CN110129228B

CN110129228B - Preparation method of nocardia competent cells and nocardia gene editing method

Info

Publication number: CN110129228B
Application number: CN201910409358.2A
Authority: CN
Inventors: 夏立群; 王文基; 鲁义善; 侯素莹; 谭万春; 陈建林
Original assignee: Shenzhen Yihai Biotechnology Co ltd; Guangdong Ocean University; Shenzhen Research Institute of Guangdong Ocean University
Current assignee: Shenzhen Yihai Biotechnology Co ltd; Guangdong Ocean University; Shenzhen Research Institute of Guangdong Ocean University
Priority date: 2019-05-16
Filing date: 2019-05-16
Publication date: 2023-06-06
Anticipated expiration: 2039-05-16
Also published as: CN110129228A

Abstract

The invention provides a preparation method of nocardia competent cells and a nocardia gene editing method. The nocardia competent cell preparation method adopts lysozyme to treat nocardia, so that the thickness of the nocardia cell wall is reduced, and finally the nocardia competent cell which is easy to accept exogenous DNA is prepared. The method for editing the nocardia gene of the invention applies the CRISPR/Cas9 system to the nocardia for the first time, constructs the CRISPR/Cas9 gene editing plasmid and converts the CRISPR/Cas9 gene editing plasmid into the nocardia to edit the target gene, has simple and quick operation and higher application value, and lays a foundation for researching the function of the nocardia gene, constructing the nocardia gene deletion strain and preparing the nocardia gene deletion strain vaccine.

Description

Preparation method of nocardia competent cells and nocardia gene editing method

Technical Field

The invention relates to the field of molecular biology, in particular to a preparation method of nocardia competent cells and a nocardia gene editing method.

Background

Nocardia sericata is the main pathogenic bacteria of nocardia sericata in aquaculture, and when the immunity of fish is low, fish can be infected by bait, gill or wound. Nocardia sericata belongs to the genus nocardia of the order nocardiaceae, and is gram positive bacteria in taxonomy. Nocardia made of fish is a facultative intracellular parasitic bacterium, and in the course of its infection, the bacterium is phagocytized by fish phagocytes, mainly macrophages. Nocardia sericata can survive in macrophages and spread to infect various organs of fish body with migration of macrophages. The strain can mainly cause white nodules generated by the internal organs of fish, so that the fish is slow in movement, low in appetite and low in immunity, and further death is caused. The Nocardia of the fish can infect more than 20 sea and freshwater fishes such as snakeheads, oval pompanos, large yellow croakers and the like, so that the fishes die chronically, or the commercial value of the fishes is reduced due to the induction of body surface ulcers, huge losses are brought to the aquaculture industry, the morbidity is increased year by year, and the damage to the fish aquaculture industry is more serious, so that the research on the function of Nocardia genes by means of molecular biology and the deep understanding of the pathogenesis of Nocardia of the Seriolae are needed.

The cell wall of nocardia mainly comprises peptidoglycan, lipoteichoic acid, cell wall protein and the like, the cell wall is thicker, the common methods for preparing competent cells at present mainly comprise a calcium chloride method, a glycerol-polyethylene glycol method, a rubidium chloride method and the like, but the methods basically do not work for nocardia, that is, nocardia competent cells capable of effectively absorbing exogenous DNA cannot be prepared by adopting the methods.

CRISPR (Clustered Regulatory Interspaced Short Palindromic Respeats, CRISPR) is one of the biological defense systems widely found in bacteria and archaea and is an immune mechanism for bacteria to degrade invading viral DNA or other foreign DNA. CRISPR systems are classified into type I, type II and type III systems, which require CRISPR-related proteins (Cas proteins) to work together, wherein the modified type II system CRISPR/Cas9 is now a widely used genetic modification tool, CRISPR/Cas9 is mediated by a single guide RNA (sgRNA), one part of which is a sgRNA anchor sequence, which can be designed according to different genes and sites of interest, and the other part of which is an intrinsic sequence, which is typically a sgRNA-tracr sequence designed on a plasmid, and Cas9 protein recognizes PAM (protospacer adjacent motif, PAM) and its upstream 20bp sequence on the genome and creates a double-stranded nick at the location of the sgRNA anchor sequence upstream of PAM, thereby achieving the purpose of gene editing and studying gene functions. However, there is no current study to apply CRISPR/Cas9 technology to nocardia.

Disclosure of Invention

The invention aims at providing a preparation method of nocardia competent cells, which can prepare nocardia competent cells which are easy to accept exogenous DNA, and the method is simple and convenient to operate and has higher application value.

The invention also aims to provide a nocardia gene editing method which is simple and quick to operate and has higher application value, and lays a foundation for researching nocardia gene functions, constructing nocardia gene deletion strains and preparing nocardia gene deletion strain vaccines.

To achieve the above object, the present invention provides a method for preparing nocardia competent cells, comprising:

taking nocardia bacteria liquid in logarithmic growth phase in a centrifuge tube, centrifuging for collecting nocardia bacteria for the first time, washing the bacteria with sterile water or sterile water solution, re-suspending the bacteria for the first time with sterile water or sterile water solution, adding lysozyme into the re-suspended bacteria for treatment, centrifuging for collecting nocardia bacteria for the second time after treatment, and re-suspending the bacteria for the second time with sterile water or sterile water solution to obtain nocardia competent cells.

