CN110129228A - The preparation method and Nocard's bacillus gene editing method of Nocard's bacillus competent cell - Google Patents
The preparation method and Nocard's bacillus gene editing method of Nocard's bacillus competent cell Download PDFInfo
- Publication number
- CN110129228A CN110129228A CN201910409358.2A CN201910409358A CN110129228A CN 110129228 A CN110129228 A CN 110129228A CN 201910409358 A CN201910409358 A CN 201910409358A CN 110129228 A CN110129228 A CN 110129228A
- Authority
- CN
- China
- Prior art keywords
- nocard
- bacillus
- gene
- competent cell
- gene editing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/355—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Nocardia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The present invention provides the preparation method and Nocard's bacillus gene editing method of a kind of Nocard's bacillus competent cell.The preparation method of Nocard's bacillus competent cell of the invention is handled Nocard's bacillus using lysozyme, to reduce the thickness of nocardial cell wall, the Nocard's bacillus competent cell of acceptant exogenous DNA is finally prepared, this method is simple and efficient to handle, application value with higher.Nocard's bacillus gene editing method of the invention for the first time applies to CRISPR/Cas9 system in Nocard's bacillus, it constructs CRISPR/Cas9 gene editing plasmid and is converted and target gene is edited into Nocard's bacillus, this method is simple and efficient to handle, application value with higher for research Nocard's bacillus gene function, constructs Nocard's bacillus gene-deleted strain and prepares Nocard's bacillus gene delection strain vaccine and lay a good foundation.
Description
Technical field
The present invention relates to molecular biology fields, and in particular to a kind of preparation method and promise of Nocard's bacillus competent cell
Cattell bacterium gene editing method.
Background technique
Yellowtail fish Nocard's bacillus is that the main pathogenic bacteria of aquaculture nocardiasis can lead to when fish immunity power is low
Cross bait, the gill or wound infection.Yellowtail fish Nocard's bacillus belongs to Actinomycetal, Nocardiaceae, Nocardia on taxology, is
Gram-positive bacteria.Yellowtail fish Nocard's bacillus is a kind of facultative bacterial parasite intracellular, and in its course of infection, thallus can be swallowed by fish body
The phagocytosis of cell, mainly macrophage.Yellowtail fish Nocard's bacillus can survive in macrophage, and can be with the migration of macrophage
And diffusive infection is to each organ of fish body.The bacterium can mainly cause fish body internal organ to generate the tubercle of white, lead to fish locomotion
It is slow, loss of appetite, hypoimmunity, and then lead to death.Yellowtail fish Nocard's bacillus can infect snakehead, egg-shaped pompano, Larimichthys crocea
Deng more than 20 kinds of seas, freshwater fishes, lead to fish slow death, or reduce adult fish commodity value due to causing body surface ulcer, gives
Culture fishery brings huge loss, and disease incidence increases year by year in addition, increasingly severe to fish farming industry harm, therefore urgently
The function of Nocard's bacillus gene need to be studied by molecular biology method and understands the nocardial pathogenesis of Yellowtail fish in depth.
Nocardial cell wall is mainly made of peptide glycan, lipoteichoicacid and cell wall protein etc., and cell wall is thicker,
The common method for preparing competent cell at present mainly has Calcium Chloride Method, glycerol-polyethylene glycol method, rubidium chloride method etc., but this
A little methods do not work substantially for Nocard's bacillus, and in other words, can not be prepared at all using these methods effectively to be absorbed
The Nocard's bacillus competent cell of exogenous DNA.
CRISPR (Clustered Regulatory Interspaced Short Palindromic Respeats,
CRISPR) be to be widely present in one of bacterium and archeobacteria biological defensive system, be bacterial degradation invasion viral DNA or
The immunologic mechanism of other exogenous DNAs.CRISPR system is divided into I type system, II type system and type III system, and CRISPR system needs
CRISPR GAP-associated protein GAP (Cas albumen) is wanted to play a role jointly, wherein the II type system CRISPR/Cas9 by transformation becomes existing
In widely used genetic modification tool, CRISPR/Cas9 is situated between by single guidance RNA (single guide RNA, sgRNA)
It leads, sgRNA includes two parts, and a part is sgRNA anchor series, and sgRNA anchor series can be according to different target gene
And site design, another part are intrinsic sequences, intrinsic sequence is usually the sgRNA-tracr sequence designed on plasmid,
PAM (protospacer adjacent motif, PAM) and its upstream 20bp sequence on Cas9 albumen identification genome, and
The sgRNA anchor series position of the upstream PAM generates double-strand notch, to achieve the purpose that gene editing, studies gene function.So
And there has been no correlative studys at present by CRISPR/Cas9 technical application into Nocard's bacillus.
Summary of the invention
The purpose of the present invention, which first consists in, provides a kind of preparation method of Nocard's bacillus competent cell, can prepare appearance
It is easily accepted by the Nocard's bacillus competent cell of exogenous DNA, this method is simple and efficient to handle, application value with higher.
The object of the invention is also to provide a kind of Nocard's bacillus gene editing methods, and this method is simple and efficient to handle, tool
There is higher application value, while being research Nocard's bacillus gene function, building Nocard's bacillus gene-deleted strain and preparation promise
Cattell bacterium gene delection strain vaccine lays the foundation.
In order to achieve the above object, present invention firstly provides a kind of preparation methods of Nocard's bacillus competent cell, comprising:
It takes the Nocard's bacillus bacterium solution in logarithmic growth phase in centrifuge tube, nocardial bacterium is collected by centrifugation for the first time
Body, after washing the thallus using sterile water or aseptic aqueous solution, then using sterile water or aseptic aqueous solution first time resuspension institute
Thallus is stated, lysozyme is then added in the thallus of resuspension and is handled, nocardial bacterium is collected by centrifugation after processing for the second time
Body carries out second to the thallus using sterile water or aseptic aqueous solution and is resuspended, obtains Nocard's bacillus competent cell.
Optionally, in being added in the thallus of resuspension after lysozyme, the final mass concentration of lysozyme is 100 μ g/ml-
300mg/ml。
Optionally, the time that lysozyme post-processing is added in the thallus of resuspension is 0.3-5 hours.
