co., Ltd's synthetic, for instructing salmon calcitonin see calcimar to be secreted in the milk and making things convenient for purifying, added three elements of restriction enzyme site of secretion peptide, 6 * His label and the enteropeptidase of goat beta-casein before the salmon calcitonin see calcimar coding framework, both sides are the XhoI site.The sCT sequence is cloned in the pUC18 carrier, forms plasmid pUC18-sCT.Fig. 7 has shown the salmon calcitonin see calcimar sequence of synthetic.
4. the structure that contains the sCT mammary gland-specific expression vector in two loxp sites
Utilize SalI and SacII double digestion plasmid pBLG-sct and pUC18-2loxp, sCT is expressed framework insert between two loxp sites, obtain to contain the sCT mammary gland specifically expressing plasmid p2xGsct in two loxp sites.
5. puromycin resistance gene is expressed the clone of framework
According to plasmid pGL4.20[luc2/Puro] (available from Promega company, GenBank Accession Number:DQ1888 40) sequence, the synthetic following primer of design:
F-puro1183(5’-ttgcggccgcgataaggatccg tttgcgta-3’SEQ ID NO.：5)；
R-puro1183(5’-ttgcggccgcatcggtcgacagcatctagt-3’SEQ ID NO.：6)。
Therefrom amplify the expression framework of puromycin resistance gene.
After 2% agarose gel electrophoresis detects successfully, utilize TIANGEN DNA purifying to reclaim the test kit purifying and reclaim screening-gene expression fragment, the band that recovery is obtained is connected with carrier pGM-T and is transformed among the competence DH5 α, obtain plasmid pMD-Puro (Fig. 8, M is DL2000marker, and band is respectively 100,250,500,750,1000 from bottom to top, 2000bp; 1,2 are puro expression framework amplification electrophoretogram).
(Fig. 9, M are DL2000marker, and 11-20 is for transforming the picking clone to utilize respectively the PCR method; 11,12,13,14,16,17,18,19,20 positive clones; 21 negative contrasts, purpose band are 1183bp) and endonuclease cutting (Figure 10, M are 1kb Ladder, and 11-20 is for transforming the picking clone; 16,17,18,19,20 positive clones, the purpose band is 1183bp) pMD-Puro is identified.
Qualification result shows that this plasmid construction is correct.
6. salmon calcitonin see calcimar positioning integration plasmid construction
Utilize NotI digested plasmid pMD-Puro to obtain the expression framework of Puro, among the p2xGsct with it insertion NotI linearization for enzyme restriction, get salmon calcitonin see calcimar positioning integration plasmid pTM-sCT2.
Show that through evaluation (Figure 11, M are DL2000 to the expection band that obtains 1183bp to have 4 positive clones, PCR to increase in 23 bacterium colonies; 1-23 is the picking mono-clonal: 2,19,20 positive clones; 24 negative contrasts).
Further qualification result shows: pTM-sCT2 cuts the sCT fragment that can obtain 180bp through the XhoI enzyme, and (Figure 12, M are D2000; 2,19,20 positive clones), through Not I enzyme cut the Puro that can cut out 1183bp express framework (Figure 13,1 is BM15000DNA Marker II, each band is 500,1000,1500,3000,5000,7500,10000 from top to bottom, 15000bp; 2 is the electrophoretogram of Not I digested plasmid pTM-sCT2), show the plasmid construction success.
1.pTM-sCT2 the preparation of plasmid and pBS185 plasmid
PBS185 is available from Addgene company.
The pTM-sCT2 plasmid is from preparing among the embodiment 4.
Utilize the EndoFree Plasmid Maxi Kit (Cat.No.12362) of QIAGEN to carry out respectively a large amount of extractings of plasmid, finally take out to such an extent that plasmid pBS185 concentration is 485ng/ μ l, totally 500 μ l, plasmid pTM-sCT2 concentration is 1.9 μ g/ μ l, totally 500 μ l.