Alternatively, the final mass concentration of lysozyme is 100. Mu.g/ml to 300mg/ml after the lysozyme has been added to the resuspended cells.

Alternatively, the time of post-treatment by lysozyme is 0.3-5 hours.

The invention also provides a nocardia gene editing method, which comprises the following steps:

step a, determining a target gene to be edited in nocardia, obtaining an sgRNA anchoring sequence of the target gene, providing a Cas9 vector, and inserting the sgRNA anchoring sequence into the Cas9 vector to obtain a CRISPR/Cas9 gene editing plasmid;

step b. Preparing nocardia competent cells according to the preparation method of nocardia competent cells as described above;

c, converting the CRISPR/Cas9 gene editing plasmid into the nocardia competent cells, resuscitating and culturing the converted nocardia competent cells, coating bacterial liquid after resuscitating and culturing on the surface of a solid culture medium containing antibiotics, and screening positive clones.

Alternatively, the method of conversion is electrical conversion.

Optionally, the parameters of the electrical conversion are: the voltage is 150-300V, the pulse interval time is 600-1500ms, the pulse duration is 60-150 mu s, and the square wave is 20-40.

Optionally, the step a further includes: inserting homologous arm fragments amplified from the sgRNA anchor sequence of the target gene and upstream and downstream of the corresponding PAM site, respectively, into the Cas9 vector.

Alternatively, the sgRNA anchor sequence of the gene of interest is designed by means of a CRISPR online design tool.

Alternatively, the Cas9 vector is a pCRISPomyces-2 plasmid.

The invention also provides an application of the nocardia gene editing method in researching nocardia gene functions, constructing nocardia gene deletion strains and preparing nocardia gene deletion strain vaccines.

The invention has the beneficial effects that:

the nocardia competent cell preparation method adopts lysozyme to treat nocardia, so that the thickness of the nocardia cell wall is reduced, and finally the nocardia competent cell which is easy to accept exogenous DNA is prepared.

The method for editing the nocardia gene of the invention applies the CRISPR/Cas9 system to the nocardia for the first time, firstly prepares the CRISPR/Cas9 gene editing plasmid, and introduces the CRISPR/Cas9 gene editing plasmid into nocardia competent cells prepared by the method to edit the target gene.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 shows a map of pCRISPomyces-2 plasmid used in the examples of the present invention;

FIG. 2 illustrates a homologous recombination repair process according to an embodiment of the present invention;

FIG. 3A shows positive clonal colonies of a knocked-out 2816 gene obtained in an embodiment of the invention;

FIG. 3B shows positive clone colonies obtained by the examples of the present invention that knocked out 3141 gene;

FIG. 3C shows a negative control blank plate obtained in an embodiment of the present invention;

FIG. 4 shows the results of PCR identification of whether positive clonotypes are Nocardia or not according to an embodiment of the present invention;

FIG. 5 shows the results of PCR identification of whether positive clones were transferred into plasmids according to the examples of the present invention;

FIG. 6A shows the sequencing results of positive clones of the knocked-out 2816 gene of an embodiment of the present invention;

FIG. 6B shows the sequencing results of positive clones knocked out of 3141 gene according to an embodiment of the present invention.

Detailed Description

The following description of the present invention will be made clearly and fully, and it is apparent that the embodiments described are some, but not all, of the embodiments of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

When an equivalent, concentration, or other value or parameter is expressed as a range, preferred range, or a range bounded by a list of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when ranges of "1 to 5" are disclosed, the described ranges should be construed to include ranges of "1 to 4", "1 to 3", "1 to 2 and 4 to 5", "1 to 3 and 5", and the like. When a numerical range is described herein, unless otherwise indicated, the range is intended to include its endpoints and all integers and fractions within the range.

The invention firstly provides a preparation method of nocardia competent cells, which comprises the following steps:

Preferably, after the nocardia cells are collected by centrifugation for the first time, the cells are washed with sterile water a plurality of times, and then resuspended for the first time with sterile water.

Optionally, after the nocardia thalli is collected by the second centrifugation, the thalli is resuspended for the second time by adopting a sterile aqueous solution, wherein the sterile aqueous solution is a glycerol aqueous solution, and the mass percentage of the glycerol in the glycerol aqueous solution is 5% -20%.

Specifically, the culturing method of the nocardia fluid in the logarithmic growth phase comprises the following steps: and inoculating nocardia to the surface of a solid culture medium, after single colony grows out, picking single colony into a liquid culture medium, and culturing until the growth phase is logarithmic. Preferably, the method of inoculating nocardia to the surface of the solid medium is streak inoculation.

Preferably, after a second resuspension of the cells, the nocardia competent cells obtained are dispensed into 1.5ml centrifuge tubes, each containing 500 microliters.

Preferably, the temperature of the first centrifugation and the second centrifugation is 2-6 ℃.