The present invention also provides a kind of Nocard's bacillus gene editing methods, comprising:
Step a., which is determined, needs target gene to be edited in Nocard's bacillus, obtain the sgRNA anchoring of the target gene
Sequence provides Cas9 carrier, and the sgRNA anchor series are inserted into the Cas9 carrier, obtains CRISPR/Cas9 gene and compiles
Collect plasmid；
Step b. prepares Nocard's bacillus competence according to the preparation method of Nocard's bacillus competent cell as described above
Cell；
Step c., which converts the CRISPR/Cas9 gene editing plasmid, to be entered in the Nocard's bacillus competent cell,
Recovery culture is carried out to the Nocard's bacillus competent cell after conversion, the bacterium solution after recovery culture is applied to containing antibiosis
The solid culture primary surface of element is cultivated, screening positive clone.
Optionally, the method for the conversion is electrotransformation.
Optionally, the parameter of the electrotransformation are as follows: voltage 150-300V, interpulse period 600-1500ms, pulse are held
Continuous time 60-150 μ s, square wave 20-40.
Optionally, the step a further include: insertion is anchored from the sgRNA of the target gene in the Cas9 carrier
The homology arm segment that sequence and the upstream and downstream in the corresponding site PAM expand respectively.
Optionally, the sgRNA anchor series of the target gene are obtained by CRISPR Photographing On-line tool design.
Optionally, the Cas9 carrier is pCRISPomyces-2 plasmid.
The present invention also provides a kind of above-mentioned Nocard's bacillus gene editing methods in research Nocard's bacillus gene function, building promise
Cattell bacterium gene-deleted strain and prepare application in Nocard's bacillus gene delection strain vaccine.
Beneficial effects of the present invention:
The preparation method of Nocard's bacillus competent cell of the invention is handled Nocard's bacillus using lysozyme, thus
The thickness of nocardial cell wall is reduced, the Nocard's bacillus competent cell of acceptant exogenous DNA, the party are finally prepared
Method is simple and efficient to handle, application value with higher.
Nocard's bacillus gene editing method of the invention for the first time applies to CRISPR/Cas9 system in Nocard's bacillus, first
CRISPR/Cas9 gene editing plasmid is first prepared, the Nocard's bacillus competent cell prepared using the above method is conducted into
In, target gene is edited in realization, and this method is simple and efficient to handle, application value with higher, for further research
Nocardial gene function, prepares Nocard's bacillus gene delection strain vaccine and provides skill building Nocard's bacillus gene-deleted strain
Art basis.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Fig. 1 shows the pCRISPomyces-2 plasmid map that the embodiment of the present invention uses；
Fig. 2 shows the homologous recombination repair processes of the embodiment of the present invention；
Fig. 3 A shows the positive colony daughter colony of 2816 gene of knockout of acquisition of the embodiment of the present invention；
Fig. 3 B shows the positive colony daughter colony of 3141 gene of knockout of acquisition of the embodiment of the present invention；
Fig. 3 C shows the negative control blank plate of acquisition of the embodiment of the present invention；
What Fig. 4 showed the embodiment of the present invention identifies whether positive clone molecule is nocardial PCR qualification result；
Whether the identification positive clone molecule that Fig. 5 shows the embodiment of the present invention is transferred to the PCR qualification result of plasmid；
Fig. 6 A shows the sequencing result of the positive clone molecule of 2816 gene of knockout of the embodiment of the present invention；
Fig. 6 B shows the sequencing result of the positive clone molecule of 3141 gene of knockout of the embodiment of the present invention.
Specific embodiment
Technical solution of the present invention will be clearly and completely described below, it is clear that described embodiment is this hair
Bright a part of the embodiment, instead of all the embodiments.Based on the embodiments of the present invention, those of ordinary skill in the art are not having
Every other embodiment obtained under the premise of creative work is made, shall fall within the protection scope of the present invention.
Equivalent, concentration or other values or parameter are excellent with range, preferred scope or a series of upper limit preferred values and lower limit
When the Range Representation that choosing value limits, this should be understood as specifically disclosing by any range limit or preferred value and any range
Any pairing of lower limit or preferred value is formed by all ranges, regardless of whether the range separately discloses.For example, when open
When range " 1~5 ", described range should be interpreted as including range " 1~4 ", " 1~3 ", " 1~2 ", " 1~2 and 4~
5 ", " 1~3 and 5 " etc..When numberical range is described herein, unless otherwise stated, otherwise the range is intended to include its end
Value and all integers and score in the range.
Present invention firstly provides a kind of preparation methods of Nocard's bacillus competent cell, comprising:
It takes the Nocard's bacillus bacterium solution in logarithmic growth phase in centrifuge tube, nocardial bacterium is collected by centrifugation for the first time
Body, after washing the thallus using sterile water or aseptic aqueous solution, then using sterile water or aseptic aqueous solution first time resuspension institute
Thallus is stated, lysozyme is then added in the thallus of resuspension and is handled, nocardial bacterium is collected by centrifugation after processing for the second time
Body carries out second to the thallus using sterile water or aseptic aqueous solution and is resuspended, obtains Nocard's bacillus competent cell.
Preferably, multiple using thallus described in sterile water washing after nocardial thallus is collected by centrifugation for the first time, then
The thallus is resuspended using sterile water for the first time.
Optionally, after nocardial thallus is collected by centrifugation for the second time, the thallus is carried out using aseptic aqueous solution
Second of resuspension, the aseptic aqueous solution are glycerine water solution, and the mass percent of glycerol is 5%- in the glycerine water solution
20%.
Specifically, the cultural method of the Nocard's bacillus bacterium solution in logarithmic growth phase are as follows: Nocard's bacillus to be seeded to
Solid culture primary surface, after growing single colonie, picking single bacterium is dropped down onto fluid nutrient medium, culture to logarithmic growth phase.It is preferred that
, it is streak inoculation method by the method that Nocard's bacillus is seeded to solid culture primary surface.
Preferably, the thallus is carried out second after being resuspended, Nocard's bacillus competent cell obtained is dispensed into
In 1.5ml centrifuge tube, every pipe fills 500 microlitres.
Preferably, the temperature of the first time centrifugation and second of centrifugation is 2 DEG C -6 DEG C.
Preferably, in being added in the thallus of resuspension after lysozyme, the final mass concentration of lysozyme is 100 μ g/ml-
300mg/ml (such as 100 μ g/ml, 500 μ g/ml, 1mg/ml, 10mg/ml, 100mg/ml, 200mg/ml, 300mg/ml),
The time that lysozyme post-processing is added in the thallus of resuspension is 0.3-5 hours, during which contains the bacterium every 10-30 minutes jogs
The container (such as centrifuge tube) of body.
Specifically, the solid medium can be brain heart infusion (Brain Heart Infusion, BHI) solid culture
Base (is purchased from Huankai Microbes Tech Co., Ltd., Guangdong).