2.pBS185 with pTM-sCT2 corotation BLG3 cell
Recovery human lysozyme transgenic goat fetal fibroblast reaches 24 orifice plates, 4 * 10 in the 60mm Tissue Culture Dish after covering with in perfect medium
5Individual cells/well, every hole add 500 μ l and do not contain two anti-substratum.Treat that second day Growth of Cells to degree of converging reaches 50-80%, can carry out transfection.
Before the transfection, prepare dna-lipid mixture in accordance with the following methods: prepare plasmid (pBS185 is 1: 1 with the ratio of pTM-sCT2 add-on) by table 1, packet numbering (by 24 orifice plate coordinates), every pipe plasmid is with 100 μ l serum-free Opti-MEM
I nutrient solution (being purchased from American I nvitrogen company) dilutes, fully mixing.With PLUS (being purchased from American I nvitrogen company) reaction solution mixing gently, add 1 μ lPLUS reaction solution in the plasmid that has diluted before use, then mixing places 5min under the room temperature lightly.Mixing Lipofectamine lightly
TMLTX (being purchased from American I nvitrogen company) adds this reagent (add-on such as table 1), fully mixing in above-mentioned each pipe.Room temperature is placed 30min.In 24 porocyte plates, dropwise add the above-mentioned DNA-lipid mixture that 100 μ l prepare, lightly before and after the slip culture plate, mixing.With the cell of above-mentioned processing in 37 ℃ of incubator (volume fraction 5%CO
2) hatch after 6 hours with perfect medium it is continued to cultivate, behind cell attachment, PBS washes 3 times, adds OPTI-MEM dilution TAT-Cre (final concentration 2 μ M), processes to change normal nutrient solution after 3 hours and continue cultivation.
Table 1
The selecting and identifying of integrator cell clone strain: above-mentioned cell continued to cultivate after 24 hours, and each porocyte spreads a 100mm Tissue Culture Dish, totally 16.Tetracycline 0.08 μ g/ml pressurization screening 10 days utilizes clone's ring that monoclonal cell is transferred in the 96 porocyte culture plates, picking clone's quantity situation such as table 2.
Table 2
Training method reaches 48 porocyte culture plates with cell according to going down to posterity normally.Cell dissociation after covering with is divided into two parts, a integration evaluation, a enlarged culturing and frozen for somatic cell clone that continues of being used for.
3.sCT the restructuring of the location of transgenosis framework is identified
3.1 the extraction of cellular genome
Utilize TIANGEN Biotech's cellular genome to extract test kit (article No. Dp302-02) and carry out the cellular genome extraction, adjust concentration and be about 50ng/ μ l.
3.2 integrator cell clone's evaluation
According to the theoretical sequence of restructuring, design such as the detection primer in the table 3:
Table 3
Utilizing respectively above primer that carrying recombinant clone genome is carried out 5 ' end detection (Figure 14 and Figure 19), 3 ' holds detection (Figure 15 and Figure 20), functional gene (sct) detection (Figure 16), selectable marker gene (Neo) to detect (Figure 17), plasmid pBS185 gene test (Figure 18), used detection method is PCR method (94 ℃ of denaturation 5min, 94 ℃ of 30s Tm 30s, 72 ℃ of 1min (/ 3min), 72 ℃ of 7min).
Figure 14 has shown 5 ' end detected result of recombinant clone, and wherein M is DL2000, and 66-69,71,73-85,93 are clone's 5 ' end detected result, and 67,73,74,78,81,85 is positive, 0 negative contrast.
Figure 15 has shown 3 ' end detected result of recombinant clone, and wherein M is 1kb DNA Marker, and 20,23,24,34,41,47,50 is that screening and cloning 3 ' end detects electrophorogram, 0 negative contrast.
Figure 16 has shown the detected result of salmon calcitonin see calcimar functional gene, wherein M is DL2000,10,14,20,23,24,34,41,47,54,59,67,73,74,79,81,85,89 are functional gene neo detection electrophorogram, 1 positive contrast, 2 negative contrasts.
Figure 17 has shown screening-gene neoR detected result; Wherein M is DL2000, and 20,23,24,34,41,47,54,59,67,73,74,79,81,85 is that screening and cloning marker gene neo detects electrophorogram, and 79 is the neo gene masculine, 1 positive contrast, 2 negative contrasts.