Preferably, after adding lysozyme to the resuspended cells, the final mass concentration of lysozyme is 100. Mu.g/ml to 300mg/ml (e.g., 100. Mu.g/ml, 500. Mu.g/ml, 1mg/ml, 10mg/ml, 100mg/ml, 200mg/ml, 300 mg/ml), and the time for post-treatment with lysozyme to the resuspended cells is 0.3 to 5 hours, during which the vessel (e.g., centrifuge tube) holding the cells is gently shaken every 10 to 30 minutes.

Specifically, the solid medium may be brain heart infusion (Brain Heart Infusion, BHI) solid medium (available from guangdong-cyclokava microbiology inc.).

Specifically, the liquid medium may be BHI liquid medium.

The nocardia competent cell preparation method of the invention reduces the thickness of the nocardia cell wall by adopting lysozyme to treat nocardia, and prepares the nocardia competent cell which is easy to accept exogenous DNA by fumbling the treatment time and the treatment concentration of lysozyme.

Based on the preparation method of the nocardia competent cells, the invention also provides a nocardia gene editing method, which comprises the following steps:

step a, determining a target gene to be edited in nocardia, obtaining an sgRNA anchoring sequence of the target gene, providing a Cas9 vector, and inserting the sgRNA anchoring sequence into the Cas9 vector to obtain a CRISPR/Cas9 gene editing plasmid.

Specifically, the sgRNA anchoring sequence of the target gene can be designed by means of a CRISPR online design tool, an oligonucleotide fragment is synthesized according to the sgRNA anchoring sequence, and the oligonucleotide fragment is inserted into a Cas9 vector to obtain the CRISPR/Cas9 gene editing plasmid.

Specifically, the website of the CRISPR online design tool is http:// www.e-crisp.org/E-CRISP/. Finding out a proper PAM site of a target gene according to a CRISPR online design tool, and designing a proper sgRNA anchoring sequence according to the PAM site, wherein the sgRNA anchoring sequence comprises the PAM site and an upstream 17-22b p sequence thereof. PAM is known to be the 5' -NGG sequence of the gene of interest, and CRISPR targeting specificity is determined by two parts, one part being base pairing between the sgRNA anchor sequence and the target DNA, and the other part being Cas9 protein and PAM, cleavage of the gene of interest by Cas9 protein occurs 17-22bp upstream of PAM.

The key to the success of CRISPR/Cas9 is the design of the sgRNA anchoring sequence, which leads to higher off-target efficiency due to excessive nonspecific binding with non-target regions, and particularly 8-10bp close to PAM cannot have high homology with non-target genes.

In one embodiment of the present application, a 21-26bp oligonucleotide fragment is synthesized from the engineered sgRNA anchor sequence, the synthesized oligonucleotide fragment comprising an upstream ACGC sticky end and a downstream AAAC sticky end. The synthesized oligonucleotide fragment was inserted into a Cas9 vector, which was the original pcricomyces-2 plasmid (purchased from Addgene, usa), by golden gate (Golden Gate Assembly), the map of which pcricomyces-2 plasmid was shown in fig. 1, and the synthesized 21-26bp oligonucleotide fragment was ligated to pcricomyces-2 plasmid at the cleavage site formed by the cleavage of the two Bbsl preceding the sgRNA-tracr, which was the intrinsic sequence of the sgRNA, and the sgRNA was constructed on the pcricomyces-2 plasmid. The golden gate rule reaction system is shown in Table 1 and the golden gate rule reaction program is shown in Table 2.

TABLE 1 golden gate rule system

TABLE 2 golden gate rule reaction procedure

Specifically, to ensure that the gene editing is repaired by homologous recombination, the step a further includes: inserting homologous arm fragments amplified from the sgRNA anchor sequence of the target gene and upstream and downstream of the corresponding PAM site, respectively, into the Cas9 vector.

Specifically, the homology arms of 0.3-1.5kb sequences, namely an upstream homology Arm (Up-Arm) and a downstream homology Arm (Dn-Arm), can be amplified from the sgRNA anchoring sequence of the target gene and the upstream and downstream of the corresponding PAM site respectively, and the upstream homology Arm and the downstream homology Arm are connected together through overlapping PCR and inserted into a single XbaI site of the pCRI SPomyces-2 plasmid to construct the complete CRISPR/Cas9 gene editing plasmid. After the target gene is sheared, the upstream homology arm and the downstream homology arm sequences carried by the CRISPR/Cas9 gene editing plasmid repair the target gene in a homologous recombination mode, and the method is particularly shown in figure 2.

Step b. Nocardia competent cells are prepared according to the preparation method of nocardia competent cells as described above.

Specifically, the steps a and b may be performed simultaneously or in any order.

Specifically, a tube of nocardia competent cells obtained in the step b is taken, a proper volume of pCRISPomyces-2 plasmid obtained in the step a is added into a centrifuge tube for transformation.

Specifically, the transformation method is electric transformation, a special electric rotating cup is not needed for an electric transformation instrument used for the electric transformation, the electric transformation instrument is convenient to use, and the electric transformation instrument is provided with a high-density matrix needle electrode, so that an electric field with high uniformity and enough strength can be generated under lower voltage, and high transfection efficiency is realized. Setting parameters of an electrotransport converter: the voltage is 150-300V, the pulse interval time is 600-1500ms, the pulse duration is 60-150 mu s, and the square wave is 20-40. Nocardia competent cells were added to a 96-well plate with a pcr ospomyces-2 plasmid mixture of 80-150 μl per well, followed by electrotransformation. After the end of electrotransformation, 80-150. Mu.l of a pre-heated 0.1mM-1mM sucrose/BHI solution at 26-30℃was added to each well of the 96-well plate, and gently mixed. The 96-well plate with the culture medium added thereto was placed in a biochemical incubator and resuscitated for 12 hours.