Specifically, the fluid nutrient medium can be BHI fluid nutrient medium.
The preparation method of Nocard's bacillus competent cell of the invention is reduced by using bacteriolyze enzymatic treatment Nocard's bacillus
The thickness of nocardial cell wall, while the processing time by groping lysozyme and concentration for the treatment of, it is easy to be finally prepared into
Receive the Nocard's bacillus competent cell of exogenous DNA.
Based on the preparation method of above-mentioned Nocard's bacillus competent cell, the present invention also provides a kind of Nocard's bacillus gene editings
Method, comprising:
Step a., which is determined, needs target gene to be edited in Nocard's bacillus, obtain the sgRNA anchoring of the target gene
Sequence provides Cas9 carrier, and the sgRNA anchor series are inserted into the Cas9 carrier, obtains CRISPR/Cas9 gene and compiles
Collect plasmid.
Specifically, the sgRNA anchor series of the target gene can be obtained by CRISPR Photographing On-line tool design,
Oligonucleotide fragment is synthesized according to the sgRNA anchor series, the oligonucleotide fragment is inserted into Cas9 carrier, is obtained
CRISPR/Cas9 gene editing plasmid.
Specifically, the network address of the CRISPR Photographing On-line tool is http://www.e-crisp.org/E-CRISP/.
Suitable sgRNA is designed according to the site PAM in the suitable site PAM that target gene is found out according to CRISPR Photographing On-line tool
Anchor series, the sgRNA anchor series include the site PAM and its upstream 17-22b p sequence.Known PAM is purpose gene
5 '-NGG sequences, CRISPR targeting specific are determined by two parts, and a part is between sgRNA anchor series and target DNA
Base pairing, another part is Cas9 albumen and PAM, and the shearing of target gene occurs in the upstream PAM 17- for Cas9 albumen
The position of 22bp base.
The key of CRISPR/Cas9 success or not is the design of sgRNA anchor series, sgRNA anchor series and non-mesh
The excessive non-specific binding in the mark region efficiency that causes to miss the target is higher, cannot be with non-purpose base especially proximate to the 8-10bp of PAM
Because there is high homology.
In the embodiment of the application, the oligonucleotide of 21-26bp is synthesized according to designed sgRNA anchor series
Segment, the oligonucleotide fragment of synthesis include the ACGC cohesive end of upstream and the AAAC cohesive end in downstream.By synthesis
Oligonucleotide fragment is inserted into Cas9 carrier by Jinmen rule (Golden Gate Assembly), and the Cas9 carrier is original
Beginning pCRISPomyces-2 plasmid (is purchased from U.S. Addgene company), map such as Fig. 1 institute of the pCRISPomyces-2 plasmid
Show, the oligonucleotide fragment of the 21-26bp of synthesis is connected in pCRISPomyces-2 plasmid before sgRNA-tracr
At the restriction enzyme site that two Bbsl digestions are formed, sgRNA-tracr is exactly the intrinsic sequence of sgRNA, in pCRISPomyces-2
Building forms sgRNA on plasmid.Jinmen rule reaction system is shown in Table 1, and Jinmen rule response procedures are shown in Table 2.
1 Jinmen rule system of table
2 Jinmen rule response procedures of table
Specifically, to ensure that gene editing is repaired by homologous recombination mode, the step a further include: described
Insertion expands same respectively from the sgRNA anchor series of the target gene and the upstream and downstream in the corresponding site PAM in Cas9 carrier
Source arm segment.
Specifically, can respectively expand 0.3- from the sgRNA anchor series of target gene and the upstream and downstream in the corresponding site PAM
The homology arm of 1.5kb sequence, respectively upstream homology arm (Up-Arm) and downstream homology arm (Dn-Arm), the upstream is homologous
Arm and downstream homology arm are linked together by over-lap PCR and are inserted into the single site XbaI of pCRI SPomyces-2 plasmid
Place, is built into complete CRISPR/Cas9 gene editing plasmid.After target gene is sheared, CRISPR/Cas9 gene editing
The upstream homology arm and downstream homology arm sequence that plasmid carries repair target gene by way of homologous recombination, specifically
As shown in Figure 2.
Step b. prepares Nocard's bacillus competence according to the preparation method of Nocard's bacillus competent cell as described above
Cell.
Specifically, step a and step b can be carried out simultaneously or be carried out in any order.
Step c., which converts the CRISPR/Cas9 gene editing plasmid, to be entered in the Nocard's bacillus competent cell,
Recovery culture is carried out to the Nocard's bacillus competent cell after conversion, the bacterium solution after recovery culture is applied to containing antibiosis
The solid culture primary surface of element is cultivated, screening positive clone.
Specifically, a pipe is taken to pass through the Nocard's bacillus competent cell that step b is obtained, the step a that appropriate volume is added changes
The pCRISPomyces-2 plasmid made is converted in centrifuge tube.
Specifically, the method for the conversion is electrotransformation, the electroporation that the electrotransformation uses is not necessarily to dedicated electric revolving cup,
It is easy to use, and there is high-density matrix pin electrode, make it at the lower voltage and can generate high uniformity, sufficient intensity
Electric field realizes high transfection efficiency.Electroporation parameter: voltage 150-300V, interpulse period 600-1500ms, pulse persistance is set
Time 60-150 μ s, square wave 20-40.Nocard's bacillus competent cell and pCRISPomyces-2 plasmid mixture are added to
In 96 orifice plates, then 80-150 microlitres of every hole carries out electrotransformation.After electrotransformation, 80-150 μ is added in every hole in 96 orifice plates
L, 0.1mM-1mM sucrose/BHI solution of 26-30 DEG C of preheating, is gently mixed.96 orifice plates of culture solution will have been added to be placed on biochemical training
It supports in case, recovers 12 hours.
Draw 80-120 μ l recover 12 hours after Nocard's bacillus bacterium solution be applied to containing apramycin (Apramycin,
Apr BHI solid culture primary surface), screening positive clone.Apramycin is called peace platenomycin, and sulfate is white
Or off-white color crystalline powder, it is soluble easily in water.Its has a broad antifungal spectrum, to most Gram-negative bacterias for example Escherichia coli, salmonella,
Pasteurella, proteus, klebsiella bacillus, Pseudomonas aeruginosa, brucella etc. have strong effect；To certain Gram-positives
Bacterium, treponema and certain mycoplasmas etc. have stronger antibacterial activity.Apramycin has stronger effect to Nocard's bacillus,
PCRISPomyces-2 plasmid has an apramycin resistance, and the Nocard's bacillus of successful conversion pCRISPomyces-2 plasmid could be
BHI solid culture primary surface growth containing apramycin (Apramycin, Apr).