Figure 18 is pBS185 gene test electrophorogram, and wherein M is DL2000; 23,24,34,47,59,74,78,81,85 is screening and cloning pBS185 gene test electrophoresis result, and wherein 24,34,81 is this gene masculine; 0 negative contrast.
Figure 19 is salmon calcitonin see calcimar positioning integration clone 5 ' sequencing analysis collection of illustrative plates.
Figure 20 is salmon calcitonin see calcimar positioning integration clone 3 ' sequencing analysis collection of illustrative plates.
Above-mentioned detection is consistent with theoretical sequence (Figure 21 and Figure 22) with sequencing result.
Present embodiment has detected altogether 44 strain thyrocalcitonin transgenosis integrator cells clone, has altogether obtained 9 positioning integration positive colonies.Under these 6 kinds of transfection conditions, best positioning integration efficient is 40% (2/5), and other positioning integration efficient is respectively 20% (1/5,2/10), 23.1% (3/13), 25% (1/4).Find that altogether 4 strains are integrated with pBS 185, can not be used for the preparation of clone sheep.PCR product sequencing analysis is carried out in the positive colony representative that filters out, and through the BLAST comparison, the result is consistent with theoretical sequence.Above result shows that all external source functional gene and human lysozyme transgenic goat genome successfully realize location restructuring.
1. liposome transfection
Method realizes positioning integration with pBS 185 with pTM-sCT2 cotransfection method.Plasmid add-on such as table 4.
Table 4
Among 49 clones of institute's picking, 2 positive cell clone strains are arranged as a result, under the transfection conditions, recombination efficiency is 20% (1/5), 12.5% (1/8) in 6.The result identifies such as Figure 13-17.
2. electroporation transfection
Plasmid pTM-sCT2 is quantitative, and its concentration is 1.9 μ g/ μ l, and it is for subsequent use to get 7 μ l.
Recovery human lysozyme transgenic goat fetal fibroblast is passaged to the 100mm Tissue Culture Dish in the 60mm Tissue Culture Dish after covering with, when treating that cell density reaches 80% left and right sides, begin to carry out cell transfecting.Count behind the trypsin digestion cell, be resuspended in electricity after cell 1000rpm 5min is centrifugal to turn among the damping fluid PBS, adjust cell count 5 * 10
6～1 * 10
7Individual/mL.Get 500 μ l cell suspensions, the cyclic plasmid pTM-sCT2 to wherein adding the 12 μ g that filter through 0.22 μ m strainer mixes, join in the 4mm electricity revolving cup of precooling, leave standstill on ice and put into electroporation behind the 5min and shock by electricity pulsed voltage 220V, electric capacity 950 μ F.After the electric shock, leave standstill 10min on ice, cell suspension is moved in the culture plate of the 100mm that is added with nutrient solution, 37 ℃, 5%CO
2Cultivate.Behind cell attachment, PBS washes 3 times, adds OPTI-MEM dilution TAT-Cre (final concentration 2 μ M), processes and changes normal nutrient solution continuation cultivation after 3 hours.After 24 hours, peptic cell reaches in 6-8 the 100mm Tissue Culture Plate, and (final concentration: 0.08 μ g/ml) the pressurization screening is 7 days for tetracycline.Utilize clone's ring that monoclonal cell is transferred in the 96 porocyte culture plates, according to the cell mode that normally goes down to posterity it is cultivated, after the cell in 48 holes covers with, digestion is divided into two parts, a integration evaluation, a enlarged culturing that continues of being used for, and frozen, for somatic cell clone is prepared.
3.sCT the restructuring of the location of transgenosis framework is identified
Extract the genome of institute's bar clonal cell line, in 4 ℃ of preservations.
Show that such as Figure 23, Figure 24 and result shown in Figure 25 in 18 cell clones that this time transfection detects, obtain altogether 2 of positive colonies, recombination efficiency is 2/18=11.1%.