80-120 μl of nocardia fluid after 12 hours of resuscitation is aspirated and coated on the surface of BHI solid culture medium containing Apramycin (Apramycin, apr), and positive clones are selected. Apramycin, also called An Pula, has its sulfate as white or off-white crystalline powder, which is readily soluble in water. The antibacterial agent has broad antibacterial spectrum, and has strong effects on most gram-negative bacteria such as Escherichia coli, salmonella, pasteurella, proteus, klebsiella, pseudomonas aeruginosa, brucella and the like; has strong antibacterial activity to some gram-positive bacteria, treponema pallidum, some mycoplasma and the like. The Apramycin has a strong effect on nocardia, the pCRISPomyces-2 plasmid has the resistance of the Apramycin, and the nocardia successfully transformed into the pCRISPomyces-2 plasmid can grow on the surface of BHI solid culture medium containing the Apramycin (Apramycin, apr).

Preferably, another 80-120. Mu.l of nocardia without electric conversion and without mixing pCRISPomyces-2 plasmid was applied to the surface of BHI solid medium containing apramycin as a negative control.

Furthermore, a step of identifying positive clones is also provided after positive clones are obtained on the surface of the BHI solid culture medium containing the apramycin.

Specifically, positive clones were picked up and expanded into 1.5mL centrifuge tubes containing An Pula-resistant BHI broth. Sucking 80-120 mu L of bacterial liquid, coating the bacterial liquid on the surface of a BHI solid culture medium containing An Pula mycin, and repeatedly screening and passaging to about 5-10 generations so as to screen out transformants capable of stable inheritance.

To demonstrate that the positive clones picked were nocardia, 16S rRNA identification of nocardia was performed as follows: the positive cloned and wild nocardia bacterial solution is used as a template, and nocardia 16S rRNA-F and 16S rRNA-R are used as primers to carry out PCR amplification to obtain a nocardia 16S rRNA fragment. The amplified positive clones and PCR products of the 16S rRNA fragment of wild nocardia were identified by agarose gel electrophoresis. And (3) sequencing the PCR products of the 16S rRNA fragments of the positive cloned and the wild nocardia, and then comparing the sequences to prove that the positive cloned is nocardia.

In order to prove that the constructed pCRISPomyces-2 plasmid is successfully transferred into nocardia, respectively taking bacterial liquid of positive cloned seeds, bacterial liquid of wild nocardia and pCRISPomyces-2 plasmid as templates, designing primers on the pCR ISPomyces-2 plasmid for PCR amplification, wherein the primer sequences are primer F: CATTCAGGCTGC GCAACTG; primer R: CGTTTTACAACGTCGTGACTGG. The PCR product is identified by agarose gel electrophoresis, if the bacterial liquid of the positive clone and the pCRISPomyces-2 plasmid are used as templates, DNA fragments with the same size can be amplified, and the bacterial liquid of the wild nocardia can not be amplified to obtain the DNA fragments by using the bacterial liquid of the wild nocardia as templates, the successful transfer of the pCRISPomyces-2 plasmid into the positive clone can be proved.

In order to verify that the gene editing site of the target gene design is subjected to gene editing, the bacterial liquids of positive cloned bacteria and wild nocardia are respectively used as templates, and primers are used for amplifying the open reading frame of the target gene, so that PCR products of the target gene are obtained through amplification.

The PCR product of the purified target gene was incubated at 26-30℃for 0.5-3h according to the TA cloning reaction system of Table 3 and ligated to pMD 18T. The ligated product was transformed into E.coli DH 5. Alpha. Competent cells, and then spread on the surface of ampicillin-containing LB solid medium.

Table 3 TA clone reaction System

Picking single colony on the surface of LB solid medium, and amplifying culturing in liquid LB medium containing ampicillin. Culturing to logarithmic growth phase, delivering bacterial liquid to sequence, and determining the editing effect of target gene according to the sequencing result, wherein the sequencing primer is a universal primer of pMD 18T.

Embodiments of the present invention will be described in detail below with reference to specific examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

In the embodiment of the invention, two target genes in the nocardia seriiolae genome are selected as targeting sequences, and are used for designing sgRNA anchoring sequences and constructing CRISPR/Cas9 gene editing plasmids. The numbers of the two target genes are 2816 and 3141, and the sequences of the 2816 gene and 3141 gene are SEQ ID NO.1 and SEQ ID NO.9 respectively. In the early research, the protein coded by the two genes is a secreted protein and is presumed to be a virulence factor, and the protein plays an important role in pathogenicity of nocardia seriolae, and the embodiment of the invention lays a foundation for further researching the gene functions of nocardia seriolae, constructing a nocardia gene deletion strain and preparing a nocardia gene deletion strain vaccine by knocking out 2816 genes and 3141 genes in nocardia seriolae.