Preferably, 80-120 μ l is in addition taken not pass through electrotransformation, and the promise without mixing pCRISPomyces-2 plasmid
Cattell bacterium is applied to the BHI solid culture primary surface containing apramycin, as negative control.
Further, it is additionally provided with pair after the BHI solid culture primary surface containing apramycin obtains positive clone molecule
The step of positive clone molecule is identified.
Specifically, picking positive clone molecule contains the BHI fluid nutrient medium for pacifying platenomycin resistance to 0.8-1.2mL
Expand culture in 1.5mL centrifuge tube.It draws 80-120 μ L bacterium solution and is applied to the BHI solid culture base table containing peace platenomycin
Face repeats screening and is passaged to the generation left and right 5-10, to filter out the transformant that can stablize heredity.
In order to prove, the positive clone molecule of picking is Nocard's bacillus, carries out nocardial 16S rRNA identification, experiment
Process is as follows: using positive clone molecule and the nocardial bacterium solution of wild type as template, with Nocard's bacillus 16S rRNA-F and 16S
RRNA-R carries out PCR amplification as primer and obtains nocardial 16S rRNA segment.Expand obtained positive clone molecule and
The PCR product of the nocardial 16S rRNA segment of wild type is identified by agarose gel electrophoresis.Positive clone molecule and wild
The PCR product of the nocardial 16S rRNA segment of type carries out sequence alignment after sending sequencing, it was demonstrated that positive clone molecule is promise Cattell
Bacterium.
In order to prove that the pCRISPomyces-2 plasmid of building is successfully transferred to Nocard's bacillus, respectively with positive clone molecule
The nocardial bacterium solution of bacterium solution, wild type and pCRISPomyces-2 plasmid design pCR ISPomyces-2 matter as template
Primer on grain carries out PCR amplification, and primer sequence is primers F: CATTCAGGCTGC GCAACTG；Primer R:
CGTTTTACAACGTCGTGACTGG.PCR product by agarose gel electrophoresis identify, if the bacterium solution of positive clone molecule and
PCRISPomyces-2 plasmid is the DNA fragmentation that template can amplify same size, and the nocardial bacterium solution of wild type is
Template cannot expand to obtain DNA fragmentation, can prove successfully to be transferred to pCRISPomyces-2 plasmid in positive clone molecule.
In order to which gene editing has occurred in the gene editing site of verifying purpose gene design, respectively with positive clone molecule and open country
For the raw nocardial bacterium solution of type as template, primer is the primer of amplifying target genes open reading frame, and amplification obtains purpose base
The PCR product of cause.
The PCR product for purifying target gene, according to the TA cloning reaction system of table 3,26-30 DEG C of incubation 0.5-3h, connection
Onto pMD18T.Product after connection is transformed into bacillus coli DH 5 alpha competent cell, is then coated on containing ampicillin
LB solid culture primary surface.
3 TA cloning reaction system of table
The single bacterium of picking LB solid culture primary surface, which is dropped down onto, expands culture in the LB liquid medium containing ampicillin.
Bacterium solution is sent out and is sequenced, sequencing primer is the universal primer of pMD18T, judges mesh according to sequencing result to logarithmic growth phase by culture
Gene edit effect.
Embodiment of the present invention is described in detail below in conjunction with specific embodiment, but those skilled in the art
It will be understood that the following example is merely to illustrate the present invention, and it is not construed as limiting the scope of the invention.It is not specified in embodiment
Actual conditions person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer,
It is the conventional products that can be obtained by commercially available purchase.
The embodiment of the present invention chooses two target gene in Yellowtail fish Nocard's bacillus genome as targeting sequence, for setting
Meter sgRNA anchor series simultaneously construct CRISPR/Cas9 gene editing plasmid.The number of two target gene is respectively 2816 Hes
The sequence of 3141,2816 genes and 3141 genes is respectively SEQ ID NO.1 and SEQ ID NO.9.It is sent out in the research of early period
The albumen of existing the two genes coding is all secretory protein, and speculates that it is virulence factor, nocardial to Yellowtail fish pathogenic
Play a significant role, the embodiment of the present invention is further by knocking out 2816 genes and 3141 genes in Yellowtail fish Nocard's bacillus
Research Nocard's bacillus gene function, prepares Nocard's bacillus gene delection strain vaccine and establishes base building Nocard's bacillus gene-deleted strain
Plinth.
Embodiment 1
The transformation of pCRISPomyces-2 plasmid
Step 1: being found out by CRISPR Photographing On-line tool (http://www.e-crisp.org/E-CRISP/)
The site suitable action site PAM of 2816 and 3141 genes, is designed according to the site P AM in Yellowtail fish Nocard's bacillus genome
Suitable sgRNA anchor series, the sgRNA anchor series are PAM site upstream 20bp sequence.According to the 2816 of the design of this step
The sgRNA anchor series of gene can be any one of SEQ ID NO.2-8, and using in embodiments of the present invention is SEQ
ID NO.2；The sgRNA anchor series of 3141 genes can be any one of SEQ ID NO.10-17, in the embodiment of the present invention
Used in be SEQ I D NO.10.
Step 2: synthesizing the oligonucleotide fragment of 24bp according to designed sgRNA anchor series, oligonucleotides are synthesized
The primer (Ai Ji biotech firm synthesizes by Guangzhou) of acid fragment includes the ACGC cohesive end of upstream and the AAAC viscosity end in downstream
End.The primer sequence of the synthesis oligonucleotide fragment of 2816 and 3,141 two genes is shown in Table 4.
The primer sequence of the synthesis oligonucleotide fragment of table 4
Step 3: by the 24bp oligonucleotide fragment of synthesis by Jinmen rule be inserted into respectively it is original
PCRISPomyces-2 plasmid (is purchased from U.S. Addgene company), and the map of the pCRISPomyces-2 plasmid is shown in Fig. 1 institute
Show, the 24bp oligonucleotide fragment of synthesis is connected in pCRISPomyces-2 plasmid before sgRNA-tracr by digestion
At the restriction enzyme site that two Bbsl digestions in face are formed.Jinmen rule reaction system is shown in Table 1, Jinmen rule reaction interval
Sequence is shown in Table 2.