Figure 23 is that screening and cloning cell strain 5 ' end detects electrophorogram; M is DL2000; 1-12 is that picking clonal cell line 5 ' end detects electrophorogram, No. 10 positive clones.
Figure 24 is that screening and cloning cell strain 3 ' end detects electrophorogram; M is DL2000; 1-12 is that picking clonal cell line 3 ' end detects electrophorogram, No. 10 positive clones.
Figure 25 is that functional gene detects electrophorogram; M is DL2000, and 10,14 is that screening and cloning functional gene sct detects electrophorogram.
The acquisition of the mammary gland specifically expressing framework of embodiment 7 human serum albumin mini genes
Genome sequence according to human serum albumin, total man worker has synthesized the mini gene of human serum albumin, total length 4015bp, comprise exon1, intron1, exon2, intron2 and exon3 partial sequence and all cDNA encoding sequences (complete sequence is shown in SEQ ID NO.:27) afterwards, sequence has been synthesized and has been cloned in the commercially available pUC19 carrier plasmid called after pUC19-miniHSA.
PUC19-miniHSA cuts the mini gene that obtains human serum albumin through Xho I enzyme, and product reclaims the XhoI site of the directed pbLGpA of insertion plasmid.Utilize a pair of direction primers designed HSAg-Fnew (GTGGGTAACCTTTATTTCC) and T7 (TAATACGACTCACTATAGGG) successively 55 single bacterium colonies to be carried out PCR and identify (shown in Figure 42), only amplify the purpose fragment of 4394bp for No. 9, send order-checking with No. 9 bacterium liquid, No. 9 plasmids are carried out sequencing analysis, and the result is that direction of insertion is correctly cloned.Obtained thus the framework of cow's milk ball albumin regulation and control human serum albumin mini gene realization mammary gland specifically expressing, plasmid called after pBLG-minihSA.
Figure 42 has shown the qualification result of human serum albumin mammary gland-specific expression vector, and wherein M is λ/HindIII DNA Marker, and each stripe size is respectively 23130.9416。6557。4361。2322。2027。564。125bp。1-32 is the plasmid sample; Have an appointment in No. 9 samples positive band of 4.3kb.
The structure of embodiment 7 human serum albumin positioning integration plasmid pTM-hSA2
With restriction enzyme XhoI digested plasmid pTM-sCT2, excision sCT gene, recovery obtains size and is the plasmid framework (Figure 26) of 7019bp, use simultaneously XhoI digested plasmid pBLG-minihSA (Figure 27), be recovered to 4015bp hSA and express framework, above recovery product connection is transformed into competence DH5 α, the picking mono-clonal, shake bacterium, extract plasmid (Figure 28), get plasmid pTM-hSA2.
Cut this plasmid (Figure 29) through the EcoRI enzyme, obtain the purpose band (if hsA expression framework with reverse insertion, is then cut the purpose band being: 6kb, 0.655kb, 3.872kb) that size is respectively 3.209kb, 3.906kb, 3.872kb.For further verifying the exactness of has gene direction of insertion among the plasmid pTM-hSA2, according to the theoretical sequence of its plasmid, design pair of primers in hsA5 ' end upstream and hSA, carry out PCR-order-checking detection to it, sequence such as table 5:
Table 5
fx691-F 5-TAGAGGAAGCAACCCCAGG-3S EQ ID NO.：17
fx691-R 5-CAGCAACCAAGAAGACAGAC-3SEQ ID NO.：18
Amplification length is 691bp, and annealing temperature is 58 ℃.Obtain theoretical size strip through amplification.Its PCR product is carried out sequencing analysis (Figure 30, Figure 32), result consistent with theoretical sequence (Figure 31).
It is correct that above result shows that all plasmid pTM-sCT2 makes up.
Utilize the EndoFree Plasmid Maxi Kit of QIAGEN that plasmid pTM-hSA2 is carried out a large amount of extractings, concentration 1 μ g/1 μ l totally 500 μ l, be stored in after the packing-20 ℃ for subsequent use.And corresponding bacterial classification preserved.
