CN106520824A - Multi-target-point editing system and application thereof - Google Patents

Multi-target-point editing system and application thereof Download PDF

Info

Publication number
CN106520824A
CN106520824A CN201610872349.3A CN201610872349A CN106520824A CN 106520824 A CN106520824 A CN 106520824A CN 201610872349 A CN201610872349 A CN 201610872349A CN 106520824 A CN106520824 A CN 106520824A
Authority
CN
China
Prior art keywords
sequence
mutiple targets
target
seq
editing system
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610872349.3A
Other languages
Chinese (zh)
Inventor
杨进孝
徐雯
张成伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Dbn Biotech Co Ltd
Beijing Dabeinong Technology Group Co Ltd
Original Assignee
Beijing Dbn Biotech Co Ltd
Beijing Dabeinong Technology Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Dbn Biotech Co Ltd, Beijing Dabeinong Technology Group Co Ltd filed Critical Beijing Dbn Biotech Co Ltd
Priority to CN201610872349.3A priority Critical patent/CN106520824A/en
Publication of CN106520824A publication Critical patent/CN106520824A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a multi-target-point editing system and application thereof. The multi-target-point editing system comprises (a) and (b), wherein (a) represents Csy4 protein and Cas9 protein, and (b) is obtained by connecting two or more pieces of sgRNA to a Csy4 cutting and recognition sequence in series at intervals. According to the multi-target-point editing system and application thereof, the Csy4 protein and the corresponding recognition sequence thereof are applied to a CRISPR/Cas9 system for the first time, corresponding RNA sequences can be cut and recognized with the Csy4 protein, then the multiple pieces of sgRNA can be cut into independent fragments after being transcribed in the same expression cassette at the same time, and multi-target-point editing of genomes is achieved; meanwhile, the single-target-point cutting efficiency is obviously improved compared with that of a tRNA shearing system in the prior art, and the efficiency of detecting fragment deletion caused by multi-target-point cutting is higher than that of the tRNA shearing system.