Step 4: to ensure that gene editing is repaired by homologous recombination mode, respectively from 2816 and 3141 genes
The upstream and downstream in sgRNA anchor series and the corresponding site PAM respectively expands the upstream homology arm and downstream homology arm of 1kb sequence, expands
Increase the primer sequence of homology arm as shown in table 5 and table 6.Upstream homology arm segment and downstream homology arm segment are passed through into overlapping respectively
PCR is connected to together at the single site XbaI of pCRISPomyces-2 plasmid, is built into complete CRISPR/Cas9 gene and is compiled
The 2816-pCRISPomyces-2 and 31 41-pCRISPomyces-2 plasmids for the system of collecting.
The primer sequence of 5 2816 gene magnification homology arm of table
The primer sequence of 6 3141 gene magnification homology arm of table
Embodiment 2
The preparation of Yellowtail fish Nocard's bacillus competent cell
The Yellowtail fish Nocard's bacillus sterile working streak inoculation of preservation to BHI solid medium (is purchased from Guangdong ring by step 1
Triumphant microorganism Science and Technology Ltd.), 28 DEG C of inversion cultures.To grow single colonie on plate, sterile working picking single bacterium is dropped down onto
In 50ml BHI fluid nutrient medium, 28 DEG C, 130rpm is cultivated to logarithmic growth phase.
Step 2 takes the 30ml Yellowtail fish Nocard's bacillus for reaching logarithmic growth phase in 50ml centrifuge tube, and 4 DEG C, 8000rpm is received
Collect microorganism；Microorganism twice, then with 10ml sterile water is resuspended with 10ml sterile water difference washing thalline, then to centrifugation
Appropriate lysozyme (purchased from Guangzhou Dongsheng Biotechnology Co., Ltd) is added in pipe to be uniformly mixed, keeps the final mass of lysozyme dense
Degree is 5mg/ml；28 DEG C it is static be incubated for 1 hour, during which every 20 minutes jog centrifuge tubes.
Step 3, in 4 DEG C, 8000rpm is collected by centrifugation by the processed Yellowtail fish Nocard's bacillus of lysozyme, with 2ml10% glycerol
Microorganism is resuspended, is dispensed into 1.5ml centrifuge tube, 500 microlitres of every pipe, Yellowtail fish Nocard's bacillus competent cell is prepared.
Embodiment 3
Electrotransformation is carried out to competent cell and plasmid
Step A, two pipes is taken to pass through the Yellowtail fish Nocard's bacillus competent cell that embodiment 2 is prepared, mono- pipe sense of Yu Qizhong
Obtained 2816-pCRISPomyces-2 plasmid is transformed by the embodiment 1 that appropriate volume is added in state cell, is experienced in another pipe
Obtained 3141-pCRISPomyces-2 plasmid is transformed in the embodiment 1 that appropriate volume is added in state cell, makes
The final concentration of 2 μ g/ml of pCRISPomyces-2 plasmid, ice bath half an hour.
Step B, Yellowtail fish Nocard's bacillus competent cell and pCRISPomyces-2 plasmid mixture are added in 96 orifice plates,
100 microlitres of every hole；Electroporation (reaching Biotechnology Co., Ltd purchased from Suzhou one) parameter: voltage 200V is set, when the pulse spacing
Between 1000ms, 100 μ s of pulse duration, square wave 30, carry out electrotransformation.
Step C, after electricity turns, 100 μ l are added in every hole, and 0.3mM sucrose/BHI solution of 28 DEG C of preheatings is gently mixed.
Then 96 orifice plates are placed in biochemical cultivation case, 28 DEG C are recovered 12 hours.
Step D, the Yellowtail fish Nocard's bacillus bacterium solution after 100 μ l recover 12 hours is drawn to be applied to containing peace platenomycin
BHI solid culture primary surface, screening positive clone；In addition it takes 100 μ l not turn by electricity, and does not mix
The Yellowtail fish Nocard's bacillus of pCRISPomyces-2 plasmid is applied to the BHI solid culture primary surface containing peace platenomycin, as
Negative control.The BHI solid culture containing peace platenomycin for being coated with bacterium solution is based on 28 DEG C of cultures, as a result such as Fig. 3 A- Fig. 3 C
It is shown.Wherein Fig. 3 A is the Yellowtail fish Nocard's bacillus Δ 2816 for having converted 2816-pCRISPomyces-2 plasmid, and Fig. 3 B is conversion
The Yellowtail fish Nocard's bacillus Δ 3141 of 3141-pCRISPomyces-2 plasmid, wherein the place in Fig. 3 A and Fig. 3 B in circle circle be
Positive clone molecule, Fig. 3 C are the negative control for not growing bacterium colony, and preliminary proof constructs CRISPR/ in Yellowtail fish Nocard's bacillus
The success of Cas9 system.
Embodiment 4
The identification of positive clone molecule
In order to further prove the positive clone molecule in embodiment 3 really by having converted embodiment in Yellowtail fish Nocard's bacillus
In 1 obtained by improved plasmid, need further to identify positive clone molecule.
Step I, positive clone molecule Δ 2816 and Δ 3141 are picked them separately to the BHI liquid containing 1mL peace platenomycin resistance
Expand culture in the 1.5mL centrifuge tube of body culture medium.100 μ L bacterium solutions are drawn respectively, are respectively applied to containing peace platenomycin
BHI solid culture primary surface repeats screening and is passaged to the generation left and right 5-10.
Step II, in order to prove, the positive clone molecule of picking is Yellowtail fish Nocard's bacillus, carries out the nocardial 16S of Yellowtail fish
RRNA identification, experimentation are as follows: the bacterium solution with positive clone molecule Δ 2816, Δ 3141 and Yellowtail fish Nocard's bacillus Z J0503 is
Template, with primer 16S rRNA-F:AGAGTTTGATCCTGGCTCAG and primer 16S rRNA-R:
GGTTACCTTCTTACCGACTT obtains the 16S rRNA segment of Yellowtail fish Nocard's bacillus ZJ0503 to carry out PCR amplification.PCR reaction
System are as follows: 1 μ l bacterium solution, 1 μ l primer 16S rRNA-F, 1 μ l primer 16S rRNA-R, 7 μ l ddH2O, 10 μ l Taq mix.PCR
Amplification program are as follows: 95 DEG C of 5mi n, 95 DEG C of 30s, 55 DEG C of 1min, 72 DEG C of 1min, 35 circulations, 72 DEG C, 10min, 16 DEG C preservations.
Expand the PCR product of the 16S rRNA segment of obtained positive clone molecule Δ 2816, Δ 3141 and Yellowtail fish Nocard's bacillus ZJ0503
It is identified by 1% agarose gel electrophoresis, as shown in Figure 4.