Recovery human lysozyme transgenic goat fetal fibroblast is passaged to the 100mm Tissue Culture Dish in the 60mm Tissue Culture Dish after covering with, when treating that cell density reaches 80% left and right sides, begin to carry out cell transfecting.Count behind the trypsin digestion cell, be resuspended in electricity after cell 1000rpm 5min is centrifugal to turn among the damping fluid PBS, adjust cell count 5 * 10
6～1 * 10
7Individual/mL.Get 500 μ l cell suspensions, the cyclic plasmid pTM-hSA2 to wherein adding the 12 μ g that filter through 0.22 μ m strainer mixes, join in the 4mm electricity revolving cup of precooling, leave standstill on ice and put into electroporation behind the 5min and shock by electricity pulsed voltage 220V, electric capacity 950 μ F.After the electric shock, leave standstill 10min on ice, cell suspension is moved in the culture plate of the 100mm that is added with nutrient solution, 37 ℃, 5%CO
2Cultivate.Behind cell attachment, PBS washes 3 times, adds OPTI-MEM dilution TAT-Cre (final concentration 2 μ M), processes and changes normal nutrient solution continuation cultivation after 3 hours.After 24 hours, peptic cell reaches in 6-8 the 100mm Tissue Culture Plate, and (final concentration: 0.08 μ g/ml) the pressurization screening is 7 days for tetracycline.Utilize clone's ring that monoclonal cell is transferred in the 96 porocyte culture plates, according to the cell mode that normally goes down to posterity it is cultivated, after the cell in 48 holes covers with, digestion is divided into two parts, a for integrating evaluation, it is also frozen that portion continues enlarged culturing, for somatic cell clone is prepared.
The result identifies
The synthetic following primer of design detects picking clone's 5 ' end, 3 ' end and key element (functional gene, selection markers gene) thereof.
Table 6
Plasmid pTM-hSA2 transfection rhlyzGFC obtains 25 clones altogether, extracts genome, and utilizes method (4 ℃ of denaturation 5min of pcr amplification; 94 ℃ of sex change 30s, renaturation 30s (annealing temperature is with reference to upper table), 72 ℃ are extended 30s, totally 30 circulations; Last 72 ℃ are extended 5min; ) its 5 ' end (Figure 33), 3 ' end (Figure 34), functional gene (Figure 35) and marker gene (Figure 36) are detected, detected result gained positive colony is 1,11,14,20,21, totally 5, the location recombination efficiency is: 5/25=20%.The positive colony that filters out is increased, and product send the order-checking of Invitrogen company, and sequencing result (Figure 39, Figure 40) is consistent with theoretical sequence (Figure 37, Figure 38), shows successfully to realize the location restructuring.
Figure 33 is picking clonal cell line 5 ' end electrophoresis detection figure; M1 is D2000; 1,2,8-24 is picking clone 5 ' end electrophoresis detection figure, wherein 11,12,14,20,21,1,2 is positive; 26,5 positive contrasts; 27,6 negative contrasts; Figure 34 is picking clonal cell line 3 ' end electrophoresis detection figure; M1 is D2000; 1-4,8-25 are picking clone 3 ' end electrophoresis detection figure, and wherein 11,14,17,20,21,1 is positive; 26,5 positive contrasts; 27,6 negative contrasts; Figure 35 is that screening and cloning cell strain functional gene detects collection of illustrative plates; M is 1kb DNA Ladder; 1 is screening and cloning marker gene detection collection of illustrative plates; Figure 36 screening and cloning cell strain marker gene detects collection of illustrative plates; M is D2000; 1,2 for the screening and cloning marker gene detects collection of illustrative plates, and 1 is the location recombinant clone; 3: positive control; 4: negative control; The theoretical sequence of Figure 37 human serum albumin location recombinant clone 5 ' end restructuring; The theoretical sequence of Figure 38 human serum albumin location recombinant clone 3 ' end restructuring.