Example 1

Modification of pCRISPomyces-2 plasmid

Step one, finding out suitable acting site PAM sites of 2816 and 3141 genes in Nocardia seriolae genome by means of CRISPR online design tool (http:// www.e-CRISP. Org/E-CRISP /), and designing a suitable sgRNA anchoring sequence according to the P AM site, wherein the sgRNA anchoring sequence is 20bp upstream of the PAM site. The sgRNA anchor sequence of 2816 gene designed according to this step can be any one of SEQ ID NO.2-8, and SEQ ID NO.2 is used in the embodiment of the present invention; the sgRNA anchor sequence of 3141 gene may be any one of SEQ ID NO.10-17, SEQ ID NO.10 being used in the examples of the present invention.

Step two, synthesizing an oligonucleotide fragment of 24bp according to the designed sgRNA anchoring sequence, wherein a primer for synthesizing the oligonucleotide fragment (synthesized by Guangzhou Ai Ji biological company) comprises an upstream ACGC sticky end and a downstream AAAC sticky end. Primer sequences for synthetic oligonucleotide fragments of both 2816 and 3141 genes are shown in Table 4.

TABLE 4 primer sequences for the synthesis of oligonucleotide fragments

Step three, the synthesized 24bp oligonucleotide fragment is respectively inserted into an original pCRISPomyces-2 plasmid (purchased from Addgene corporation in the United states) through a golden gate rule, wherein the map of the pCRISPomyces-2 plasmid is shown in figure 1, and the synthesized 24bp oligonucleotide fragment is connected to an enzyme cutting site formed by the enzyme cutting of two Bbsl before sgRNA-tracr in the pCRISPomyces-2 plasmid through enzyme cutting. The golden gate rule reaction system is shown in table 1, and the golden gate rule reaction program is shown in table 2.

Fourth, in order to ensure that the gene editing is repaired by homologous recombination, the upstream homology arm and the downstream homology arm of the 1kb sequence are amplified from the sgRNA anchor sequences of 2816 and 3141 genes and the upstream and downstream of the corresponding PAM sites, respectively, and the primer sequences for amplifying the homology arms are shown in tables 5 and 6. The upstream homology arm fragment and the downstream homology arm fragment were ligated together by overlapping PCR at a single XbaI site of the pCRISPomyces-2 plasmid, respectively, to construct 2816-pCRISPomyces-2 and 31-pCRISPomyces-2 plasmids of the complete CRISPR/Cas9 gene editing system.

TABLE 5 primer sequences for 2816 Gene amplification homology arms

TABLE 6 primer sequences for amplifying homology arms of 3141 gene

Example 2

Preparation of competent cells of nocardia sericata

Step 1, preserved nocardia seriolae is streaked and inoculated to a BHI solid medium (purchased from Guangdong Cryptographic micro-organism technology Co., ltd.) for inverted culture at 28 ℃. When single colonies were grown on the plates, the single colonies were picked up in 50ml BHI broth, at 28℃and 130rpm to logarithmic growth phase.

Step 2, taking 30ml of Nocardia seriioli reaching the logarithmic growth phase, and collecting bacterial cells in a 50ml centrifuge tube at 4 ℃ and 8000 rpm; respectively washing thalli twice by using 10ml of sterile water, re-suspending the thalli by using 10ml of sterile water, and then adding a proper amount of lysozyme (purchased from Guangzhou Dong biosciences Co., ltd.) into a centrifuge tube, and uniformly mixing to ensure that the final mass concentration of the lysozyme is 5mg/ml; incubate at 28℃for 1 hour at rest, while gently shaking the centrifuge tube every 20 minutes.

Step 3, centrifugally collecting the nocardia seriolae treated by lysozyme at the temperature of 4 ℃ and at the speed of 8000rpm, re-suspending bacterial cells by using 2ml of 10% glycerol, and subpackaging into 1.5ml centrifuge tubes with 500 microliters of each tube to prepare the nocardia seriolae competent cells.

Example 3

Electrotransformation of competent cells and plasmids

Step A, taking two tubes of Nocardia seriolae competent cells prepared in the embodiment 2, adding a proper amount of 2816-pCRISPomyces-2 plasmid obtained by modifying the embodiment 1 into one tube of competent cells, adding a proper amount of 3141-pCRISPomyces-2 plasmid obtained by modifying the embodiment 1 into the other tube of competent cells, and enabling the final concentration of the pCRISPomyces-2 plasmid to be 2 mug/ml, and carrying out ice bath for half an hour.

Step B, adding the nocardia seriolae competent cells and pCRISPomyces-2 plasmid mixture into a 96-well plate, wherein each well is 100 microliters; parameters of an electrotransport machine (purchased from Yida biotechnology Co., suzhou) were set: the voltage is 200V, the pulse interval time is 1000ms, the pulse duration is 100 mu s, the square wave is 30, and the electric conversion is carried out.

After the end of the electrotransfer, 100. Mu.l of a pre-heated 0.3mM sucrose/BHI solution at 28℃was added to each well and gently mixed. The 96-well plates were then placed in a biochemical incubator and resuscitated at 28℃for 12 hours.