In Fig. 4, M swimming lane represents Marker, and 1 swimming lane represents template as the nocardial 16S rRNA of Yellowtail fish, and 2 swimming lanes represent
Template is the 16S rRNA of positive clone molecule Δ 2816, and 3 swimming lanes represent template as the 16S rRNA of positive clone molecule Δ 3141,4
Swimming lane represents the negative control for being free of DNA profiling.As shown in Figure 4, positive clone molecule Δ 2816, Δ 3141 and Yellowtail fish Nocard's bacillus
The PCR product of 16S rRNA segment there is the length of same size, PCR product is sent after sequencing through sequence alignment, it was demonstrated that positive
Clone Δ 2816, Δ 3141 are Yellowtail fish Nocard's bacillus.
Step III, in order to prove embodiment 1 construct plasmid 2816-pCRISPomyces-2 and 3141-pCRIS
Pomyces-2 has successfully been transferred to Yellowtail fish Nocard's bacillus, respectively with positive clone molecule Δ 2816, Δ 3141 and wild strain Yellowtail fish promise card
The bacterium solution and 2816-pCRISPomyces-2 plasmid and 3141-pCRISPomyc es-2 plasmid of Salmonella ZJ0503 is as mould
Plate, the primer designed on pCRISPomyces-2 plasmid carry out PCR amplification, and primer sequence is respectively primers F:
CATTCAGGCTGCGCAACTG；Primer R:CGTTTTACAACGTCGTGACTGG.PCR reaction system are as follows: 10 μ l Taq mix, 7
μl ddH2O, 1 μ l primers F, 1 μ l primers F, 1 μ l bacterium solution.PCR response procedures are as follows: 95 DEG C of 5min, 95 DEG C of 30S, 58 DEG C of 1min, 72
DEG C 1min, 35 circulations, 72 DEG C of 5min, 16 DEG C of preservations.PCR product is identified by 1% agarose gel electrophoresis, as a result such as Fig. 5
It is shown.
In Fig. 5, M swimming lane represents Marker, and 1 swimming lane represents template as wild type Yellowtail fish Nocard's bacillus ZJ0503 bacterium solution
PCR product, 2 swimming lanes represent template as the PCR product of 2816 bacterium solution of positive clone molecule △, and 3 swimming lanes represent template as positive colony
The PCR product of sub- 3141 bacterium solution of △, 4 swimming lanes represent template as the PCR product of 2816-pCRISPomyces-2 plasmid, 5 swimming lane generations
Table template is the PCR product of 3141-pCRISPomyces-2 plasmid.Wherein, 1 swimming lane does not have product, it was demonstrated that the PCR primer used
For the specific primer of pCRISPomyces-2 plasmid, the stripe size of 2 swimming lanes and the vertical arrow meaning of 4 swimming lanes is identical, it was demonstrated that
Positive clone molecule △ 2816 has been transferred to plasmid 2816-pCRISPomyces-2, the band of 3 swimming lanes and the vertical arrow meaning of 5 swimming lanes
Size is identical, it was demonstrated that positive clone molecule △ 3141 has been transferred to plasmid 3141-pCRISPomyces-2.
Step IV, the gene editing site generation gene editing for the design of verifying purpose gene, carry out target gene
Sequencing identification.Respectively using the bacterium solution of positive clone molecule Δ 2816, Δ 3141 and wild strain Yellowtail fish Nocard's bacillus ZJ0503 as mould
Plate, primer are the primer of amplifying target genes open reading frame, amplify target gene fragment, wherein the amplimer of Δ 2816
Sequence is Δ 2816-F:ACCGACGTTGCGTTCAGA, Δ 2816-R:TACGAATGATGGTTGGGTG；The amplification of Δ 3141 is drawn
Object sequence is Δ 3141-F:TCCGAACAGCGGTTAGAGCG, Δ 3141-R:GGCCCAGGTCATCATGTCAGC.PCR reaction
System: 10 μ l Taq mix, 7 μ l ddH2O, 1 μ l primers F, 1 μ l primer R, 1 μ l bacterium solution.PCR response procedures: 95 DEG C of 5min, 95
DEG C 30S, 58 DEG C of 1min, 72 DEG C of 1min, 35 circulations, 72 DEG C of 5min, 16 DEG C of preservations.Respectively obtain 2816 genes and 3141 genes
PCR product.
The PCR product for purifying 2816 genes and 3141 genes respectively, according to TA cloning reaction system shown in table 3,28 DEG C
It is incubated for 1h, is connected respectively on different pMD18T to obtain 2816-pMD18T and 3141-pMD 18T.By 2816-pMD18T and
3141-pMD18T is mixed with 50 μ L bacillus coli DH 5 alpha competent cells respectively, ice bath 30min, by 42 DEG C of heat shock 90s of mixture
After be immediately placed in 2min on ice, 200 μ l LB culture mediums are added, 37 DEG C after mixing, are coated on benzyl containing ammonia after 120r/min culture 1h
The LB solid culture primary surface of penicillin.
The single colonie of picking LB solid culture primary surface, until containing the LB liquid medium of ampicillin (50mg/ml)
Middle expansion culture.Culture to bacterial growth reaches logarithmic growth phase, and bacterium solution is sent out and is sequenced.Sequencing primer sequence is sequencing-F:
TGTAAAACGACGGCCAGT and sequencing-R:CAGGAAACAGCTATGACC.
Sequencing result is as shown in Figure 6 A and 6 B, and Fig. 6 A is the sequencing result comparison chart of 2816 genes, and wherein box 1 is
The site PAM of 2816 genes, box 2 are sgRNA anchor series, and " ... " indicates base deletion, and wt is wild type Yellowtail fish promise Cattell
2816 gene orders of bacterium ZJ0503,1-4 is respectively 2816 gene orders of the four positive clone molecule Δs 2816 selected, from figure
6A is it is found that the missing of base has occurred in the sgRNA anchor series of positive clone molecule 1-4, it was demonstrated that the success of 2816 gene knockouts.
Fig. 6 B is the sequencing result comparison chart of 3141 genes, and wherein box 3 is the site PAM of 3141 genes, and box 4 is
SgRNA anchor series, " ... " indicate base deletion, and wt is nocardial 3141 gene order of wild type Yellowtail fish, 1-4 difference
For 3141 gene orders of the four positive clone molecule Δs 3141 selected, from Fig. 6 B it is found that the sgRNA anchor of positive clone molecule 1-4
Sequencing arranges the missing that base has occurred, it was demonstrated that the success of 3141 gene knockouts.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Pipe present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its according to
So be possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features into
Row equivalent replacement；And these are modified or replaceed, various embodiments of the present invention technology that it does not separate the essence of the corresponding technical solution
The range of scheme.