The somatic cell clone of embodiment 10 positioning integration cell clones
1. ovocyte preparation and acceptor sheep is synchronous
Pick out the ewe intramuscular injection PG 0.1mg/ head as the ovocyte donor, for the second time PG was injected at the interval in 10～14 days afterwards, injected PG in the second time and began super row after 10～13 days, i.e. intramuscular injection FSH at first, minutes 6 times, 2 times/days, consumption is 100IU every day, 80IU, 80IU.When injecting FSH the last time, inject a PG (0.1mg/ head), the interval is time injection LRH after 24 hours, 25 μ g/ time, 26～28 hours recovery ovocytes behind the injection LRH.
For synchronous with the donor sheep that ovocyte is provided, acceptor sheep interval 9～11 days is intramuscular injection PG at twice, and behind the super row's injection of donor sheep PG 24 hours, acceptor was also injected PG simultaneously, the same donor of Time and dosages of acceptor injection LRH.
The surgical exposure uterine tube rushes ovoscopy under ovum, the stereoscope with the F-10 nutritive medium.Hyaluronic acid enzymic digestion granulosa cell, M16 are washed 4～5 times, put in M16 side's cup and cultivate, and be for subsequent use.
2. the hunger of donor cell is processed
Treating that hungry cell is inoculated in the 35mm plate.When treating that Cell abundance reaches 70%～75% left and right sides, suck nutrient solution, add the DMEM liquid that contains 0.5%FCS, after hungry 5 days, conventional method digestion collecting cell.Then be put in-85 ℃ of refrigerators and preserve.Tested front 6 days in nuclear transplantation, take out 2 tubules recoveries and be inoculated in 4 orifice plates.Cultivate hunger after 2 days or 3 days, hungry method is the same again.
3. the preparation of reconstruct ovum and activation
4. the transplanting of the embedding of reconstruct ovum, recovery and embryonic development
Agarose embedding reconstruct ovum with 1%, and be implanted in the uterine tube, culturing in vivo after 5 days is gone out adhesive tape, and the embryo in the adhesive tape is peeled off out, selects to grow to mulberry fruit and blastula embryo, is transplanted to acceptor sheep intrauterine, calculates mulberry fruit and blastocyst rate.
5. reconstruct egg development rate and pregnancy rate
Salmon calcitonin see calcimar positioning integration cell is got 39 of ovum donor goats altogether, gets 462 pieces on ovum; Being used for nuclear transplantation ovum number is 423 pieces, merges altogether 387 pieces, and fusion rate 91.56% (387/423) activates 355 pieces of reconstructed embryos, 227 pieces of embeddings, 127 pieces of directly transplantings.After the embedding, reclaim altogether 216 pieces, the rate of recovery 95.15%; Several 203 pieces of the spilting of an egg, spilting of an egg rate 93.98%, several 114 pieces of proper splitting accounts for 52.78% of total division number; Obtain totally 48 pieces of mulberry blastaeas, mulberry blastaea rate 22.22%, 27 of uterine transplantation acceptors; Uterine tube directly transplanting receptor 12 is only transplanted 10-12 piece of reconstructed embryo for every; The co-transplantation receptor 39 (GPR 39) only.30-35 days ultrasound diagnosis results: 9 pregnancies (pregnancy rate 33.3%) in uterine transplantation mulberries, 27 acceptors of blastaea; 12 receptor 11s of common oviduct transplantation 1-2 cell only conceived (pregnancy rate 91.7%).Add up to 39 acceptors, 20 pregnancies (pregnancy rate 51.3%).
Serum albumin is expressed the positioning integration cell of member, gets altogether 32 of ovum donors, gets 441 pieces on ovum; 5.2 401 pieces of nuclear transplantation, for merging 375 pieces, fusion rate 92.27% (346/375) activates 338 pieces, 338 pieces of directly transplantings.35 of uterine tube directly transplanting acceptors are transplanted 8-12 piece of reconstructed embryo for every.Transplant the detection of rear 32 days B ultrasonic gestation and show 20 pregnancies are arranged, pregnancy rate 57.1%.