Step D, absorbing 100 mu l of nocardia seriolae bacteria liquid after 12 hours of resuscitation, coating the nocardia seriolae bacteria liquid on the surface of a BHI solid culture medium containing An Pula mycin, and screening positive clones; another 100. Mu.l of North America, which had not been subjected to electrotransformation and had not been mixed with pCRISPomyces-2 plasmid, was plated onto the surface of BHI solid medium containing An Pula mycin as a negative control. The results of solid culture of An Pula-mycin-containing BHI coated with the bacterial liquid were shown in FIGS. 3A to 3C based on the culture at 28 ℃. Wherein FIG. 3A is Nocardia Seriolae delta 2816 transformed with 2816-pCRISPomyces-2 plasmid, FIG. 3B is Nocardia Seriolae delta 3141 transformed with 3141-pCRISPomyces-2 plasmid, wherein the place in the circle in FIG. 3A and FIG. 3B is positive clone, and FIG. 3C is negative control without outgrowth of colony, and the success of CRISPR/Cas9 system construction in Nocardia Seriolae was initially demonstrated.

Example 4

Identification of Positive clones

To further demonstrate that the positive clones in example 3 were indeed obtained from transformation of the modified plasmid in example 1 in nocardia seriolae, further identification of positive clones was required.

Step I, positive clones delta 2816 and delta 3141 are picked respectively and cultured in a 1.5mL centrifuge tube containing 1mL An Pula-mycin-resistant BHI liquid culture medium in an enlarged mode. 100 mu L of bacterial liquid is respectively absorbed, and respectively coated on the surface of a BHI solid culture medium containing An Pula mycin, and the screening is repeated until the passage is about 5 to 10 generations.

Step II, in order to prove that the selected positive cloned seed is Nocardia quinquefolium, 16S rRNA identification of Nocardia quinquefolium is carried out, and the experimental process is as follows: the bacterial solutions of positive clones delta 2816, delta 3141 and Nocardia seriolae Z J0503 are used as templates, and the primer 16S rRNA-F is used: agagttgatcctggcttag and primer 16S rRNA-R: GGTTACCTTCTTACCGACTT PCR amplification was performed to obtain the 16S rRNA fragment of nocardia seriolae ZJ 0503. The PCR reaction system is as follows: mu.l of bacterial liquid, 1. Mu.l of primer 16S rRNA-F, 1. Mu.l of primer 16S rRNA-R, 7. Mu.l of ddH ₂ O, 10. Mu.l Taq mix. The PCR amplification procedure was: 95℃5mi n,95℃30s,55℃1min,72℃1min,35 cycles, 72℃10min,16 ℃. The amplified PCR products of the positive clones Delta2816, delta3141 and 16S rRNA fragment of Nocardia Serratia ZJ0503 were identified by 1% agarose gel electrophoresis, as shown in FIG. 4.

In FIG. 4, lane M represents Marker, lane 1 represents 16S rRNA of Nocardia Serratia, lane 2 represents 16S rRNA of positive clone Δ2816, lane 3 represents 16S rRNA of positive clone Δ3141, and lane 4 represents a negative control without DNA template. As can be seen from FIG. 4, the PCR products of the 16S rRNA fragments of the positive clones delta 2816, delta 3141 and Nocardia seriolae have the same size and length, and the PCR products are subjected to sequence alignment after being sequenced, so that the positive clones delta 2816 and delta 3141 are Nocardia seriolae.

Step III, in order to prove that plasmids 2816-pCRISPomyces-2 and 3141-pCRIS Pomyces-2 constructed in example 1 have been successfully transferred into Nocardia quinquefolium, primers on the pCRISPomyces-2 plasmids are designed for PCR amplification by using bacterial solutions of positive clones delta 2816, delta 3141 and wild strains Nocardia quinquefolium ZJ0503 as templates, respectively, and the primer sequences are respectively primer F: CATTCAGGCTGCGCAACTG; primer R: CGTTTTACAACGTCGTGACTGG. PCR reactionThe system is as follows: 10 μl Taq mix,7 μl ddH ₂ O, 1. Mu.l of primer F, 1. Mu.l of bacterial liquid. The PCR reaction procedure was: 95℃for 5min,95℃for 30S,58℃for 1min,72℃for 1min,35 cycles, 72℃for 5min,16 ℃. The PCR products were identified by 1% agarose gel electrophoresis and the results are shown in FIG. 5.

In FIG. 5, lane M represents Marker, lane 1 represents PCR product of wild type North America ZJ0503 bacterial solution, lane 2 represents PCR product of positive clone Delta2816 bacterial solution, lane 3 represents PCR product of positive clone Delta3141 bacterial solution, lane 4 represents PCR product of 2816-pCRISPomyces-2 plasmid, and lane 5 represents PCR product of 3141-pCRISPomyces-2 plasmid. Wherein, lane 1 has no product, the PCR primer used is the specific primer of pCRISPomyces-2 plasmid, the size of the bands indicated by the vertical arrows in

lanes

2 and 4 is the same, the positive clone delta 2816 is transferred into plasmid 2816-pCRISPomyces-2, the size of the bands indicated by the vertical arrows in

lanes

3 and 5 is the same, and the positive clone delta 3141 is transferred into plasmid 3141-pCRISPomyces-2.

And IV, carrying out gene editing on the target gene in order to verify the gene editing site designed by the target gene, and carrying out sequencing identification on the target gene. The positive clones delta 2816, delta 3141 and bacterial liquid of wild line Nocardia seririli ZJ0503 are respectively used as templates, and primers are used for amplifying a target gene open reading frame, and target gene fragments are amplified, wherein the amplification primer sequence of delta 2816 is delta 2816-F: ACCGACGTTGCGTTCAGA, and delta 2816-R: TACGAATGATGGTTGGGTG; the amplification primer sequence of the delta 3141 is delta 3141-F: TCCGAACAGCGGTTAGAGCG, delta 3141-R: GGCCCAGGTCATCATGTCAGC. PCR reaction system: 10 μl Taq mix,7 μl ddH ₂ O, 1. Mu.l of primer F, 1. Mu.l of primer R, 1. Mu.l of bacterial liquid. PCR reaction procedure: 95℃for 5min,95℃for 30S,58℃for 1min,72℃for 1min,35 cycles, 72℃for 5min,16 ℃. PCR products of 2816 gene and 3141 gene were obtained, respectively.

The PCR products of 2816 gene and 3141 gene were purified respectively, and incubated at 28℃for 1 hour according to the TA cloning reaction system shown in Table 3, and then ligated to different pMD18T to obtain 2816-pMD18T and 3141-pMD18T, respectively. 2816-pMD18T and 3141-pMD18T are respectively and uniformly mixed with 50 mu L of escherichia coli DH5 alpha competent cells, the mixture is subjected to heat shock at 42 ℃ for 90 seconds and then is rapidly placed on ice for 2 minutes in an ice bath, 200 mu L of LB culture medium is added, and after uniform mixing, the mixture is cultured at 37 ℃ for 1 hour at 120r/min and then is coated on the surface of the LB solid culture medium containing ampicillin.

Single colonies on the surface of LB solid medium were picked up and grown in liquid LB medium containing ampicillin (50 mg/ml). Culturing until bacterial growth reaches logarithmic phase, and sequencing. The sequencing primer sequence is sequencing-F: tgtaaaacgacgccagt and sequencing-R: CAGGAAACAGCTATGACC.

The sequencing results are shown in fig. 6A and 6B, fig. 6A is a comparison chart of the sequencing results of 2816 genes, wherein a box 1 is a PAM site of the 2816 genes, a box 2 is an sgRNA anchor sequence, "..+ -." indicates a base deletion, wt is a 2816 gene sequence of wild nocardia sericata ZJ0503, 1-4 are 2816 gene sequences of four selected positive clones delta 2816, and as can be seen from fig. 6A, the sgRNA anchor sequences of positive clones 1-4 are all subjected to base deletion, thus proving successful knockout of the 2816 genes.

FIG. 6B is a diagram showing comparison of sequencing results of 3141 gene, wherein the box 3 is PAM site of 3141 gene, the box 4 is sgRNA anchor sequence, "..degree" shows base deletion, the wt is 3141 gene sequence of wild type Nocardia seriolae, 1-4 are 3141 gene sequences of four selected positive clones delta 3141 respectively, and as can be seen from FIG. 6B, base deletion of sgRNA anchor sequence of positive clones 1-4 is all carried out, thus proving 3141 gene knockout is successful.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

SEQUENCE LISTING

<110> 1. Shenzhen university of sea, guangdong university of sea 2. Guangdong university of sea

3. Shenzhen Yihai biotechnology Co Ltd

<120> method for producing nocardia competent cells and nocardia gene editing method