Description

Mutiple Targets editing system and application thereof
Technical field
The present invention relates to Csy4 albumen is applied to by a kind of Mutiple Targets editing system and application thereof, more particularly to one kind Realizing system and application thereof of Mutiple Targets cutting in CRISPR/Cas9 systems.
Background technology
Higher organism is usually constructed with the idiotype network of complexity and carries out guaranteeing that intracellular biological activity is ruly, because This carries out Mutiple Targets editor for the research of genetic engineering and application are significant using CRISPR/Cas9 systems.Many targets Point editor not only can improve the mutation efficiency to some sequence of genome, realize fragment deletion or repetition, while to certain Metabolic pathway carries out polygenes knockout and additionally aids the function of illustrating related gene.
Realize Mutiple Targets editor's need with the presence of the Cas9 and independent sgRNA of multiple targeting different locis.Traditional method By microinjection or expression, the expression cassette comprising multiple single gRNA (sgRNA) is realizing.By the gRNA of vivoexpression and Cas9 albumen (or mRNA of Cas9) is expelled to cell or embryo is only applicable to some little systems, by multiple sgRNA Expression cassette be compressed on a carrier with realize Mutiple Targets cutting mainly have two ways：1) opened using multiple RNA polymerases Mover drives multiple sgRNA expression cassettes simultaneously, transcribes out corresponding sgRNA sequences respectively, to realize cutting target sequence. The expression cassette of typical sgRNA is about 400-500bp, the promoter comprising rna plymerase iii type (Pol III), sgRNA With Pol III terminators；It is less due to being currently known functional rna plymerase iii type promoter, if needing in a carrier The target spot that transcription simultaneously is more than 3, will necessarily reuse rna plymerase iii type promoter (U3 or U6), because of repetitive sequence Presence would potentially result in genome and homologous recombination occur.In addition, limited by plasmid vector bearing capacity, while expression is multiple SgRNA expression cassettes will also increase the difficulty of vector construction, and, the RNA of eukaryote type III polymerase transcription needs one Specific nucleotide starts, and this causes the target site of Cas9/gRNA to be limited.2) by multiple sgRNA pass through some recognition sequences or Self cleavage connects, and borrows Protein cleavage correspondence sequence, discharges the independent sgRNA sequences with different target spots, realizes correspondence target The cutting of sequence.One successful story can be tied by a tRNA-gRNA using the multiple sgRNA of tRNA cutting systems The synthetic gene of structure is produced by the accurate shearing of the Rnase in eukaryote body, borrows the Rnase systems in eukaryote body Cut, another case is derived from HH the and HDV Self cleavage sequences of virus.The former (tRNA cutting systems) is a kind of phase To efficient Mutiple Targets cutting mode, and the Mutiple Targets vector construction process of the latter's (HH and HDV Self cleavage sequences) is more complicated, Typically do not adopt (Kabin Xie, 2015；Yangbin Gao, 2014).
The content of the invention
It is an object of the invention to provide a kind of genomic modification system and application thereof, needs to lead in efficiently solving prior art Excessive gene knockout is illustrating the technical barriers such as related gene function.
For achieving the above object, the invention provides a kind of Mutiple Targets editing system, including a) and b)：
A) Csy4 albumen and Cas9 albumen；
B) by two or more sgRNA comprising target target site sequence of Csy4 cutting recognition sequences spaced series.
Further, the aminoacid sequence of the Csy4 albumen has SEQ ID NO:Aminoacid sequence shown in 2.
The aminoacid sequence of the Cas9 albumen has SEQ ID NO:Nucleotide sequence shown in 3.
The Csy4 cuttings recognition sequence has SEQ ID NO:Nucleotide sequence shown in 8.
Further, the nucleotide sequence of the Csy4 albumen and the nucleotide sequence of the coding Cas9 albumen are encoded Effectively connection.
Nucleotide sequence effectively connection on the basis of above-mentioned technical proposal, in the coding Mutiple Targets editing system a) In the first regulating and controlling sequence.
Preferably, first regulating and controlling sequence includes II type promoter and/or localization domain.
Specifically, the II type promoter includes cauliflower mosaic virus 35 S promoter or ubiquitin promoter.
Nucleotide sequence effectively connection on the basis of above-mentioned technical proposal, in the coding Mutiple Targets editing system b) In the second regulating and controlling sequence.
Preferably, second regulating and controlling sequence includes III type promoter.
Specifically, the III type promoter includes U6 promoteres or U3 promoteres.
For achieving the above object, present invention also offers a kind of recombinant expression carrier, comprising encoding the Mutiple Targets editor The nucleotide sequence of system.
For achieving the above object, present invention also offers a kind of method for realizing Mutiple Targets editor, is included in organism Express the Mutiple Targets editing system.
For achieving the above object, present invention also offers a kind of editor's target site sequence or method, including will be described many Target spot editing system is imported in the organism comprising target site sequence.
For achieving the above object, present invention also offers a kind of method for improving Mutiple Targets editorial efficiency, including will be described Mutiple Targets editing system imports organism genome.
For achieving the above object, present invention also offers it is a kind of produce Mutiple Targets editor plant method, including to plant The nucleotide sequence of the coding Mutiple Targets editing system is introduced in thing genome.
For achieving the above object, present invention also offers it is a kind of produce Mutiple Targets editor's plant seed method, including by The plant selfing of the Mutiple Targets editor that methods described is produced, so as to obtain with Mutiple Targets editor's plant seed.
For achieving the above object, present invention also offers it is a kind of cultivate Mutiple Targets editor plant method, including：
At least one Mutiple Targets editor plant seed of plantation；
The seed is made to grow up to plant.
For achieving the above object, present invention also offers a kind of Mutiple Targets editing system is obtaining Mutiple Targets mutation life Purposes in thing.
For achieving the above object, present invention also offers a kind of test kit, including the Mutiple Targets editing system, for reality Existing Mutiple Targets editor.
Heretofore described CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), the short palindrome repetitive sequence of the regular intervals of cluster is referred to, containing multiple short repetitions in the same direction Locus, during which is found to be present in the genome of about 40% sequencing antibacterial and in the genome of 90% sequencing archeobacteria. Immune system functions of the CRISPR as protokaryon, which gives the opposing to external genetic elements such as plasmid and phage Property.CRISPR systems provide a kind of acquired immunity form.The short-movie section (referred to as spacer) of foreign DNA is incorporated into CRISPR In genome between repetitive sequence, then in the way of the RNAi in similar to eukaryote of CRISPR spacers for identification and The external genetic elements of silence.
A kind of heretofore described Cas9, important protein component in II type CRISPR/Cas system, can be from life Object such as Streptococcus species (Streptococcus sp.), preferably streptococcus pyogeness (Streptococcus pyogenes) In it is isolated.When two RNA of Cas9 and referred to as CRISPR RNA (crRNA) and trans-activation crRNA (TracrRNA) are answered During conjunction, active Cobra venom endonuclease is formed, so as to cut off invasion phage or the foreign genetic element in plasmid, to protect host thin Born of the same parents.CRISPR element transcriptions of the crRNA from host genome, captures from external source invader wherein before the CRISPR elements. Research shows that the single-chain chimeric RNA that the necessary part by merging crRNA and tracrRNA is produced can replace Cas9/RNA multiple Two RNA in zoarium are forming functional nucleic acid restriction endonuclease.The variant of Cas9 protein can be the mutant forms of Cas9, Wherein catalytic aspartate residues change into any other aminoacid.Preferably, described other aminoacid can be alanine.
Heretofore described guide RNA or guiding RNA (guide RNA, gRNA), also referred to as little guide RNA (small Guide RNA, sgRNA), act on a kind of kinetoplast (kinetoplastid) referred to as rna editing (RNA editing) in vivo Rear transcription modification in, be also a kind of small-sized non-coding RNA.Can match with pre-mRNA, and insert some urine wherein Pyrimidine (U), produces the effective mRNA of tool.The RNA molecule of guide rna editing, length be about 60-80 nucleotide, be by Single genetic transcription, there is one section of anchorage zone in the 5 ' ends of gRNA, with special G-U matching methods and unedited pre- MRNA sequence is complementary, and anchor series promote the editing area complementation in gRNA and pre-mRNA, specially combine；In gRNA molecules Between position have an editing area be responsible in the pre-mRNA molecules edited insert U position, its with by editor mRNA it is accurate It is complementary；In 3 ' ends of gRNA molecules, add after having one section of transcription by about 15 noncoding PolyU sequences, function is On the nucleotide sequence of the 5 ' upstreams rich in purine bases of the editing area for gRNA being linked to pre-mRNA.In editor, formed One editosome (editosome), carries out the correction of transcript using the sequence inside gRNA as template, while producing editor's mRNA。
There are three types CRISPR/Cas systems, be directed to II type of Cas9 protein and crRNA, tracrRNA CRISPR/Cas systems are representational.Cas9 protein can be practiced shooting DNA by the guide effect of manually modified guide RNA The 5 '-N20-NGG-3 ' (N represents any Deoxydization nucleotide base) of sequence, N20 are 5 ' sequence identical, 20 alkali with gRNA Base, NGG are PAM areas (prototype introns are adjacent to motif, Protospacer-adjacent motif).The site of Cas9 shearings is just It is the region near PAM.Relative to zinc finger and activating transcription factor sample effector DBP provide advantage-because Nucleotide combines the locus specificity in CRISPR-Cas albumen and is regulated and controled by RNA molecule rather than DBP regulation and control.
Heretofore described restructuring, when for such as cell, nucleic acid, protein or carrier when, represent the cell, nucleic acid, Protein or carrier are modified by introducing heterologous nucleic acids or protein or changing natural acid or protein, or this is thin Born of the same parents are derived from the cell of this modification.
In the present invention, guide RNA can be transferred to cell or organism in the form of the RNA or DNA for encoding guide RNA In.Guide RNA can be detached RNA, be incorporated to viral vector RNA form or encode in the carrier.Preferably, carry Body can be viral vector, plasmid vector or agrobacterium vector.
The DNA of coding guide RNA can be the carrier comprising coding guide RNA sequence.For example, can be by with detached The plasmid DNA transfection cell or organism of guide RNA or the sequence comprising coding guide RNA and promoter, by guide RNA transfection To cell or organism.
Heretofore described cutting or shearing refer to the fracture of the covalent skeleton of nucleic acid molecule.Guide RNA can be prepared as Any target to be cut is specific to, any target DNA is cut by the target specific moiety of guide RNA.
In the present invention, the series connection is referred to will be two or more than two guide RNA (sgRNA) stringing, each sgRNA Head end and previous sgRNA tail end by Csy4 cutting recognition sequence connection.
The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any hereditary material, and including nucleus and plastid and mitochondrial genome.
Heretofore described polynucleotide and/or nucleotide form completely " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that can be placed in the polynucleotide of the present invention and/or nucleotide Under regulating and controlling sequence control in purpose host.
Such as the application, including claim used in, unless clearly indicated otherwise in context, otherwise odd number and list The term of number form formula, such as " one ", " one " and " being somebody's turn to do ", including plural thing.Thus, for example " plant ", " plant " or " plant " also indicates that multiple plants.And based on context, may further indicate that the plant in heredity using term " plant " Similar or identical offspring.Similarly, term " nucleic acid " can refer to many copies of nucleic acid molecules.Similarly, term " probe " May refer to same or analogous probe molecule.
Digital scope includes the numeral for limiting the scope, and clearly includes each integer and non-in limited range Integer fraction.Unless otherwise noted, whole technologies otherwise used herein and scientific terminology with ordinary skill people The identical implication that member is commonly understood by.
In the present invention, term " nucleic acid ", " nucleotide ", " nucleotide sequence ", " oligonucleotide " and " polynucleotide " can be mutual Change use, they refer to the polymerized form of the nucleotide with any length, based on context implication, may refer to DNA or RNA, Or its analog.Wherein DNA includes but is not limited to cDNA, genomic DNA, synthetic DNA (such as synthetic) and contains nucleic acid Like the DNA (or RNA) of thing.Polynucleotide can have any three dimensional structure, and can perform known or unknown any function. Nucleic acid can be double-strand or single-stranded (both sense strand or antisense were single-stranded).The non-limiting example of polynucleotide includes gene, gene piece Section, exon, intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, cDNA, recombination of polynucleotide, branch Polynucleotide, plasmid, carrier, the separation DNA of any sequence, the separation RNA of any sequence, nucleic probe and primer, Yi Jihe Acid-like substance.
In the present invention, " wild type " represents biology, bacterial strain, the canonic form of gene or when it has time zone in nature Not in mutant or the feature of variant form.
In the present invention, " mutant " or " variant " refers to the individuality undergone mutation, and which has the sequences different from wild type, The sequence that at least part of function of wherein sequence has been lost is may result in, for example, the sequence in promoter or enhancer region Change by least in part affect organism in coded sequence expression.Term " mutation " refer to can by such as disappearance, addition, Replace or reset any change of sequence in the nucleotide sequence for causing.Mutation can also affect one or more steps that the sequence is participated in Suddenly.For example, the change in DNA sequence can cause mRNA and/or egg activated, that have amount of activated or inactive change White synthesis.
In the present invention, " non-naturally occurring " shows artificial participation.When nucleic acid molecules or polypeptide is referred to, the nucleic acid is represented Molecule or polypeptide are at least substantially found at least another kind in connection in nature in nature or such as from them Component separate out.
" express " in the present invention and refer to that sequence transcription interested produces correspondence mRNA and the mRNA translations produce correspondence and produce Thing, i.e. peptide, polypeptide or albumen.Regulating element controls or adjusts sequence table interested to reach, and the regulating element includes 5 ' regulations Element such as promoter.
In the present invention, " polypeptide ", " peptide " and " protein " is interchangeably used, and refers to that the aminoacid with any length gathers Compound.The polymer can be straight or branched, and it can be comprising the aminoacid of modification, and it can be by non-amino acid It is disconnected.These terms are also contemplated by adorned amino acid polymer；These modification for example disulfide formation, glycosylation, it is esterified, Acetylation, phosphorylation or any other operation, such as and marker components combination.Term " aminoacid " includes natural and/or non- The aminoacid of natural or synthesis, including glycine and D and L optical isomers and amino acid analogue and peptide simulation Thing.
In the present invention, term " carrier " is the DNA molecular for referring to replicate in host cell.Plasmid and cosmid are examples Property carrier.Additionally, term " carrier " and " medium " are used interchangeably is transferred to another kind carefully by DNA fragmentation from a kind of cell to refer to The nucleic acid molecules of born of the same parents, therefore DNA fragmentation (is for example transferred to plant from agrobatcerium cell by the unnecessary identical biology that belongs to of cell Cell).
In the present invention, term " expression vector " is referred to containing required coded sequence and is expressed in specific host biology The recombinant DNA molecules of the appropriate nucleic acid sequences required for the coded sequence of effectively connection.
In the present invention, term " recombinant expression carrier " refers to from any source, can be integrated into genome or autonomous replication Any factor for example plasmid, cosmid, virus, BAC (bacterial artificial chromosome), autonomous replication type sequence, phage or it is linear or Cyclic single strand or double-stranded DNA or RNA nucleotide sequences, use well-known restructuring including one or more of which DNA sequence The DNA molecular that DNA technique is connected in the operable mode of feature.
In the present invention, " localization domain " is optionally added to the part of protein part, and localization domain can be by egg White part or the protein part of programming or the complex of assembling position into living cells specific cells or Subcellular Localization.Positioning knot Structure domain can include the aminoacid of following domain building by being fused to mix the aminoacid sequence of protein part：Nuclear location Signal (NLS)；Mitochondrion targeting sequencing (MLS)；Chloroplast targeting sequencing；And/or be designed with by albumen transport or guide or Position any sequence of any subdivided portions to the organelle containing nucleic acid, cellular compartment or cell.In some embodiments In, organism is eukaryote, and localization domain includes that the nuclear location for allowing albumen to enter in nucleus and genomic DNA is tied Structure domain (NLS).The sequence of the NLS may include any function NLS of positively charged sequence.In other embodiments, it is fixed Nuclear localization sequence may include to make the nucleoprotein of protein part or programming to enter the targeting sequencing of organelle, be modified organelle DNA It is possibly realized.
In the present invention, eukaryote has 3 class RNA polymerases, is responsible for the different promoter of 3 classes of transcription.By rna plymerase i It is responsible for the rRNA genes of transcription, promoter (I types) is relatively simple, by two parts Sequence composition of near transcriptional start sites：The A part is core promoter (core promoter), is made up of -45+20 nucleotide, just be enough to starting during individualism Transcription；Another part is made up of-170-107 bit sequences, referred to as upstream regulatory elements, can effectively strengthen transcriptional efficiency.
By the responsible transcription of RNA polymerase III is microRNA (snRNA) in 5S rRNA, tRNA and some cores, and which opens Mover (III type) composition is more complicated, can be divided into two subclass again：One class belongs to structural gene Natural promoter, and a class belongs to structure Extragenic promoter.The effectively start of Natural promoter depends on two discontinuous DNA fragmentations that gene internal is included, the two DNA fragmentation includes some different continuous DNA sequence A, B or C areas, and Liang Ge is spaced between area.According to different groups of Liang Ge areas Close, two kinds of I classes and II classes can be divided into：I classes include A and C areas, have now been found which is existed only in the gene of 5S rRNA；II classes Including A and B areas, it is present in the gene of tRNA, the gene of 7SLRNA, the RNA of adenoviruss VAI and VAII.Inside A, B or A, C DNA sequence is III C transcripting starting binding sites of transcription factor TF III A and TF.As a rule, 5 ' ends also have other regulations Or key element, these elements are required to the efficient transcription of RNA.Transcription effect is affected between the presence or absence of these sequences Rate.These sequences are presented complicated multiformity, but most of promoteres 5 ' hold -30 to -20 places to there is TATA box sample sequences, It is similar to outer promoter.Outer promoter lacks corresponding internal sequence, only has cis acting element at 5 ' ends, in the end of gene By one group of termination signal being made up of 4 or more thymus pyrimidines, such as vertebratess U6 small nuclear RNAs and 7SK RNA promoteres, this A little promoteres are all highly similar or identical, and its position and base sequence are highly conserved, its structure and pol II promoteres There is certain similarity.Their 5 ' end cis acting element include several control elements, and about -30 places have one at its upstream TATA sample sequences, nearly -60 places have a snRNA PSE (snRNA approximating sequences) and one or more be referred to as the modification sequence of OCT Row 5 '-ATGCAAAT-3 '.TATA sample sequences are pol III snRNA genes are carried out transcribing it is special.TATA samples element and PSE Element has together decided on the selection of transcriptional start site and transcriptional efficiency.The distance between TATA samples element and PSE elements are determined The specificity of rna polymerase transcribe, but seem that TATA sample elements are more important, because in U6RNA the and 7SK RNA of PSE disappearances In genetic transcription, the only decline of transcriptional efficiency.And, PSE elements may be related to B boxes (boxB), and B boxes are to a certain extent PSE elements can be substituted.The transcription of these sequence pair downstream genes has conclusive effect, and they and initiation site phase Away from farther out, often beyond 150bp, and for pol III Natural promoters, typically within 80bp；With the outer promoteres of pol III Compare, if pol II promoteres 5 ' just hold the effect of each cis acting element conversely, TATA samples element disappearance, PSE then may be used To fulfil TATA sample element functions, the initial position of transcription is determined.In PSE upstreams, outer promoter also has a remote control sequence Row, its structure are similar to pol II enhancer OCT skeletons, but complicated compared with which.And also have a CACC sequence and OCT at -223 Skeleton is connected.The presence of these remote control sequences is greatly improved the expression efficiency of U6RNA and 7SK RNA.
The II type genes for being responsible for transcribing by rna plymerase ii include all proteins encoding gene and part snRNA genes, The promoter structure of the latter is similar to the 3rd subclass in type III gene promoter, the II type gene promoters of coded protein There is common conserved sequence in structure.Transcriptional start site does not have extensive sequence homology, but first base is that gland is fast Purine, and both sides are pyrimidine bases.This region is referred to as initial son (initiator, Inr), and sequence is represented by Py2CAPy5. Inr elements are located at -3+5.The promoter being only made up of Inr elements be with can by rna plymerase ii recognize most simply opening Mover form.Most II types promoteres have a consensus sequence for being referred to as TATA boxes, are generally in -30th area, relative to transcription The location comparison of initiation site is fixed.TATA boxes are present in all eukaryotes, and TATA boxes are seven conservative base pairs, Also some II type promoteres do not contain TATA boxes, such promoter is referred to as without TATA box promoters.
Heretofore described " effectively connection " or " being operably connected " represents the connection of nucleotide sequence, and the connection is caused One sequence can provide the function of needing for linked sequence.Described in the present invention " effectively connection " can be by promoter It is connected with sequence interested so that the transcription of the sequence interested is subject to the promoter to control and regulate and control.When interested Sequential coding albumen and " effectively connection " is represented when going for the expression of the albumen：Promoter is connected with the sequence, phase Mode even causes the transcript efficient translation for obtaining.If promoter is that transcript merges and thinks with the connection of coded sequence When realizing the expression of albumen of coding, the such connection of manufacture so that the first translation initiation codon in the transcript for obtaining It is the start codon of coded sequence.Alternatively, if promoter is that translation is merged and wants reality with the connection of coded sequence During the expression of the albumen for now encoding, the such connection of manufacture so that the first translation initiation password contained in 5 ' non-translated sequences Son is connected with promoter, and connected mode causes the translation product for obtaining and opens reading code with the translation for encoding the albumen wanted The relation of frame meets reading frame.Can be included but is not limited to the nucleotide sequence of " effectively connection "：Gene expression function is provided Sequence (i.e. gene expression element, such as promoter, 5 ' untranslated regions, intron, protein encoding regions, 3 ' untranslated regions Domain, poly- putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA borders sequence of DNA transfers and/or integration function is provided Row, site-specific recombinase recognition site, integrate enzyme recognition site), sequence (the i.e. antibiotic resistance of selectivity function is provided Label, biosynthesis gene), the sequence of label function of can scoring, sequence that is external or assisting series of operations in vivo are provided (i.e. polylinker sequence, locus specificity recombination sequence) and provide sequence (the i.e. replication orgin of antibacterial, autonomous multiple of copy function Sequence processed, centromeric sequence).
In the present invention, regulating element may be operably coupled to one or more elements of CRISPR systems, so as to drive this The expression of one or more of elements of CRISPR systems.In general, CRISPR (the short palindrome of regular intervals cluster repeats), Also referred to as SPIDR (repetition in the same direction that Spacer is spaced apart), constitutes the DNA bases generally for specificity for specific bacteria species Because of the family of seat.One of the short tandem repeats spaced apart (SSR) that the CRISPR seats are identified in being included in escherichia coli Inhomogeneity and related gene.Similar SSR spaced apart is identified in Hfx. mediterranei, streptococcus pyogenes, Herba Houttuyniae In category and mycobacterium tuberculosis.These CRISPR seats typically differ from the repetitive structure of other SSR, and these repetitions are claimed Short weight for regular intervals is multiple (SRSR).In general, these repetitions are the short elements existed with cluster, which is by with substantially permanent Unique intervening sequence of measured length is regularly spaced apart.Although repetitive sequence is highly conserved between bacterial strain, many intervals The sequence of the repetition opened and these spacers is different typically between bacterial strain and bacterial strain, in the prokaryote more than 40 kinds Identify CRISPR seats.
In the present invention, " target sequence " or " target sequence " or " target site sequence " or " target polynucleotide " are waited to be applied Any desired predetermined nucleotide sequence, including but not limited to coding or non-coding sequence, gene, exon or intron, tune Section sequence, intergenic sequence, composition sequence and cytozoon sequence.In some embodiments, target sequence is present in target Cell, tissue, organ or biological internal.
Term " primer " is one section of detached nucleic acid molecules, and which passes through nucleic acid hybridization, and annealed combination is to complementary target dna On chain, heterozygote is formed between primer and target dna chain, then in the presence of polymerase (such as archaeal dna polymerase), along mesh Mark DNA extends.The primer pair of the present invention is related to its application in target nucleic acid sequence amplification, for example, by polymerase chain Formula reacts (PCR) or other conventional nucleic acid amplification methods.
The length of primer usually 11 polynucleotide or more, preferably 18 polynucleotide or more, more preferably Be 24 polynucleotide or more, most preferably 30 polynucleotide or more.This primer is in high stringency hybridization bar Specifically hybridize with target sequence under part.Although keeping hybridization ability different from target dna sequence and to target dna sequence Primer can be by conventional design out, however, it is preferred to, the continuous kernel of the primer in the present invention and target sequence Acid has completely DNA sequence homogeneity.
The primer of the present invention is hybridized with target dna sequence under strict conditions.Nucleic acid molecules or its fragment are in certain situation Under can carry out specific hybrid with other nucleic acid molecules.As the present invention is used, if two nucleic acid molecules can form anti-flat Capable double-strandednucleic acid structure, it is possible to say that the two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid Molecule shows completely complementarity, then claim one of nucleic acid molecules to be another nucleic acid molecules " complement ".Such as this It is bright to use, when each nucleotide of nucleic acid molecules is with the corresponding nucleotide complementary of another nucleic acid molecules, then The two nucleic acid molecules are claimed to show " complete complementary ".If two nucleic acid molecules can be with enough stability phase mutual crosses So that they under the conditions of at least conventional " low strict " anneal and be bonded to each other, then the two nucleic acid molecules are called " most Low degree is complementary ".Similarly, if two nucleic acid molecules can be with enough stability phase mutual crosses so that they are in routine " height strict " under the conditions of anneal and be bonded to each other, then claim the two nucleic acid molecules that there is " complementarity ".From complete complementary Middle deviation can be permission, as long as this not exclusively two molecules of prevention that deviate form duplex structures.In order that a nucleic acid Molecule can be used as primer or probe, it is only necessary to ensure which has in sequence sufficiently complementary, so that in the spy for being adopted Determine under solvent and salinity, to form stable duplex structure.
As the present invention is used, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules for matching down.Promote the suitable strict of DNA hybridization Condition, for example, with 6.0 × sodium chloride/sodium citrate (SSC) process about under the conditions of 45 DEG C, then uses under the conditions of 50 DEG C 2.0 × SSC is washed, and these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected About 2.0 × SSC from Low stringency conditions, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C.Additionally, washing step In temperature conditionss can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature strip Part and salinity all can change, it is also possible to which one of holding is constant and another variable changes.Preferably, originally One nucleic acid molecules of invention can be under moderate stringency, such as with SEQ ID NO at about 2.0 × SSC and about 65 DEG C: 1 and SEQ ID NO:One or more nucleic acid molecules or its complementary series in 2, or arbitrary fragment generation of above-mentioned sequence is special Property hybridization.It is highly preferred that nucleic acid molecules of the present invention under high stringency with SEQ ID NO:1 and SEQ ID NO: One or more nucleic acid molecules or its complementary series in 2, or arbitrary fragment generation specific hybrid of above-mentioned sequence.The present invention In, preferred label nucleic acid molecules have SEQ ID NO:1 or SEQ ID NO:2 or its complementary series, or above-mentioned sequence Arbitrary fragment.Another preferred label nucleic acid molecules of the present invention and SEQ ID NO:1 or SEQ ID NO:2 or its complementary sequence Row, or arbitrary fragment of above-mentioned sequence is with 80% to 100% or 90% to 100% sequence iden.SEQ ID NO:1 Or SEQ ID NO:2 can serve as label in plant breeding method to identify the offspring of genetic cross.Probe and target dna The hybridization of molecule can be detected by the method that any one is well known to those skilled in the art, these methods include but It is not limited to, fluorescent labeling, radioactive label, antibody class labelling and chemiluminescent labeling.
With regard to the amplification (for example, by PCR) carried out to target nucleic acid sequence using specific amplimer, " strict bar Part " refers to only to allow primer pair target nucleic acid sequence in the hot amplified reactions of DNA the condition of hybridization occurs, with target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), can be combined with the target nucleic acid sequence, and excellent Choosing produces unique amplified production, and amplified production is amplicon.
Term " specific binding (target sequence) " refer under stringent hybridization condition primer only with comprising target sequence There is hybridization in the target sequence in sample.
In the present invention, " test kit " may include the genomic modification system and any one following or complete of present invention description Portion：Determine reagent, buffer, probe and/or primer and Sterile Saline or another kind of pharmaceutically acceptable Emulsion and suspension base Bottom.Additionally, test kit is may include containing for putting into practice saying for directions for use (for example, the operation scheme) of the method for present invention description Bright property material.
In the present invention, by Exogenous DNA transfered plant, the nucleotide sequence or table of Mutiple Targets editing system as described in by coding Plant cell is imported up to box or recombinant vector, conventional method for transformation is included but is not limited to, Agrobacterium-medialed transformation, micro Penetrate bombardment, directly the DNA that DNA takes in the mediation of protoplast, electroporation or silicon whisker is imported.
The invention provides a kind of Mutiple Targets editing system and application thereof, with advantages below：
1st, the present invention is applied to Csy4 albumen and its correspondence recognition sequence in CRISPR/Cas9 systems first, utilizes Csy4 albumen can cut and recognize corresponding RNA sequence so that after multiple sgRNA are transcribed in same expression cassette simultaneously, Independent fragment can be cut into, the Mutiple Targets editor to genome is realized.
2nd, for CRISPR/Cas9 systems, the present invention realizes that Mutiple Targets editor provides a kind of new selection, and single target spot is cut TRNA cutting systems are significantly improved compared to existing technology to cut efficiency, while to the fragment deletion efficiency caused by Mutiple Targets cutting It is high compared with tRNA cutting systems.
Below by drawings and Examples, technical scheme is described in further detail.
Description of the drawings
Fig. 1 is the recombinant clone shears vector construction flow chart of Mutiple Targets editing system of the present invention and application thereof；
Fig. 2 is that the recombinant expression carrier DBN- shears of Mutiple Targets editing system of the present invention and application thereof build flow chart；
Fig. 3 is that the Nicotiana tabacum L. target spot carrier DBN-GET344 of Mutiple Targets editing system of the present invention and application thereof builds flow chart；
Fig. 4 is the Nicotiana tabacum L. target spot carrier DBN-GET372 structural representations of Mutiple Targets editing system of the present invention and application thereof；
Fig. 5 is the Nicotiana tabacum L. target spot carrier DBN-GET371 structural representations of Mutiple Targets editing system of the present invention and application thereof；
Fig. 6 is the GUS colored graphs of the tobacco plant blade of the instantaneous conversion of Mutiple Targets editing system of the present invention and application thereof；
Fig. 7 is the GUS activity values of the tobacco plant blade of the instantaneous conversion of Mutiple Targets editing system of the present invention and application thereof Comparison diagram；
Fig. 8 is the Oryza sativa L. target spot carrier DBN-GET373 structural representations of Mutiple Targets editing system of the present invention and application thereof；
Fig. 9 is that the fine gene Os03G17700 of rice varieties Japan of Mutiple Targets editing system of the present invention and application thereof is upper four The relative position schematic diagram of target spot；
Figure 10 is the Oryza sativa L. target spot carrier DBN-GET374 structural representations of Mutiple Targets editing system of the present invention and application thereof；
Figure 11 is the Oryza sativa L. target spot carrier DBN-GET375 structural representations of Mutiple Targets editing system of the present invention and application thereof；
Figure 12 be Mutiple Targets editing system of the present invention and application thereof detection fragment deletion efficiency in amplification region and primer Relative position schematic diagram.
Specific embodiment
The technical scheme of Mutiple Targets editing system of the present invention and application thereof is further illustrated below by specific embodiment.
The selection of first embodiment, Semen Maydiss target site
According to Cas9 albumen recognize PAM sequences (NGG/NGGNG) principle, CRISPRDirect websites (http:// crispr.dbcls.jp/) target site sequence (20bp) from Semen Maydiss, i.e. 45CS1 target site sequences is screened, such as SEQ ID NO:Shown in 1.
The structure of second embodiment, shears carrier
1st, carrier is carrier and recombinant clone shears carrier are built
PCAMBIA2300 (CAMBIA mechanisms can provide) carrier is transformed, is built using conventional enzymatic cleavage methods Carrier is well-known to those skilled in the art, removes the BsaI sites on pCAMBIA2300 carriers by point mutation, while will Kanamycin expression cassette removes, and obtains pDBN skeleton carriers.Pat table is introduced to the pDBN skeleton carriers and reaches box, expressed Carrier DBN-PAT；PMI expression cassettes and Csy4 expression cassettes are introduced to the pDBN skeleton carriers, expression vector DBN-Csy4- is obtained PMI, both are used for following vector constructions.
By the Csy4-Cas9 nucleotide sequences of synthesis be connected into cloning vehicle pGEM-T (Promega, Madison, USA, CAT：A3600 on), operating procedure is carried out by Promega Products pGEM-T carriers description, obtains recombinant clone shears load Body DBN01-T, which builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1；F1 represents phage f1 Replication orgin；LacZ is LacZ start codons；SP6 is SP6RNA polymerase promoters；T7 is t7 rna polymerase promoter； Csy4-Cas9 is Csy4-Cas9 nucleotide sequences (Csy4-Cas9 nucleotide sequences such as SEQ ID NO:Shown in 4；Csy4 amino Acid sequence such as SEQ ID NO:Shown in 2, Cas9 aminoacid sequences such as SEQ ID NO:Shown in 3)；MCS is multiple clone site).
Then recombinant clone shears carrier DBN01-T is converted into escherichia coli T1 competent cells with heat shock method (Transgen, Beijing, China, CAT：CD501), its hot shock condition is：50 μ l escherichia coli T1 competent cells, 10 μ l Plasmid DNA (recombinant clone shears carrier DBN01-T), 42 DEG C of water-baths 30 seconds；37 DEG C of shaken cultivation 1 hour are (under 100rpm rotating speeds Shaking table shakes), surface scribble IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro- 3- indole-β of the bromo- 4- of 5-- D- galactosides) ampicillin (100mg/L) LB flat boards (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjust pH to growing overnight on 7.5) with NaOH.Picking white colony, in LB fluid medium (Trypsins Peptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, with NaOH adjust pH in 7.5) in temperature Overnight incubation under the conditions of 37 DEG C.Alkalinity extraction its plasmid：Bacterium solution is centrifuged into 1min under 12000rpm rotating speeds, supernatant is removed, is sunk Shallow lake thalline with the solution I of 100 μ l ice pre-coolings (25mM Tris-HCl, 10mM EDTA (ethylenediaminetetraacetic acid), 50mM glucoses, PH8.0) suspend；The solution II (0.2M NaOH, 1%SDS (sodium lauryl sulphate)) for adding 200 μ l newly to prepare, pipe is run 4 times, 3-5min on ice is put in mixing；The solution III (3M potassium acetates, 5M acetic acid) for adding 150 μ l ice-cold, is fully mixed immediately, 5-10min is placed on ice；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, in supernatant add 2 times of volumes without Water-ethanol, after mixing, room temperature places 5min；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, supernatant is abandoned, precipitates With drying after the washing with alcohol that concentration (V/V) is 70%；Add 30 μ l containing RNase (20 μ g/ml) TE (10mM Tris-HCl, 1mM EDTA, pH8.0) dissolution precipitation；The water-bath 30min at 37 DEG C of temperature, digests RNA；In temperature, -20 DEG C save backup.
The plasmid of extraction carries out sequence verification to positive colony Jing after the identification of SnabI and SpeI enzyme action, as a result shows restructuring The Csy4-Cas9 nucleotides sequences inserted in clone shears carrier DBN01-T are classified as SEQ ID NO in sequence table:Shown in 4 Nucleotide sequence, i.e. Csy4-Cas9 nucleotide sequences are correctly inserted into.
2nd, build recombinant expressed shears carrier
Enzyme action recombinant clone shears carrier DBN01-T and expression vector is distinguished with restricted enzyme SnabI and SpeI The Csy4-Cas9 nucleotide sequences for cutting are inserted expression vector DBN-PAT by DBN-PAT, are built using conventional enzymatic cleavage methods Carrier is well-known to those skilled in the art, is built into recombinant expression carrier DBN- shears, and it is as shown in Figure 2 which builds flow process (RB：Right margin；pr35S：Cauliflower mosaic virus 35 S promoter (SEQ ID NO:5)；Csy4-Cas9：Csy4-Cas9 nucleoside Acid sequence (Csy4-Cas9 nucleotide sequences such as SEQ ID NO:Shown in 4；Csy4 aminoacid sequences such as SEQ ID NO:Shown in 2, Cas9 aminoacid sequences such as SEQ ID NO:Shown in 3)；t35S：Cauliflower mosaic viruses 35S terminators (SEQ ID NO:6)； PAT：Careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:7)；LB：Left margin).
Recombinant expression carrier DBN- shears are converted into escherichia coli T1 competent cells, its hot shock condition with heat shock method For：50 μ l escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN- shears), 42 DEG C of water-baths 30 seconds；37 DEG C shaken cultivation 1 hour (shaking table shake under 100rpm rotating speeds)；Then it is solid in the LB of kanamycin containing 50mg/L (Kanamycin) Body flat board (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH adjust pH on 7.5) in Cultivate 12 hours under the conditions of 37 DEG C of temperature, picking white colony, in LB fluid mediums (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycin 50mg/L, with NaOH adjust pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation.Alkali Method extracts its plasmid.The plasmid for extracting is identified with after restricted enzyme SnabI and SpeI enzyme action, and positive colony is carried out Sequencing identification, as a result shows that nucleotides sequence of the recombinant expression carrier DBN- shears between SnabI and SpeI sites is classified as sequence table Middle SEQ ID NO:Nucleotide sequence shown in 4, i.e. Csy4-Cas9 nucleotide sequences.
The structure of 3rd embodiment, Nicotiana tabacum L. target spot carrier
In the present embodiment, target spot carrier is designed as prOsU6+ target site+sgRNA+polyT structures, each target site+sgRNA Between be connected with Csy4 cutting recognition sequence.Each fragment is seamlessly connected together by restricted enzyme BsaI.Csy4 Cutting recognition sequence such as SEQ ID NO:Shown in 8.5 target sites used in the present embodiment are：
45CS1 target site sequences, such as SEQ ID NO:Shown in 1；
RFP-L1 target site sequences, such as SEQ ID NO:Shown in 9；
RFP-L2 target site sequences, such as SEQ ID NO:Shown in 10；
RFP-R1 target site sequences, such as SEQ ID NO:Shown in 11；
RFP-R2 target site sequences, such as SEQ ID NO:Shown in 12.
1st, the design of primers of single target site and vector construction
45CS1 forward primers：aactgtggtctccaaacCCCAAGAGCGGGCGAGGTAG, such as SEQ ID NO:13 institutes Show；
45CS1 reverse primers：ctagatggtctcgaaaaCCTACCTCGCCCGCTCTTGGG, such as SEQ ID NO:14 institutes Show；
Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held are protection base, and italic lowercase is restriction enzyme site BsaI, Sticky end of the lower case with underscore for restriction enzyme site BsaI, normal font capitalization are 45CS1 target site sequences Or its reverse complementary sequence.
The 45CS1 forward primers and 45CS1 reverse primers 45CS1 target site sequences respectively including 20bp, two Person's reverse complemental, template, enters performing PCR amplification with Pfu enzymes (NEB) each other, and PCR system is as follows：
PCR reaction conditions are：98 DEG C of denaturations 30s, subsequently into following circulation：98 DEG C of degeneration 10s, 56-60 DEG C of annealing 30s, 72 DEG C of extension 30s/kb, common 30-32 circulation, last 72 DEG C of extensions 5-10min；Preserve in 4 DEG C.
Column kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd) was used to cross post to above-mentioned PCR primer pure Change, concrete grammar refers to its product description；BsaI enzyme action PCR primer and expression vector DBN-Csy4-PMI, cut glue reclaim pair After answering digestion products, by the expression vector DBN-Csy4-PMI products after enzyme action and PCR primer according to 1:10 ratio is connected with T4 Connect enzyme and connect 30min at 16 DEG C of temperature, using conventional enzymatic cleavage methods carrier construction be it is well-known to those skilled in the art, Nicotiana tabacum L. target spot carrier DBN-GET344 is built into, which builds flow chart (RB as shown in Figure 3：Right margin；prOsU6：Oryza sativa L. U6 is opened Mover (SEQ ID NO:16)；Csy4-R：Csy4 cuts recognition sequence (such as SEQ ID NO:Shown in 8)；45CS1：45CS1 target position Point sequence (SEQ ID NO:1)；sgRNA：SgRNA sequences are (such as SEQ ID NO:Shown in 15)；t35S：Cauliflower mosaic viruses 35S terminators (SEQ ID NO:6)；pr35S：Cauliflower mosaic virus 35 S promoter (SEQ ID NO:5)；GUUS：Contain The gus gene of 45CS1 target site sequences is (such as SEQ ID NO:Shown in 17)；tNos：The terminator of rouge alkali synthetase gene (SEQ ID NO:18)；prUbi：Maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:19)；PMI：Phosphomamlose Sugared isomerase gene (SEQ ID NO:20)；LB：Left margin).
Nicotiana tabacum L. target spot carrier DBN-GET344 is converted into escherichia coli T1 competent cells, its hot shock condition with heat shock method For：50 μ l escherichia coli T1 competent cells, 10 μ l plasmid DNA (Nicotiana tabacum L. target spot carrier DBN-GET344), 42 DEG C of water-baths 30 seconds； 37 DEG C of shaken cultivation 1 hour (shaking table shake under 100rpm rotating speeds)；Then in the LB solid plate (pancreases containing 50mg/L kanamycin Peptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH adjust pH on 7.5) in 37 DEG C of temperature Under the conditions of cultivate 12 hours, picking white colony, LB fluid mediums (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycin 50mg/L, with NaOH adjust pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation.Alkalinity extraction Its plasmid：Bacterium solution is centrifuged into 1min under 12000rpm rotating speeds, supernatant is removed, the solution I of 100 μ l ice pre-coolings of thalline is precipitated (25mM Tris-HCl, 10mM EDTA (ethylenediaminetetraacetic acid), 50mM glucoses, pH8.0) suspends；200 μ l are added newly to prepare Solution II (0.2M NaOH, 1%SDS (sodium lauryl sulphate)), will be pipe reverse 4 times, 3-5min on ice is put in mixing；Plus Enter the ice-cold solution IIIs of 150 μ l (3M potassium acetates, 5M acetic acid), fully mix immediately, place 5-10min on ice；In 4 DEG C of temperature, 5min is centrifuged under the conditions of rotating speed 12000rpm, 2 times of volume dehydrated alcohol are added in supernatant, room temperature places 5min after mixing； 5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, supernatant is abandoned, precipitation concentration (V/V) is 70% washing with alcohol After dry；Add TE (10mM Tris-HCl, 1mM EDTA, pH8.0) dissolution precipitations of the 30 μ l containing RNase (20 μ g/ml)；In Water-bath 30min at 37 DEG C of temperature, digests RNA；In temperature, -20 DEG C save backup.
The plasmid of extraction Jing after the identification of KpnI and AscI enzyme action carries out sequence verification to positive colony, as a result shows Nicotiana tabacum L. In target spot carrier DBN-GET344,45CS1 target site sequences are correctly inserted into.
2nd, the structure of multiple target site tandem vectors
According to step and method in the present embodiment 1, recognition sequence is cut as expanding template with the sgRNA+Csy4 for synthesizing (in amplification system<250ng), by 45CS1 target site sequences, RFP-L1 target site sequences, RFP-L2 target site sequences, RFP-R1 Target site sequence and RFP-R2 target site sequences bring template into by following primer, obtain after PCR amplifications containing target site sequence+ SgRNA+Csy4 cuts the product of recognition sequence, crosses column purification, BsaI enzyme action PCR primer and expression vector to above-mentioned PCR primer After DBN-Csy4-PMI cuts glue reclaim correspondence digestion products, by the expression vector DBN-Csy4-PMI products after enzyme action and 5 PCR Product fragment is according to 1:10 ratio connects 30min with T4 ligases at 16 DEG C of temperature, is built using conventional enzymatic cleavage methods Carrier is well-known to those skilled in the art, is built into Nicotiana tabacum L. target spot carrier DBN-GET372, its carrier schematic diagram such as Fig. 4 institutes Show (RB：Right margin；prOsU6：Oryza sativa L. U6 promoteres (SEQ ID NO:16)；Csy4-R：Csy4 cuts recognition sequence (such as SEQ ID NO:Shown in 8)；RFP-L1：RFP-L1 target site sequences (SEQ ID NO:9)；RFP-L2：RFP-L2 target site sequence (SEQ ID NO:10)；RFP-R1：RFP-R1 target site sequences (SEQ ID NO:11)；RFP-R2：RFP-R2 target site sequence (SEQ ID NO:12)；45CS1：45CS1 target site sequences (SEQ ID NO:1)；sgRNA：SgRNA sequences are (such as SEQ ID NO:15 institutes Show)；t35S：Cauliflower mosaic viruses 35S terminators (SEQ ID NO:6)；pr35S：Cauliflower mosaic virus 35 S promoter (SEQ ID NO:5)；GUUS：Gus gene containing 45CS1 target site sequences is (such as SEQ ID NO:Shown in 17)；tNos：Kermes Terminator (the SEQ ID NO of alkali synthase gene:18)；prUbi：Maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:19)；PMI：Phophomannose isomerase gene (SEQ ID NO:20)；LB：Left margin).
4 pairs of primers for introducing RFP-L1, RFP-L2, RFP-R1, RFP-R2 and 45CS1 target site are as follows：
Primers F 1：aactgtggtctccaaacGacgttctcggaggaggccagttttagagctagaaata, such as SEQ ID NO:Shown in 21；
Primer R1：ctagatggtctcgcaccTtgaagcgctgcctatacggcagtgaacgcaccgactcggtgc, Such as SEQ ID NO:Shown in 22；
Primers F 2：aactgtggtctccggtgCgcatggagttttagagctagaaata, such as SEQ ID NO:23 institutes Show；
Primer R2：ctagatggtctcgcccgGctactacctgcctatacggcagtgaacgcaccgactcggtgcc, Such as SEQ ID NO:Shown in 24；
Primers F 3：aactgtggtctcccgggCagctgcagttttagagctagaaatag, such as SEQ ID NO:25 institutes Show；
Primer R3：ctagatggtctcgggaggtgatgtccctgcctatacggcagtgaacgcaccgactcggtgcc A, such as SEQ ID NO:Shown in 26；
Primers F 4：aactgtggtctccctccCacaacggttttagagctagaaatagcaag, such as SEQ ID NO:27 It is shown；
Primer R4：ctagatggtctcgaaaacctacctcgcccgctcttgggctgcctatacggcagtgaacgcac , such as SEQ ID NO:Shown in 28；
Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held are protection base, and italic lowercase is restriction enzyme site BsaI, Sticky end of the lower case with underscore for restriction enzyme site BsaI.
According to the method in the present embodiment 1, Nicotiana tabacum L. target spot carrier DBN-GET372 is converted into escherichia coli with heat shock method； The plasmid of extraction Jing after the identification of KpnI and AscI enzyme action carries out sequence verification to positive colony, as a result shows Nicotiana tabacum L. target spot carrier 5 target spot (RFP-L1 target site+RFP-L2 target site+RFP-R1 target site+RFP-R2 target site+45CS1 in DBN-GET372 Target site) it is correctly inserted into.
According to the method for above-mentioned structure Nicotiana tabacum L. target spot carrier DBN-GET372, by RFP-L1 target sites, RFP-L2 target sites Expression vector DBN-Csy4-PMI is inserted with 45CS1 target sites, Nicotiana tabacum L. target spot carrier DBN-GET371 is obtained.Enzyme action and sequencing are tested In card Nicotiana tabacum L. target spot carrier DBN-GET371,3 target spots (RFP-L1 target site+RFP-L2 target site+45CS1 target sites) are correct Insertion, the carrier schematic diagram (RB as shown in Figure 5 of Nicotiana tabacum L. target spot carrier DBN-GET371：Right margin；prOsU6：Oryza sativa L. U6 starts Son (SEQ ID NO:16)；Csy4-R：Csy4 cuts recognition sequence (such as SEQ ID NO:Shown in 8)；RFP-L1：RFP-L1 target position Point sequence (SEQ ID NO:9)；RFP-L2：RFP-L2 target site sequences (SEQ ID NO:10)；45CS1：45CS1 target site sequences Row (SEQ ID NO:1)；sgRNA：SgRNA sequences are (such as SEQ ID NO:Shown in 15)；t35S：Cauliflower mosaic viruses 35S ends Only son (SEQ ID NO:6)；pr35S：Cauliflower mosaic virus 35 S promoter (SEQ ID NO:5)；GUUS：Containing 45CS1 targets The gus gene of site sequence is (such as SEQ ID NO:Shown in 17)；tNos：Terminator (the SEQ ID of rouge alkali synthetase gene NO:18)；prUbi：Maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:19)；PMI：Phosphomannose isomerase Gene (SEQ ID NO:20)；LB：Left margin).
Fourth embodiment, shears carrier and Nicotiana tabacum L. target spot carrier cotransformation Agrobacterium
By oneself constructed correct recombinant expression carrier DBN- shears respectively with DBN-GET344, DBN-GET371 and DBN- To in Agrobacterium GV3101, its conversion condition is GET372 liquid nitrogen method cotransformations：100 μ L Agrobacterium GV3101,3 μ L plasmids DNA (recombinant expression carrier)；It is placed in 5 minutes in liquid nitrogen, 37 DEG C of tepidarium 5 minutes；Agrobacterium GV3101 after conversion is inoculated with Cultivate 2 hours under the conditions of being 200rpm in 28 DEG C of temperature, rotating speed in LB test tubes, be applied to the rifampicin containing 50mg/L (Rifampicin) and 50mg/L kanamycin LB flat boards on until grow positive monoclonal, picking Colony Culture is simultaneously carried Take its plasmid, carry out digestion verification with restricted enzyme, as a result show recombinant expression carrier DBN- shears, DBN-GET344, DBN-GET371 and DBN-GET372 structures are completely correct.
5th embodiment, the acquisition of the tobacco plant of instantaneous conversion
Activation bacterium solution：With containing DBN- shears and DBN- target spots (DBN-GET344, DBN-GET371 or DBN-GET372) GV3101 strains line, according to 1:It is sharp containing 50mg/L that -80 DEG C of temperature frozen bacterium solution (GV3101) is seeded to 1ml by 50 ratio Good fortune flat (Rifampicin) and 50mg/L kanamycin YEP culture medium (beef extract 10g/L, yeast extract 10g/L, NaCl 5g/L, pH7.0) in；After about 20h, according to 1:Above-mentioned culture bacterium solution is increased to 4ml by 100 ratio, and in temperature 28 Incubated overnight 16-18h (OD at DEG C600About 2) value, then under the conditions of rotating speed is 8000rpm is centrifuged 4min, abandons supernatant, use 10mM MgCl2The bacterial concentration abandoned after supernatant is adjusted to into OD600=1；Add final concentration of 10mM MES (MES, PH5.6), final concentration of 200 μM of acetosyringone (AS) is subsequently adding, the static placement of room temperature was obtained after 3 hours infects liquid.With Liquid will be infected it will be injected into tobacco leaf (6-8 is all), and dark processing 48-72h without the syringe of syringe needle.Cigarette to instantaneous conversion Careless plant sampling carries out detection by quantitative.
The functional verification of sixth embodiment, Mutiple Targets editing system in reporter gene
The tobacco plant for proceeding to DBN-GET344 (1 target spot)+shears of instantaneous conversion acquisition is taken respectively, proceed to DBN- The tobacco plant of GET371 (3 target spot)+shears, the tobacco plant and empty vector control that proceed to DBN-GET372 (5 target spot)+shears Tobacco plant as sample, with reference to Jefferson etc. (Jefferson, R.A., Kavanagh, T.A.and Bevan, M.W.GUS fusions:beta-glucuronidase as a sensitive and versatile gene fusion Marker in higher plants.EMBO J., 1987,3901-3907) method, it is logical with 4-methyl umbelliferone (4-MU) Cross fluorescence spectrometry GUS active, i.e., 45CS1 target site sequences make GUUS recover GUS dyeing after being cut, while with wild type cigarette Careless plant is tested and analyzed according to the method described above as negative control.Experiment sets 3 repetitions, averages.
The concrete grammar for determining GUS activity is as follows：
Step 1, weigh respectively and proceed to the tobacco plant of DBN-GET344 (1 target spot)+shears, proceed to DBN-GET371 (3 targets Point) tobacco plant of+shears, the tobacco plant for proceeding to DBN-GET372 (5 target spot)+shears, empty vector control tobacco plant and The each 20mg of fresh blade of wild-type tobacco plants (6 leaf phase), with plant total protein extraction test kit, (buying is generation from Beijing health Discipline bio tech ltd) leaves total protein of above-mentioned sample is extracted, concrete grammar refers to its product description；
Step 2, under 4 DEG C of temperature, rotating speed 13000rpm be centrifuged 10min after, collect supernatant, at 4 DEG C of juxtaposition preserve；
Step 3, reaction buffer (the 50mM Na for preheating (37 DEG C, at least 30min) in 250 μ l3PO4(pH7.0), 1mM bis- Sulfur threitol (DTT), 10mM EDTA, 0.1% sarcosyl (Sarcosyl), 0.1% Polyethylene Glycol octyl phenyl Ether (Triton X-100), 1mM 4-methyl umbelliferones acyl-beta-glucosidase acid (MUG)) supernatant described in 50 μ l of middle addition, mixes It is even, after 15min being reacted at 37 DEG C of temperature, take out 30 μ l and be added in 270 μ l reaction terminating liquids (2% (m/v) sodium carbonate) eventually Only react；
Step 4, make 4-MU standard curve (0,50,100,250,500,1000,1500 and 2000pmol 4-MU is dilute Release in 2% sodium carbonate), the Ex365/Em455 values of each sample are determined with SpectraMax M2.
The experimental result of transgenic tobacco plant GUS activity is as shown in Figure 6 and Figure 7.Measure respectively and proceed to DBN-GET344 The tobacco plant of (1 target spot)+shears, the tobacco plant for proceeding to DBN-GET371 (3 target spot)+shears, proceed to DBN-GET372 (5 Target spot)+shears tobacco plant, empty vector control tobacco plant (NG) and wild-type tobacco plants (WT) GUS activity values (pmol 4-MU/mg albumen/min) is 527.72,454.56,567.00,0 and 0.Above-mentioned experimental result is also shown that and proceeds to simultaneously The tobacco plant of DBN-GET344 (1 target spot)+shears, the tobacco plant for proceeding to DBN-GET371 (3 target spot)+shears, proceed to The tobacco plant of DBN-GET372 (5 target spot)+shears, empty vector control tobacco plant (NG) and wild-type tobacco plants (WT) The sequence of GUS activity values is corresponding with the sequence of its GUS stained area.
In sum, when 45CS1 target sites are located at the first and third of different Mutiple Targets carriers and five respectively, Csy4 eggs Bai Junneng is recognized and is cut its correspondence sequence, and 45CS1 target site sequences can effectively be cut, be made containing 45CS1 target site sequences GUUS recover GUS dyeing；And test result indicate that GUS activity and coloration result no significant difference, illustrate that Csy4 albumen can be with Mutiple Targets editing system is applied to, its correspondence sequence is recognized and cut, so as to instruct Cas9 albumen to practice shooting multiple target sites, and together One target site diverse location target practice efficiency without significant difference.
7th embodiment, the selection of Oryza sativa L. target site
According to Cas9 albumen recognize PAM sequences (NGG/NGGNG) principle, CRISPRDirect websites (http:// crispr.dbcls.jp/) three target site sequences (20bp) from Oryza sativa L., i.e. BADH2 target site sequences is screened, such as SEQ ID NO:Shown in 29；CAS002 target site sequences, such as SEQ ID NO:Shown in 30；CAS003 target site sequences, such as SEQ ID NO:Shown in 31.
The structure of the 8th embodiment, Oryza sativa L. target spot carrier
In the present embodiment, target spot carrier is designed as prOsU6+ target site+sgRNA+polyT structures, each target site+sgRNA Between be connected with Csy4 cutting recognition sequence.Each fragment is seamlessly connected together by restricted enzyme BsaI.Csy4 Cutting recognition sequence such as SEQ ID NO:Shown in 8.3 target sites used in the present embodiment are：
BADH2 target site sequences, such as SEQ ID NO:Shown in 29；
CAS002 target site sequences, such as SEQ ID NO:Shown in 30；
CAS003 target site sequences, such as SEQ ID NO:Shown in 31.
The method of the Nicotiana tabacum L. target spot carrier DBN-GET372 built according to 3rd embodiment, is cut with the sgRNA+Csy4 for synthesizing Recognition sequence is cut for amplification template (in amplification system<250ng), by BADH2 target sites, CAS002 target sites and CAS003 target position Point brings template into by following primer, then in PCR amplifications, enzyme action insertion expression vector DBN-Csy4-PMI, obtains water Rice target spot carrier DBN-GET373.3 target spot (BADH2 target position in enzyme action and sequence verification Oryza sativa L. target spot carrier DBN-GET373 Point+CAS002 target site+CAS003 target sites) it is correctly inserted into, carrier schematic diagram such as Fig. 8 of Oryza sativa L. target spot carrier DBN-GET373 Shown (RB：Right margin；prOsU6：Oryza sativa L. U6 promoteres (SEQ ID NO:16)；Csy4-R：Csy4 cuttings recognition sequence is (such as SEQ ID NO:Shown in 8)；BADH2：BADH2 target site sequences (SEQ ID NO:29)；CAS002：CAS002 target site sequences (SEQ ID NO:30)；CAS003：CAS003 target site sequences (SEQ ID NO:31)；sgRNA：SgRNA sequences are (such as SEQ ID NO:Shown in 15)；t35S：Cauliflower mosaic viruses 35S terminators (SEQ ID NO:6)；prUbi：Maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:19)；PMI：Phophomannose isomerase gene (SEQ ID NO:20)； tNos：Terminator (the SEQ ID NO of rouge alkali synthetase gene:18)；LB：Left margin).
2 pairs of primers for introducing BADH2, CAS002 and CAS003 target site are as follows：
Primers F 5：aactgtggtctccaaacTttactgggagttatgaaacgttttagagctagaaata, such as SEQ ID NO:Shown in 32；
Primer R5：ctagatggtctcgaccaAtgcctccctgcctatacggcagtgaacgcaccgactcggtgcc, Such as SEQ ID NO:Shown in 33；
Primers F 6：aactgtggtctcctggtGcttcttggttttagagctagaaatag, such as SEQ ID NO:34 institutes Show；
Primer R6：ctagatggtctcgaaaaccggtgcatctggactcgtccctgcctatacggcagtgaacgcac , such as SEQ ID NO:Shown in 35；
Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held are protection base, and italic lowercase is restriction enzyme site BsaI, Sticky end of the lower case with underscore for restriction enzyme site BsaI.
9th embodiment, shears carrier and Oryza sativa L. target spot carrier cotransformation Agrobacterium
By oneself constructed correct recombinant expression carrier DBN- shears with DBN-GET373 liquid nitrogen method cotransformations to agriculture bar Bacterium LBA4404 (Invitrgen, Chicago, USA；CAT：In 18313-015), its conversion condition is：100 μ L Agrobacteriums LBA4404,3 μ L plasmid DNA (recombinant expression carrier)；It is placed in 10 minutes in liquid nitrogen, 37 DEG C of tepidarium 10 minutes；After conversion Agrobacterium LBA4404 is cultivated 2 hours in being inoculated in LB test tubes under the conditions of 28 DEG C of temperature, rotating speed are for 200rpm, is applied to containing 50mg/ Until growing positive monoclonal on the LB flat boards of the kanamycin of the rifampicin and 50mg/L of L, picking Colony Culture is simultaneously extracted Its plasmid, carries out digestion verification with digestion with restriction enzyme, as a result shows recombinant expression carrier DBN- shears and DBN- GET373 structures are completely correct.
Tenth embodiment, the rice plant for obtaining conversion
For agriculture bacillus mediated rice conversion, briefly, rice paddy seed (Japan is fine, and China Agricultural University provides) is connect Plant in inducing culture (N6 salt 3.1g/L, N6 vitamins, casein 300mg/L, maltose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) on, calluss (step 1 is induced from Mature Embryos of Rice：Wound healing is induced Step), afterwards, preferred calluss contact calluss with agrobacterium suspension, and the mediation can be planted by wherein Agrobacterium The construct of thing fertility is transferred at least one cell (step 2 on calluss：Infect step).In this step, more Injured tissue preferably immerses agrobacterium suspension (OD660=0.3, infect culture medium (N6 salt 3.1g/L, N6 vitamins, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in starting inoculation.Calluss co-culture one section of period (3 days) (step 3 with Agrobacterium：Co-culture step Suddenly).Preferably, calluss after step is infected in solid medium (N6 salt 3.1g/L, N6 vitamins, casein 300mg/ L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, plant Thing gel 3g/L, pH5.8) on cultivate.After the here co-cultivation stage, there is " recovery " step.In " recovery " step, recover Culture medium (N6 salt 3.1g/L, N6 vitamins, casein 300mg/L, sucrose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) at least exist it is a kind of oneself know suppress Agrobacterium growth antibiotic (cephamycin 150-250mg/L), without the selective agent (step 4 of vegetable transformant：Recovering step).Preferably, calluss are having antibiosis It is plain but do not have to cultivate on the solid medium of selective agent, to eliminate Agrobacterium and provide convalescent period as infected cell.Then, it is inoculated with Calluss in the culture medium containing selective agent (mannose) culture the transformed calli (step 5 of growth selection：Choosing Select step).Preferably, calluss are in screening solid medium (N6 salt 3.1g/L, N6 vitamins, the casein for having selective agent 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 2mg/L, plant gel 3g/L, PH5.8 cultivate on), cause the cell selective growth for converting.Then, callus regeneration is into plant (step 6：Regeneration step Suddenly), it is preferable that the calluss grown in the culture medium containing selective agent are in solid medium (N6 division culture mediums and MS lifes Root culture medium) on cultivate with aftergrowth.
The resistant calli that screening is obtained is transferred to the N6 division culture mediums (N6 salt 3.1g/L, N6 vitamins, cheese Plain 300mg/L, sucrose 20g/L, mannose 5g/L, 6- benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L, PH5.8 on), culture differentiation at 25 DEG C.Differentiation seedling out is transferred to the MS root medias, and (MS salt 2.15g/L, MS are tieed up He is life, casein 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8) on, cultivate high to about 10cm at 25 DEG C, move to Hot-house culture is to solid.In greenhouse, cultivate at 28 DEG C daily.
11st embodiment, functional verification of the Mutiple Targets editing system on rice genome
Generate altogether 71 Oryza sativa L. T0Plant.Sequencing result as shown in table 1, obtains target spot BADH2 Mutant Rices T0Plant Strain number is 25 plants, its mutation efficiency (mutation efficiency=correspondence mutant quantity/mutant T0Plant sum × 100%) be 35.2%；Obtain target spot CAS002 Mutant Rices T0Plant number is 21 plants, and its mutation efficiency is 29.5%；Obtain target spot CAS003 Mutant Rices T0Plant number is 35 plants, and its mutation efficiency is 49.3%.
The experimental result that table 1, Mutiple Targets editing system are applied on rice genome
It is above-mentioned test result indicate that：In Mutiple Targets carrier, Csy4 albumen can be recognized and cut its correspondence sequence, target position Point BADH2, target site CAS002 and target site CAS003 effectively can be cut, and obtain corresponding mutant；Illustrate Csy4 Albumen can apply to Mutiple Targets editing system, recognize and cut its correspondence sequence, so as to instruct the multiple targets of Cas9 albumen target practice Site.
12nd embodiment, on single-point cutting efficiency and fragment deletion efficiency Csy4 systems and tRNA systems comparison
1st, the selection of Oryza sativa L. target site
The principle of PAM sequences (NGG/NGGNG) is recognized according to Cas9 albumen, in the fine gene of rice varieties Japan Four target sites (as shown in Figure 9), i.e. T1 target site sequences, such as SEQ ID NO is selected on Os03G17700:Shown in 36；T2 targets Site sequence, such as SEQ ID NO:Shown in 37；T3 target site sequences, such as SEQ ID NO:Shown in 38；T4 target site sequences, such as SEQ ID NO:Shown in 39.
2nd, tRNA shears carriers are built
Method according to recombinant clone shears carrier is built described in second embodiment 1, by the Cas9 nucleoside of synthesis Acid sequence is connected on cloning vehicle pGEM-T, obtains recombinant clone tRNA shears carriers, and wherein, Cas9 is Cas9 nucleotide sequences (such as SEQ ID NO:Shown in 40).Cas9 nucleotide sequences described in enzyme action and sequence verification recombinant clone tRNA shears carriers are just Really insert.
Method according to recombinant expression carrier DBN- shears are built described in second embodiment 2, by SnabI and SpeI enzyme action The Cas9 nucleotide sequences insertion expression vector DBN-PAT that recombinant clone shears carrier cuts, obtains recombinant expression carrier DBN-tRNA shears.Nucleotide sequence in enzyme action and sequence verification recombinant expression carrier DBN-tRNA shears contains for sequence table Middle SEQ ID NO:Nucleotide sequence shown in 40, i.e. Cas9 nucleotide sequences, the Cas9 nucleotide sequences can connect described Pr35S promoteres and t35S terminators.
3rd, build target spot carrier
According to the method that 3rd embodiment builds Nicotiana tabacum L. target spot carrier DBN-GET372, with the sgRNA+Csy4 cuttings for synthesizing Recognition sequence is amplification template (in amplification system<250ng), T1 target sites, T2 target sites, T3 target sites and T4 target sites are led to Cross following primer and bring template into, then in PCR amplifications, enzyme action insertion expression vector DBN-Cys4-PMI, obtain Oryza sativa L. target Point carrier DBN-GET374.4 target spot (T1 target site+T2 targets in enzyme action and sequence verification Oryza sativa L. target spot carrier DBN-GET374 Site+T3 target site+T4 target sites) it is correctly inserted into, the carrier schematic diagram of Oryza sativa L. target spot carrier DBN-GET374 is as shown in Figure 10 (RB：Right margin；prOsU6：Oryza sativa L. U6 promoteres (SEQ ID NO:16)；Csy4-R：Csy4 cuts recognition sequence (such as SEQ ID NO:Shown in 8)；T1：T1 target site sequences (SEQ ID NO:36)；T2：T2 target site sequences (SEQ ID NO:37)；T3：T3 targets Site sequence (SEQ ID NO:38)；T4：T4 target site sequences (SEQ ID NO:39)；sgRNA：SgRNA sequences are (such as SEQ ID NO:Shown in 15)；t35S：Cauliflower mosaic viruses 35S terminators (SEQ ID NO:6)；prUbi：Maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:19)；PMI：Phophomannose isomerase gene (SEQ ID NO:20)； tNos：Terminator (the SEQ ID NO of rouge alkali synthetase gene:18)；LB：Left margin).
3 pairs of primers for introducing T1 target sites, T2 target sites, T3 target sites and T4 target sites are as follows：
Primers F 7：actacaggtctccaaacAgatgtcgtagagcaggtacgttttagagctagaaatagc, such as SEQ ID NO:Shown in 41；
Primer R7：aggtaaggtctctcgtgGcgatgtagactgcctatacggcagtgaacgcac, such as SEQ ID NO:Shown in 42；
Primers F 8：acaatcggtctcccacgGagctcagttttagagctagaaatagc, such as SEQ ID NO:43 institutes Show；
Primer R8：aggtaaggtctctcaatGggcatgatgggctgcctatacggcagtgaacgcac, such as SEQ ID NO:Shown in 44；
Primers F 9：acaatcggtctccattgGccggttttagagctagaaatagc, such as SEQ ID NO:Shown in 45；
Primer R9：aggtaaggtctctaaaacggcagtgctcttctgacagtctgcctatacggcagtgaacgcac , such as SEQ ID NO:Shown in 46；
Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held are protection base, and italic lowercase is restriction enzyme site BsaI, Sticky end of the lower case with underscore for restriction enzyme site BsaI.
According to the method for above-mentioned structure Oryza sativa L. target spot carrier DBN-GET374, with the sgRNA+tRNA cutting identification sequences for synthesizing It is classified as amplification template (in amplification system<250ng), by T1 target sites, T2 target sites, T3 target sites and T4 target sites by following Primer brings template into, then in PCR amplifications, enzyme action insertion expression vector DBN-tRNA-PMI, obtains Oryza sativa L. target spot carrier DBN-GET375.4 target spot (T1 target site+T2 target site+T3 in enzyme action and sequence verification Oryza sativa L. target spot carrier DBN-GET375 Target site+T4 target sites) it is correctly inserted into, the carrier schematic diagram (RB as shown in figure 11 of Oryza sativa L. target spot carrier DBN-GET375：The right Boundary；prOsU6：Oryza sativa L. U6 promoteres (SEQ ID NO:16)；pre-tRNA：TRNA cuts recognition sequence (such as SEQ ID NO:47 It is shown)；T1：T1 target site sequences (SEQ ID NO:36)；T2：T2 target site sequences (SEQ ID NO:37)；T3：T3 target sites Sequence (SEQ ID NO:38)；T4：T4 target site sequences (SEQ ID NO:39)；sgRNA：SgRNA sequences are (such as SEQ ID NO: Shown in 15)；t35S：Cauliflower mosaic viruses 35S terminators (SEQ ID NO:6)；prUbi：Maize ubiquitin (Ubiquitin) base Because of promoter (SEQ ID NO:19)；PMI：Phophomannose isomerase gene (SEQ ID NO:20)；tNos：Nopaline synthesizes Terminator (the SEQ ID NO of enzyme gene:18)；LB：Left margin).
3 pairs of primers for introducing T1 target sites, T2 target sites, T3 target sites and T4 target sites are as follows：
Primers F 10：actacaggtctccaaacAgatgtcgtagagcaggtacgttttagagctagaaatagcaa, Such as SEQ ID NO:Shown in 48；
Primer R10：ctggaaggtctcgcgtgGcgatgtagatgcaccagccgggaa, such as SEQ ID NO:49 institutes Show；
Primers F 11：actacaggtctcccacgGagctcagttttagagctagaaatagcaa, such as SEQ ID NO:50 It is shown；
Primer R11：ctggaaggtctcgcaatGggcatgatgggtgcaccagccgggaa, such as SEQ ID NO:51 institutes Show；
Primers F 12：actacaggtctccattgGccggttttagagctagaaatagcaa, such as SEQ ID NO:52 institutes Show；
Primer R12：ctggaaggtctcgaaaaCggcagtgctcttctgacagttgcaccagccgggaa, such as SEQ ID NO:Shown in 53；
Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held are protection base, and italic lowercase is restriction enzyme site BsaI, Sticky end of the lower case with underscore for restriction enzyme site BsaI.
4th, shears carrier and Oryza sativa L. target spot carrier cotransformation Agrobacterium
According to the method for cotransformation Agrobacterium described in the 9th embodiment, respectively by oneself constructed correct recombinant expression carrier DBN- shears and DBN-GET374, DBN-tRNA shears and DBN-GET375 liquid nitrogen method cotransformations in Agrobacterium LBA4404, Digestion verification is carried out with digestion with restriction enzyme, as a result shows recombinant expression carrier DBN- shears and DBN-GET374, DBN- TRNA shears and DBN-GET375 structures are completely correct.
5th, the comparative experimentss on single-point cutting efficiency
Oryza sativa L. kanamycin-resistant callus tissue is obtained according to the tenth embodiment methods described.Sequencing result as shown in table 2, T1 target sites, On T2 target sites and T4 target sites, the mutation efficiency (mutation efficiency=correspondence mutation kanamycin-resistant callus tissue of expression vector DBN-GET374 Quantity/kanamycin-resistant callus tissue sum × 100%) higher than expression vector DBN-GET375, respectively 61.7%, 88.8% and 53.5%； And on T3 target sites, the mutation efficiency of expression vector DBN-GET374 is less than expression vector DBN-GET375, it is 57.9%；I.e. The cutting efficiency of Csy4 albumen is apparently higher than tRNA cutting systems on the whole.
Table 2, on single-point cutting efficiency Csy4 systems and tRNA systems comparative experimentss result
6th, the comparative experimentss in fragment deletion efficiency
Using the Oryza sativa L. kanamycin-resistant callus tissue of above-mentioned acquisition, the fragment deletion efficiency of relevant position is detected by following primer, expanded Increase region and primer relative position is as shown in figure 12.Sequencing result is as shown in table 3, in T1T4 regions, T1T3 regions and T2T4 areas Domain, expression vector DBN-GET374 miss rate (the kanamycin-resistant callus tissue quantity of miss rate=generation disappearance/kanamycin-resistant callus tissue sum × 100%) higher than expression vector DBN-GET375, respectively 13.6%, 22.2% and 23.5%, fragment deletion total probability (fragment Kanamycin-resistant callus tissue quantity/kanamycin-resistant callus tissue the sum of disappearance total probability=any form disappearance × 100%) be up to 43.2%；That is Csy4 The fragment deletion efficiency of albumen is apparently higher than tRNA cutting systems.
The primer of the fragment deletion efficiency of detection relevant position is as follows：
Primers F 13：Gctgccttcgcctctcg, such as SEQ ID NO:Shown in 54；
Primer R13：Aattggtcccaattactccatc, such as SEQ ID NO:Shown in 55；
Primers F 14：Gcacctcgaccacgagaac, such as SEQ ID NO:Shown in 56；
Primer R14：Ggtacaggaaatactgcaacaacac, such as SEQ ID NO:Shown in 57；
Primers F 15：Gccaccttccttcctcatccg, such as SEQ ID NO:Shown in 58；
Primer R15：Gttgctcggcttcaggtcgc, such as SEQ ID NO:Shown in 59.
Table 3, in fragment deletion efficiency Csy4 systems and tRNA systems comparative experimentss result
In sum, the present invention is applied to Csy4 albumen and its correspondence recognition sequence in CRISPR/Cas9 systems first, Corresponding RNA sequence can be cut and is recognized using Csy4 albumen so that multiple sgRNA are transcribed in same expression cassette simultaneously Afterwards, independent fragment can be cut into, the Mutiple Targets editor to genome is realized；The cutting efficiency of single target spot is compared existing simultaneously There is technology tRNA cutting system to significantly improve, and to cutting the fragment deletion efficiency for causing also compared with tRNA cutting systems by Mutiple Targets It is high.
It should be noted last that, above example is only unrestricted to illustrate technical scheme, although ginseng The present invention is described in detail according to preferred embodiment, it will be understood by those within the art that, can be to the present invention Technical scheme modify or equivalent, without deviating from the spirit and scope of technical solution of the present invention.

Claims (20)

1. a kind of Mutiple Targets editing system, it is characterised in that including a) and b)：
A) Csy4 albumen and Cas9 albumen；
B) by two or more sgRNA comprising target target site sequence of Csy4 cutting recognition sequences spaced series.
2. Mutiple Targets editing system according to claim 1, it is characterised in that the aminoacid sequence tool of the Csy4 albumen There are SEQ ID NO:Aminoacid sequence shown in 2.
3. Mutiple Targets editing system according to claim 1 and 2, it is characterised in that the aminoacid sequence of the Cas9 albumen Row are with SEQ ID NO:Nucleotide sequence shown in 3.
4. the Mutiple Targets editing system according to any one of claim 1-3, it is characterised in that the Csy4 cuttings identification sequence Row are with SEQ ID NO:Nucleotide sequence shown in 8.
5. the Mutiple Targets editing system according to any one of claim 1-4, it is characterised in that the coding Csy4 albumen Nucleotide sequence and the nucleotide sequence effectively connection for encoding the Cas9 albumen.
6. the Mutiple Targets editing system according to any one of claim 1-5, it is characterised in that the coding Mutiple Targets editor Nucleotide sequence in system a) is operably coupled to the first regulating and controlling sequence.
7. Mutiple Targets editing system according to claim 6, it is characterised in that first regulating and controlling sequence includes that II type is opened Mover and/or localization domain.
8. Mutiple Targets editing system according to claim 7, it is characterised in that the II type promoter includes that Brassica oleracea L. var. botrytis L. is spent Mosaic virus 35S promoter or ubiquitin promoter.
9. the Mutiple Targets editing system according to any one of claim 1-8, it is characterised in that the coding Mutiple Targets editor Nucleotide sequence in system b) is operably coupled to the second regulating and controlling sequence.
10. Mutiple Targets editing system according to claim 9, it is characterised in that second regulating and controlling sequence includes III type Promoter.
11. Mutiple Targets editing systems according to claim 10, it is characterised in that the III type promoter includes that U6 starts Son or U3 promoteres.
12. a kind of recombinant expression carriers, it is characterised in that comprising Mutiple Targets editor system described in coding any one of claim 1-11 The nucleotide sequence of system.
A kind of 13. methods for realizing Mutiple Targets editor, it is characterised in that express claim 1-11 in being included in organism arbitrary The item Mutiple Targets editing system.
14. it is a kind of editor target site sequences or method, it is characterised in that include many targets described in any one of claim 1-11 Point editing system is imported in the organism comprising target site sequence.
A kind of 15. methods for improving Mutiple Targets editorial efficiency, it is characterised in that including will be more described in any one of claim 1-11 Target spot editing system imports organism genome.
A kind of 16. methods of the plant for producing Mutiple Targets editor, it is characterised in that include introducing coding power in Plant Genome Profit requires the nucleotide sequence of Mutiple Targets editing system described in any one of 1-11.
A kind of 17. methods for producing Mutiple Targets editor's plant seed, it is characterised in that include producing claim 16 methods described The plant selfing of raw Mutiple Targets editor, so as to obtain with Mutiple Targets editor's plant seed.
A kind of 18. methods for cultivating Mutiple Targets editor plant, it is characterised in that include：
Mutiple Targets editor's plant seed described at least one claim 17 of plantation；
The seed is made to grow up to plant.
Purposes of the Mutiple Targets editing system described in a kind of 19. any one of claim 1-11 in Mutiple Targets mutation biology is obtained.
20. a kind of test kits, it is characterised in that including Mutiple Targets editing system described in claim 11 or 12, many for realizing Target spot editor.
CN201610872349.3A 2016-09-30 2016-09-30 Multi-target-point editing system and application thereof Pending CN106520824A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610872349.3A CN106520824A (en) 2016-09-30 2016-09-30 Multi-target-point editing system and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610872349.3A CN106520824A (en) 2016-09-30 2016-09-30 Multi-target-point editing system and application thereof

Publications (1)

Publication Number Publication Date
CN106520824A true CN106520824A (en) 2017-03-22

Family

ID=58331288

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610872349.3A Pending CN106520824A (en) 2016-09-30 2016-09-30 Multi-target-point editing system and application thereof

Country Status (1)

Country Link
CN (1) CN106520824A (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018237369A3 (en) * 2017-06-23 2019-02-14 Vical Incorporated Lipid nanoparticle (lnp)-mediated delivery of a crispr-expressing plasmid dna for treating chronic hepatitis b virus infection
WO2019184655A1 (en) * 2018-03-27 2019-10-03 苏州克睿基因生物科技有限公司 Application of crispr/cas system in gene editing
CN111019967A (en) * 2019-11-27 2020-04-17 南京农业大学 Application of GmU3-19g-1 and GmU6-16g-1 promoters in soybean polygene editing system
CN111304241A (en) * 2020-04-03 2020-06-19 保山华大智慧农业科技股份有限公司 Method for improving yield of dry rice by multi-gene editing
CN111850011A (en) * 2020-06-24 2020-10-30 湖南文理学院 Improved Csy4 sequence, improvement method and application
CN112410234A (en) * 2019-08-21 2021-02-26 江南大学 Visual screening method for multi-target editing recombinant aspergillus strains
CN112654710A (en) * 2018-05-16 2021-04-13 辛瑟高公司 Methods and systems for directing RNA design and use

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015099850A1 (en) * 2013-12-26 2015-07-02 The General Hospital Corporation Multiplex guide rnas

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015099850A1 (en) * 2013-12-26 2015-07-02 The General Hospital Corporation Multiplex guide rnas

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LIOR NISSIM ET AL.: "Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells.", 《MOLECULAR CELL》 *
WAGNER,J.C ET AL.: "Cas9 endonuclease [Expression vector pCas9]", 《GENBANK: AII16583.1》 *
无: "MULTISPECIES: type I-F CRISPR-associated endoribonuclease Cas6/Csy4 [Pseudomonas]", 《NCBI REFERENCE SEQUENCE: WP_016254196.1》 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018237369A3 (en) * 2017-06-23 2019-02-14 Vical Incorporated Lipid nanoparticle (lnp)-mediated delivery of a crispr-expressing plasmid dna for treating chronic hepatitis b virus infection
WO2019184655A1 (en) * 2018-03-27 2019-10-03 苏州克睿基因生物科技有限公司 Application of crispr/cas system in gene editing
CN111971389A (en) * 2018-03-27 2020-11-20 苏州克睿基因生物科技有限公司 Application of CRISPR/Cas system in gene editing
JP2021523745A (en) * 2018-05-16 2021-09-09 シンテゴ コーポレイション Methods and systems for guide RNA design and use
US11802296B2 (en) 2018-05-16 2023-10-31 Synthego Corporation Methods and systems for guide RNA design and use
US11697827B2 (en) 2018-05-16 2023-07-11 Synthego Corporation Systems and methods for gene modification
EP3794130A4 (en) * 2018-05-16 2022-07-27 Synthego Corporation Methods and systems for guide rna design and use
CN112654710A (en) * 2018-05-16 2021-04-13 辛瑟高公司 Methods and systems for directing RNA design and use
CN112410234A (en) * 2019-08-21 2021-02-26 江南大学 Visual screening method for multi-target editing recombinant aspergillus strains
CN112410234B (en) * 2019-08-21 2022-08-23 江南大学 Visual screening method for multi-target editing recombinant aspergillus strains
CN111019967A (en) * 2019-11-27 2020-04-17 南京农业大学 Application of GmU3-19g-1 and GmU6-16g-1 promoters in soybean polygene editing system
CN111304241A (en) * 2020-04-03 2020-06-19 保山华大智慧农业科技股份有限公司 Method for improving yield of dry rice by multi-gene editing
CN111304241B (en) * 2020-04-03 2023-08-01 保山华大智慧农业科技股份有限公司 Method for improving yield of upland rice by polygene editing
CN111850011A (en) * 2020-06-24 2020-10-30 湖南文理学院 Improved Csy4 sequence, improvement method and application
CN111850011B (en) * 2020-06-24 2022-08-26 湖南文理学院 Improved Csy4 sequence, improvement method and application

Similar Documents

Publication Publication Date Title
CN106520824A (en) Multi-target-point editing system and application thereof
CN106318947A (en) Genome editing system and application thereof
CN109072207A (en) Improved method for modifying target nucleic acid
CN108546716A (en) A kind of genome edit methods
CN105543270A (en) Double resistance CRISPR/Cas9 carrier and application
WO2012164100A2 (en) Transcription terminator sequences
CN110891965A (en) Methods and compositions for anti-CRISPR proteins for use in plants
CN109468339A (en) For enhancing the regulatory nucleic acid molecules that constitutive gene is expressed in plant
CN105087640B (en) Adjust gene and its application of vegetable seeds development
CN114045303B (en) Artificial gene editing system for rice
CN113801891B (en) Construction method and application of beet BvCENH3 gene haploid induction line
CN105296534B (en) The method and its application of black fruit fructus lycii Establishment of Agrobacterium-Mediated Transformation System
CN103981216A (en) Backbone plasmid vector and application thereof
CN107828816A (en) One primary yeast Agrobacterium shuttle vector and construction method and application
CN104711262B (en) Maize Anther specificity promoter and its application
CN105695461B (en) A kind of specifically expressed promoter of wheat flag leaf and its application
CN106978438A (en) The method for improving homologous recombination efficiency
CN116286742B (en) CasD protein, CRISPR/CasD gene editing system and application thereof in plant gene editing
CN106119278A (en) A kind of method of Fructus Lycopersici esculenti, carrier and application thereof cultivating anti-TYLCV virus
CN106676129A (en) Method for improving genome edition efficiency
CN106755075A (en) The method for improving genome editorial efficiency
CN104109682B (en) A kind of pectin lyase BnPL gene and promoter thereof and application
CN106676132A (en) Efficient plant binary inducible gene expression recombinant plasmid
CN106434692A (en) Applications of rice OsPCF7 gene in culturing high-tillering rice varieties
US11932861B2 (en) Virus-based replicon for plant genome editing without inserting replicon into plant genome and uses thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170322