SEQUENCE LISTING
2. Guangdong Ocean University,<110>1. Shenzhen research institute, Guangdong Ocean University
3. Shenzhen justice marine growth Science and Technology Ltd.
<120>preparation method of Nocard's bacillus competent cell and Nocard's bacillus gene editing method
<130> 2019-04-16
<160> 17
<170> PatentIn version 3.5
<210> 1
<211> 624
<212> DNA
<213> Nocardia seriolae
<400> 1
gtggctgtct acacgctgcc tgaactcgat tacgactact cggccctgga gcccttcatc 60
tccggccaga tcaacgagat ccaccacacc aagcaccacg ccgcctacgt cgcgggtgtc 120
aacgccgccc tcgagaagct cgaggaggcg cgcgccaagg acgaccacgc cgccatcttc 180
ctgaacgaga agaacctcgc gttccacctc ggcggccacg tcaaccactc catctggtgg 240
aagagcctgt ccaaggacgg cggcgacaag ccggtcggcg acctggccgc cgccgtcgac 300
gaggagttcg gctccttcga caagttcgtc gcgcagttct ccgctgcggc caacggcctg 360
cagggctccg gctgggcctg gctgggctac gacaccctgg gcaacaagct gctcaccttc 420
cagctcaccg accagcaggg caacgtgccg ctgggcatca tcccgctgct cggcctggac 480
atgtgggagc acgccttcta cctgcagtac aagaacgtca aggcggacta cgtcaaggcg 540
ttctggaacg tggtgaactg ggccgaaatc caggagcgct acaccaaggc cgtcaaccag 600
ggcaaaggcc tgatcttcgg ctga 624
<210> 2
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 2
ggctcttcca ccagatggag 20
<210> 3
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 3
gagtagtcgt aatcgagttc 20
<210> 4
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 4
caggcctttg ccctggttga 20
<210> 5
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 5
cgaagatcag gcctttgccc 20
<210> 6
<211> 23
<212> DNA
<213> Nocardia seriolae
<400> 6
tacaccaagg ccgtcaacca 20
<210> 7
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 7
aaggccgtca accagggcaa 20
<210> 8
<211> 23
<212> DNA
<213> Nocardia seriolae
<400> 8
tggctgggct acgacaccct 20
<210> 9
<211> 558
<212> DNA
<213> Nocardia seriolae
<400> 9
gtgaagctgc tgaacccgcg ggggttcgga ttggtttgcg catccgcggc cgtggcggcg 60
gggttgatgc tggcgggctg cgcgaacacg gtcgagggta ccccgacggt cgatcaggct 120
caggtgacct cgtaccgggc cgaggtgtcc tcgtccgcgg cggccgccag ttcgtccaag 180
gccgcggcgc aggtcgccaa ggccacggcc gacaactgcg atccgttccg caagaccgcc 240
gggaccgcgg tcgaccgcta caacgagttc gtggacgcgc acgacgccag cgccgcggac 300
caagtggcga agcgggacgc ggcggccggg gcgctcgagg acgcggcgaa gacgatcgag 360
accgagttga acgcgacccg ggcggatctg cccgccgatc tcgcgggcaa gctcaccgac 420
tatgtgaacg cggcgcgctc gctggccgcg gagatccgga agatgtcggg cgggtcgtcg 480
gtggcgccgc tgaacgacgc gagcaagaag gtcaacgacg ctctaaccgc tgttcggaac 540
gcctgcccgg gcaagtga 558
<210> 10
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 10
gcagttgtcg gccgtggcct 20
<210> 11
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 11
acctgagcct gatcgaccgt 20
<210> 12
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 12
cacggtcgag ggtaccccga 20
<210> 13
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 13
cacggtcgag ggtaccccga 20
<210> 14
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 14
aggctcaggt gacctcgtac 20
<210> 15
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 15
ccgcgtcccg cttcgccact 20
<210> 16
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 16
gcggaacgga tcgcagttgt 20
<210> 17
<211> 20
<212> DNA
<213> Nocardia seriolae
<400> 17
ccgcttcgcc acttggtccg 20
Claims (10)
1. a kind of preparation method of Nocard's bacillus competent cell characterized by comprising
It takes the Nocard's bacillus bacterium solution in logarithmic growth phase in centrifuge tube, nocardial thallus is collected by centrifugation for the first time, adopts
After washing the thallus with sterile water or aseptic aqueous solution, then use sterile water or aseptic aqueous solution that the bacterium is resuspended for the first time
Then body is added lysozyme in the thallus of resuspension and is handled, nocardial thallus is collected by centrifugation after processing for the second time, adopts
Second is carried out to the thallus with sterile water or aseptic aqueous solution to be resuspended, and obtains Nocard's bacillus competent cell.
2. the preparation method of Nocard's bacillus competent cell as described in claim 1, which is characterized in that in the thallus of resuspension
In being added after lysozyme, the final mass concentration of lysozyme is 100 μ g/ml-300mg/ml.
3. the preparation method of Nocard's bacillus competent cell as claimed in claim 2, which is characterized in that in the thallus of resuspension
The time that lysozyme post-processing is added is 0.3-5 hours.
4. a kind of Nocard's bacillus gene editing method characterized by comprising
Step a., which is determined, needs target gene to be edited in Nocard's bacillus, obtain the sgRNA anchor series of the target gene,
Cas9 carrier is provided, the sgRNA anchor series are inserted into the Cas9 carrier, obtains CRISPR/Cas9 gene editing matter
Grain；
Step b. prepares promise card according to the preparation method of Nocard's bacillus competent cell as described in any one of claims 1 to 3
Salmonella competent cell；
Step c. by the CRISPR/Cas9 gene editing plasmid convert enter the Nocard's bacillus competent cell in, to turn
The Nocard's bacillus competent cell after change carries out recovery culture, and the bacterium solution after recovery culture is applied to containing antibiotic
Solid culture primary surface is cultivated, screening positive clone.
5. Nocard's bacillus gene editing method as claimed in claim 4, which is characterized in that the method for the conversion is that electricity turns
Change.
6. Nocard's bacillus gene editing method as claimed in claim 5, which is characterized in that the parameter of the electrotransformation are as follows: electricity
150-300V, interpulse period 600-1500ms, pulse duration 60-150 μ s are pressed, square wave 20-40 is a.