<130> 2019-04-16

<160> 17

<170> PatentIn version 3.5

<210> 1

<211> 624

<212> DNA

<213> Nocardia seriolae

<400> 1

gtggctgtct acacgctgcc tgaactcgat tacgactact cggccctgga gcccttcatc 60

tccggccaga tcaacgagat ccaccacacc aagcaccacg ccgcctacgt cgcgggtgtc 120

aacgccgccc tcgagaagct cgaggaggcg cgcgccaagg acgaccacgc cgccatcttc 180

ctgaacgaga agaacctcgc gttccacctc ggcggccacg tcaaccactc catctggtgg 240

aagagcctgt ccaaggacgg cggcgacaag ccggtcggcg acctggccgc cgccgtcgac 300

gaggagttcg gctccttcga caagttcgtc gcgcagttct ccgctgcggc caacggcctg 360

cagggctccg gctgggcctg gctgggctac gacaccctgg gcaacaagct gctcaccttc 420

cagctcaccg accagcaggg caacgtgccg ctgggcatca tcccgctgct cggcctggac 480

atgtgggagc acgccttcta cctgcagtac aagaacgtca aggcggacta cgtcaaggcg 540

ttctggaacg tggtgaactg ggccgaaatc caggagcgct acaccaaggc cgtcaaccag 600

ggcaaaggcc tgatcttcgg ctga 624

<210> 2

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 2

ggctcttcca ccagatggag 20

<210> 3

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 3

gagtagtcgt aatcgagttc 20

<210> 4

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 4

caggcctttg ccctggttga 20

<210> 5

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 5

cgaagatcag gcctttgccc 20

<210> 6

<211> 23

<212> DNA

<213> Nocardia seriolae

<400> 6

tacaccaagg ccgtcaacca 20

<210> 7

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 7

aaggccgtca accagggcaa 20

<210> 8

<211> 23

<212> DNA

<213> Nocardia seriolae

<400> 8

tggctgggct acgacaccct 20

<210> 9

<211> 558

<212> DNA

<213> Nocardia seriolae

<400> 9

gtgaagctgc tgaacccgcg ggggttcgga ttggtttgcg catccgcggc cgtggcggcg 60

gggttgatgc tggcgggctg cgcgaacacg gtcgagggta ccccgacggt cgatcaggct 120

caggtgacct cgtaccgggc cgaggtgtcc tcgtccgcgg cggccgccag ttcgtccaag 180

gccgcggcgc aggtcgccaa ggccacggcc gacaactgcg atccgttccg caagaccgcc 240

gggaccgcgg tcgaccgcta caacgagttc gtggacgcgc acgacgccag cgccgcggac 300

caagtggcga agcgggacgc ggcggccggg gcgctcgagg acgcggcgaa gacgatcgag 360

accgagttga acgcgacccg ggcggatctg cccgccgatc tcgcgggcaa gctcaccgac 420

tatgtgaacg cggcgcgctc gctggccgcg gagatccgga agatgtcggg cgggtcgtcg 480

gtggcgccgc tgaacgacgc gagcaagaag gtcaacgacg ctctaaccgc tgttcggaac 540

gcctgcccgg gcaagtga 558

<210> 10

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 10

gcagttgtcg gccgtggcct 20

<210> 11

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 11

acctgagcct gatcgaccgt 20

<210> 12

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 12

cacggtcgag ggtaccccga 20

<210> 13

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 13

cacggtcgag ggtaccccga 20

<210> 14

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 14

aggctcaggt gacctcgtac 20

<210> 15

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 15

ccgcgtcccg cttcgccact 20

<210> 16

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 16

gcggaacgga tcgcagttgt 20

<210> 17

<211> 20

<212> DNA

<213> Nocardia seriolae

<400> 17

ccgcttcgcc acttggtccg 20

Claims

1. A nocardia gene editing method, comprising:

step a, determining a target gene to be edited in nocardia, obtaining an sgRNA anchoring sequence of the target gene, providing a Cas9 vector, and inserting the sgRNA anchoring sequence into the Cas9 vector to obtain a CRISPR/Cas9 gene editing plasmid; the sgRNA anchoring sequence of the target gene is designed by means of a CRISPR online design tool; inserting the oligonucleotide fragment into the Cas9 vector to obtain a CRISPR/Cas9 gene editing plasmid;

step b, preparing nocardia competent cells; the preparation method comprises the following steps:

taking nocardia bacteria liquid in logarithmic growth phase in a centrifuge tube, centrifuging for collecting nocardia bacteria for the first time, washing the bacteria with sterile water or sterile aqueous solution, re-suspending the bacteria for the first time with sterile water or sterile aqueous solution, adding lysozyme into the re-suspended bacteria for treatment, centrifuging for collecting nocardia bacteria for the second time after treatment, and re-suspending the bacteria for the second time with sterile water or sterile aqueous solution to obtain nocardia competent cells;

the sterile aqueous solution is a glycerol aqueous solution, and the mass percentage of glycerol in the glycerol aqueous solution is 5% -20%;

the culturing method of the nocardia liquid in the logarithmic growth phase comprises the following steps: inoculating nocardia to the surface of a solid culture medium, after single colony grows out, picking single colony into a liquid culture medium, and culturing until the growth period of the single colony is logarithmic; wherein, the method for inoculating nocardia to the surface of the solid culture medium is streak inoculation method;

after adding lysozyme into the resuspended thalli, the final mass concentration of the lysozyme is 100 mug/ml-300 mg/ml;

adding lysozyme into the resuspended thallus for 0.3-5 hours, and shaking a container for holding the thallus every 10-30 minutes;

after the thalli are subjected to secondary resuspension, the prepared nocardia competent cells are subpackaged into 1.5ml centrifuge tubes, and 500 microliters of each tube is filled;

the temperature of the first centrifugation and the second centrifugation is 2-6 ℃;

2. The nocardia gene editing method of claim 1, wherein said method of transformation is electrotransformation.

3. The nocardia gene editing method of claim 2, wherein the parameters of the electrotransformation are: the voltage is 150-300V, the pulse interval time is 600-1500ms, the pulse duration is 60-150 mu s, and the square wave is 20-40.

4. The nocardia gene editing method according to claim 1, wherein said step a further comprises: inserting homologous arm fragments amplified from the sgRNA anchor sequence of the target gene and upstream and downstream of the corresponding PAM site, respectively, into the Cas9 vector.

5. The nocardia gene editing method of claim 1, wherein the Cas9 vector is a pCRISPomyces-2 plasmid.

6. Use of the nocardia gene editing method according to any one of claims 1-5 for studying nocardia gene functions, constructing nocardia gene deleted strains, and preparing nocardia gene deleted strain vaccines.