The above results shows, the somatic cell clone effect of positioning integration cell is normal, all the efficient with non-positioning integration somatic cell clone is consistent for each link index such as reconstructed embryo fusion rate, spilting of an egg rate, mulberry fruit blastocyst rate and acceptor pregnancy rate, show somatocyte that positioning integration processes to after somatic cell clone without obvious detrimentally affect, available preparation Somatic Cloned Goats.
All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. the loxP element of a variation is characterized in that, the loxP element of described variation has the sequence shown in the SEQ ID NO.:30.
2. a construction is characterized in that, described construction from 5 ' to 3 ' contains following element successively:
(a) the loxP element of variation claimed in claim 1;
(b) exogenous gene expression box and/or selection markers expression cassette;
(c) has the wild-type loxP element of sequence shown in the SEQ ID NO.:28;
Wherein, element (a) and element (c) can exchange.
3. construction as claimed in claim 2 is characterized in that, described foreign gene is selected from lower group: lysozyme gene, salmon's calcitonin gene or Serum Albumin Gene.
4. construction as claimed in claim 2 is characterized in that, element (a) and element (c) are for arranging in the same way.
5. a carrier is characterized in that, described carrier contains construction claimed in claim 2.
6. a host cell is characterized in that, described host cell contains construction claimed in claim 2, or its chromosomal integration has one or more constructions claimed in claim 2.
7. host cell as claimed in claim 6 is characterized in that, described host cell is goat adult somatocyte or Goat Fetus somatocyte or Goat Embryos stem cell.
8. host cell as claimed in claim 6, it is characterized in that described host cell is with being selected from lower group method with construction transfered cell claimed in claim 2: homologous recombination method, microinjection, electroporation, liposome transfection method, calcium phosphate precipitation method, virus infection method or sperm vector method.
9. a method for preparing transgenic animal is characterized in that, comprises step:
(i) under the condition that the Cre recombinase exists, transform cell claimed in claim 6 with carrier claimed in claim 5;
(ii) be animal body with the cell regeneration that transforms, thereby obtain transgenic animal.
10. method as claimed in claim 9 is characterized in that, step (i) comprises step:
(i-1) Cre expression of enzymes carrier and carrier cotransformation claimed in claim 5 cell claimed in claim 6; Or
(i-2) under the effect of the TAT-Cre recombinant protein with cell-penetrating activity, with carrier claimed in claim 5 the karyomit(e) of cell claimed in claim 6 is carried out gene integration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210090470.2A CN103361342B (en) | 2012-03-30 | 2012-03-30 | A kind of method and its application of transgenosis positioning integration |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210090470.2A CN103361342B (en) | 2012-03-30 | 2012-03-30 | A kind of method and its application of transgenosis positioning integration |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103361342A true CN103361342A (en) | 2013-10-23 |
| CN103361342B CN103361342B (en) | 2019-01-25 |
Family
ID=49363600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210090470.2A Active CN103361342B (en) | 2012-03-30 | 2012-03-30 | A kind of method and its application of transgenosis positioning integration |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103361342B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015042895A1 (en) * | 2013-09-28 | 2015-04-02 | 上海杰隆生物工程股份有限公司 | Method for positioning and integrating transgene and use thereof |
| CN106434750A (en) * | 2016-09-26 | 2017-02-22 | 湖南农业大学 | Target targeting vector, method for constructing mouse embryonic stem cell strain through targeting integration of exogenous genes to MYH9 Intron2 locus and application |
| CN106978416A (en) * | 2016-01-18 | 2017-07-25 | 上海杰隆生物工程股份有限公司 | A kind of assignment of genes gene mapping integrant expression system and its application |
| WO2021068779A1 (en) * | 2019-10-08 | 2021-04-15 | 黄菁 | Method for site-directed integration of large-fragment foreign dna |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4206154B2 (en) * | 1997-11-13 | 2009-01-07 | 大日本住友製薬株式会社 | Mutant loxP sequence and its application |
| JP5481661B2 (en) * | 2008-10-23 | 2014-04-23 | 学校法人福岡大学 | Mutation gene production method |
-
2012
- 2012-03-30 CN CN201210090470.2A patent/CN103361342B/en active Active
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015042895A1 (en) * | 2013-09-28 | 2015-04-02 | 上海杰隆生物工程股份有限公司 | Method for positioning and integrating transgene and use thereof |
| US10036041B2 (en) | 2013-09-28 | 2018-07-31 | Shanghai Genon Bioengineering Co., Ltd | Method for positioning and integrating transgene and use thereof |
| CN106978416A (en) * | 2016-01-18 | 2017-07-25 | 上海杰隆生物工程股份有限公司 | A kind of assignment of genes gene mapping integrant expression system and its application |
| CN106434750A (en) * | 2016-09-26 | 2017-02-22 | 湖南农业大学 | Target targeting vector, method for constructing mouse embryonic stem cell strain through targeting integration of exogenous genes to MYH9 Intron2 locus and application |
| CN106434750B (en) * | 2016-09-26 | 2019-06-07 | 湖南农业大学 | Target the methods and applications of targeting vector and targeted integration foreign gene to the building mouse embryo stem cell strain of the site MYH9 Intron2 |
| WO2021068779A1 (en) * | 2019-10-08 | 2021-04-15 | 黄菁 | Method for site-directed integration of large-fragment foreign dna |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103361342B (en) | 2019-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220338452A1 (en) | Organ regeneration method utilizing blastocyst complementation | |
| JP2020124228A (en) | Fertile transgenic animals useful for producing antibodies bearing human variable regions | |
| US7459600B2 (en) | Isolation, selection and propagation of animal transgenic stem cells | |
| CN103068993A (en) | Hybrid light chain mice | |
| CN103361342A (en) | Method for positioning and integrating transgenosis and application thereof | |
| CN106978416B (en) | Gene positioning integration expression system and application thereof | |
| JP4300287B2 (en) | Induction of germ line differentiation by transplantation of isolated primordial germ cells | |
| CN112280800B (en) | Construct and application thereof in preparation of medicines for tracing and removing aged cells of animals | |
| JP4845073B2 (en) | Method for producing reconstructed fertilized egg and method for producing transgenic embryo using the same | |
| CN101608186B (en) | Method for preparing transgenic goat with high expression of human lactoferrin by somatic cell transfection | |
| Naito | Genetic manipulation in chickens | |
| JP5771240B2 (en) | Immunodeficient pig | |
| CN112553194B (en) | Preparation method and application of KIT gene modified non-human animal | |
| US10036041B2 (en) | Method for positioning and integrating transgene and use thereof | |
| CN101603045B (en) | Human lysozyme efficiently produced by utilizing mammary gland of domestic animal | |
| US7115796B2 (en) | Transgenic pig containing heat shock protein 70 transgene | |
| KR20040101793A (en) | Transgenic cloned cow producing human erythropoietin and method for producing the same | |
| US20030208785A1 (en) | Transgenic pig containing heat shock protein 70 transgene | |
| KR100502695B1 (en) | A method for mass production of cloned embryos for improving transgenesis in animals | |
| JP2004518405A (en) | Somatic cell cloning gene transfer to produce recombinant proteins, cells, and organisms | |
| KR100975350B1 (en) | Transgenic cloned cow producing human lactoferricin and method for producing the same | |
| Luche | Towards the identification of the thymus seeding progenitor:" fate mapping" of early T-cell stages using gene" knock-in" strategies | |
| WO2006022361A1 (en) | Psf1 GENE-DEFICIENT ANIMAL AND METHOD OF USING THE SAME | |
| KR20050055937A (en) | Transgenic cloned cow expressing the prion variant and method for producing the same | |
| Luche | Towards the identification of the thymus seeding progenitor:" fate mapping" of early T-cell stages using gene" knock-in" strategies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200820 Address after: 201210 Shanghai city Pudong New Area Cailun Road No. 88 Patentee after: SHANGHAI TRANSGENICS RESEARCH CENTER Address before: 201210 Shanghai city Pudong New Area Cailun Road No. 88 Co-patentee before: SHANGHAI TRANSGENICS RESEARCH CENTER Patentee before: SHANGHAI GENON BIOENGINEERING Co.,Ltd. |