7. Nocard's bacillus gene editing method as claimed in claim 4, which is characterized in that the step a further include: described
Insertion expands same respectively from the sgRNA anchor series of the target gene and the upstream and downstream in the corresponding site PAM in Cas9 carrier
Source arm segment.
8. Nocard's bacillus gene editing method as claimed in claim 4, which is characterized in that by CRISPR Photographing On-line tool
Design obtains the sgRNA anchor series of the target gene.
9. Nocard's bacillus gene editing method as claimed in claim 4, which is characterized in that the Cas9 carrier is
PCRISPomyces-2 plasmid.
10. if the described in any item Nocard's bacillus gene editing methods of claim 4-9 are in research Nocard's bacillus gene function, structure
It builds Nocard's bacillus gene-deleted strain and prepares the application in Nocard's bacillus gene delection strain vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910409358.2A CN110129228B (en) | 2019-05-16 | 2019-05-16 | Preparation method of nocardia competent cells and nocardia gene editing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910409358.2A CN110129228B (en) | 2019-05-16 | 2019-05-16 | Preparation method of nocardia competent cells and nocardia gene editing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110129228A true CN110129228A (en) | 2019-08-16 |
| CN110129228B CN110129228B (en) | 2023-06-06 |
Family
ID=67574816
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910409358.2A Active CN110129228B (en) | 2019-05-16 | 2019-05-16 | Preparation method of nocardia competent cells and nocardia gene editing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129228B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112746050A (en) * | 2020-12-22 | 2021-05-04 | 广东海洋大学深圳研究院 | Nocardia seriolae attenuated strain and preparation method and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318947A (en) * | 2016-10-17 | 2017-01-11 | 北京大北农科技集团股份有限公司 | Genome editing system and application thereof |
| CN106544298A (en) * | 2016-10-27 | 2017-03-29 | 广东省微生物研究所 | A kind of preparation method of bacilluss competent cell |
| WO2017151059A1 (en) * | 2016-02-29 | 2017-09-08 | Agency For Science, Technology And Research | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery |
| WO2018045630A1 (en) * | 2016-09-09 | 2018-03-15 | 康码（上海）生物科技有限公司 | Crispr/cas9 high efficient gene editing system optimized for kluyveromyces |
| US20180163196A1 (en) * | 2015-03-20 | 2018-06-14 | Danmarks Tekniske Universitet | Crispr/cas9 based engineering of actinomycetal genomes |
-
2019
- 2019-05-16 CN CN201910409358.2A patent/CN110129228B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180163196A1 (en) * | 2015-03-20 | 2018-06-14 | Danmarks Tekniske Universitet | Crispr/cas9 based engineering of actinomycetal genomes |
| WO2017151059A1 (en) * | 2016-02-29 | 2017-09-08 | Agency For Science, Technology And Research | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery |
| WO2018045630A1 (en) * | 2016-09-09 | 2018-03-15 | 康码（上海）生物科技有限公司 | Crispr/cas9 high efficient gene editing system optimized for kluyveromyces |
| CN106318947A (en) * | 2016-10-17 | 2017-01-11 | 北京大北农科技集团股份有限公司 | Genome editing system and application thereof |
| CN106544298A (en) * | 2016-10-27 | 2017-03-29 | 广东省微生物研究所 | A kind of preparation method of bacilluss competent cell |
Non-Patent Citations (2)
| Title |
|---|
| 王世伟等: "优化感受态细胞制备方法提高转化效率的研究", 《齐齐哈尔大学学报》, no. 02, 15 March 2009 (2009-03-15), pages 86 - 90 * |
| 王英华等: "鱼诺卡氏菌与黄粉色诺卡氏菌原生质体融合的研究", 《海南大学学报(自然科学版)》, no. 04, 25 December 2016 (2016-12-25), pages 350 - 355 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112746050A (en) * | 2020-12-22 | 2021-05-04 | 广东海洋大学深圳研究院 | Nocardia seriolae attenuated strain and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110129228B (en) | 2023-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105331627B (en) | A method of prokaryotic gene group editor is carried out using endogenous CRISPR-Cas system | |
| CN106047877B (en) | A kind of sgRNA and CRISPR/Cas9 slow virus system of targeting knockout FTO gene and application | |
| CN105238806B (en) | A kind of building and its application of the CRISPR/Cas9 gene editing carrier for microorganism | |
| GB2531454A (en) | Recombinogenic nucleic acid strands in situ | |
| WO1987006614A1 (en) | Electric field mediated dna transformation of plant cells and organelles | |
| CN111607594B (en) | CRISPR-Cas9 editing technology-based cell line for knocking out pig IRF8 gene and construction method thereof | |
| CN106119269A (en) | A kind of method preparing linear ssdna in escherichia coli | |
| CN109825464B (en) | T6SS-1 gene cluster-knocked-out attenuated vaccine for pseudomonas fragrans fish | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN110129228A (en) | The preparation method and Nocard's bacillus gene editing method of Nocard's bacillus competent cell | |
| CN103881951A (en) | SCO6974 gene deleted streptomyces coelicolor and application thereof to yield increment of antibiotics | |
| TWI643951B (en) | Gene editing system of synechococcus elongates pcc 7942 and application thereof | |
| CN113403246B (en) | Vibrio alginolyticus Hfq gene knockout mutant strain and application thereof | |
| KR20220061078A (en) | Method for modifying a target nucleic acid in the genome of a cell | |
| CN110214181A (en) | Novel vibrio parahaemolyticus phage VIB-PAP-4 and its purposes for inhibiting vibrio parahaemolytious bacterial multiplication | |
| CN111057710B (en) | Construction method of lactobacillus with enhanced stress tolerance, recombinant lactobacillus and application thereof | |
| CN103468623B (en) | Indicator bacterium for gene engineering and application thereof | |
| CN1195062C (en) | Non-antibiotics resistant shuttle plasmid expression carrier and its constructing method and uses | |
| SAITO et al. | DNA-mediated transformation in Bacillus subtilis with special reference to the method for preparing competent cells | |
| CN112980866B (en) | Plasmid transformation method of bacillus polymyxa | |
| Cohen et al. | Biotechnology: principles and processes | |
| CN114350688B (en) | Application of guaA gene, plasmid and strain in expression of azotobacter ferrite | |
| CN103849591B (en) | A kind of Tylosin-producer, genetic modification method and its application | |
| TWI629358B (en) | Gene expression interference system of synechococcus elongates pcc 7942 and method for interfering gene expression of synechococcus elongates pcc 7942 | |
| CN111334445B (en) | Long-chain dicarboxylic acid producing strain and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |