CN103352052B - Construction and application of multi-cistron double-label expression lentivirus vector - Google Patents
Construction and application of multi-cistron double-label expression lentivirus vector Download PDFInfo
- Publication number
- CN103352052B CN103352052B CN201310125062.0A CN201310125062A CN103352052B CN 103352052 B CN103352052 B CN 103352052B CN 201310125062 A CN201310125062 A CN 201310125062A CN 103352052 B CN103352052 B CN 103352052B
- Authority
- CN
- China
- Prior art keywords
- lentiviral vectors
- gene
- flag
- fragment
- mcs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a lentiviral vector, wherein the original hUbc promoter in FUGW is replaced by a U6 promoter or a strong promoter EF1alpha, the original EGFP gene is replaced by a strong fluorescent protein copGFP or a Tomato gene, a eukaryon resistance label gene, multiple clone sites and tag protein Flag are linked to the same cistron of the gene, and splicing protein T2A and P2A are adopted to link a plurality of genes on the same cistron. Compared with the conventional lentivirus vector, the lentiviral vector of the present invention has the following advantages that: a plurality of proteins can be concurrently and efficiently expressed with the same cistron, fluorescence intensity is high, induced function recovery is performed on the interfered gene, the vector is suitable for carrying large fragment genes, and the like. In addition, the lentivirus vector has characteristics of wide application, high efficiency, benefits for applications of the lentiviral vector in clinical and science researches, good practical value and good application prospects.
Description
Technical field
The invention belongs to field of biological pharmacy, particularly the two marks of a kind of polycistron are expressed the construction and application of lentiviral vectors.
Background technology
Lentiviral vectors refers to that lentiviral vectors has comprised packing, transfection, the needed genetic information of stable integration, is the chief component of slow virus carrier system with a kind of virus vector in human immunodeficiency virus-1 (HIV-1) source.The lentiviral vectors that carries foreign gene, under slow virus packaging plasmid, clone auxiliary, becomes infectious virion through virus packing, by cells infected or biological tissue, realizes foreign gene and expresses in cell or biological tissue.The infection pedigree of slow virus particle is wide, not only can efficiently infect division cells, and can infect non-division cells, can also efficiently infect primary cell and the embryonic stem cell of the transfection of plasmid difficulty, therefore increasing researchist starts to enter cell or tissue by lentiviral vectors technology transduction object fragment.In view of it has, foreign gene expression time in host of carrying is long, toxicity is low, portable exogenous genetic fragment is large, be difficult for bringing out the advantages such as host immune response, now become desirable gene transfer vector, be widely used in the field of scientific studies such as gene therapy, production of vaccine, transgenic animal, gene knockout, drug research, production target protein clone.
There is the result that polygene changes often in tumour, imports polygene and could realize its value during gene therapy.And during lentiviral vectors application, in order to realize different scientific research objects, as positioned the different objects such as tracking and screening simultaneously, need on lentiviral vectors, access reporter gene and eucaryon resistance screening gene etc.These all will, by building polycistron lentiviral vectors, express a plurality of genes simultaneously and realize on same carrier.Building at present the conventional strategy of slow virus polycistron carrier has: (1) internal ribosome entry site (internal ribosome entry site, IRES) connect, about 1000bp, but this mode exists, self structure is large, upstream and downstream is expressed the defects such as uneven, has seriously limited its application; (2) gene fusion, which has caused the folding or transportation of abnormal protein and has affected its expression; (3) use a plurality of promotors, each promotor starts independently encoder block.Its shortcoming is the easy phase mutual interference of promotor of series connection.Maximum feature of lentiviral vectors is carrier finite capacity, can insert the external source fragment that is no more than 2Kb, and titre increases and reduces with Insert Fragment length.As long as high titre could realize the gene of high effect nontoxic and import, therefore need to a plurality of albumen in same cistron, express by transformation carrier, be not also subject to the restriction of carrier capacity simultaneously.Have small molecule structure, 18-22 is amino acid whose can make this purpose become a reality from shear protein 2A polypeptide.
The 2A polypeptide of some positive strand virus codings, can make a plurality of genes in same cistron express respectively.The higher structure that its " shearing " mechanism is 2A in translation process causes size exclusion to ribosomal peptidyl transferase center; peptide bond between 2A and 2B cannot be formed; thereby the release that causes upstream gene starts downstream protein translation (M.J.Osborn, 2005 simultaneously; P.de Felipe, 2006).The 2A small peptide having now found that has P2A(porcine teschovirus), T2A (Thosea asigna virus).In view of 2A structure is short and small, shear efficiency is high, the advantage of upstream and downstream genetic expression balance, become the desirable instrument of polycistron that builds.
Summary of the invention
The invention provides a kind of lentiviral vectors, its be with lentiviral vectors FUGW for the carrier that sets out improves, inserted U6 multiple clone site, label protein Flag, shear protein P2A, label protein HA and shear protein T2A.
Preferably, described lentiviral vectors replaces with U6 promotor or strong promoter EF1 α by original hUbc promotor in FUGW.
Preferably, described lentiviral vectors is hyperfluorescenceZeng Yongminggaoyingguang albumen copGFP or Tomato gene by original EGFP Gene Replacement in FUGW.
Preferably, described lentiviral vectors has inserted eucaryon resistant maker gene.
Preferred, described lentiviral vectors is that original hUbc promotor in FUGW is replaced with to U6 promotor or strong promoter EF1 α, and be hyperfluorescenceZeng Yongminggaoyingguang albumen copGFP or Tomato gene by original EGFP Gene Replacement in FUGW, and in the same cistron of this hyperfluorescenceZeng Yongminggaoyingguang albumen copGFP or Tomato gene, connect eucaryon resistant maker gene and multiple clone site and label protein Flag, and adopt shear protein T2A to be connected a plurality of genes in this same cistron with P2A.
Further preferred, described eucaryon resistant maker gene is Puromycin or Hygromycin resistant gene.
Preferably, described lentiviral vectors, for the fragment of (comprising hUbC promotor and EGFP) between the Pac I of lentiviral vectors FUGW and EcoR I restriction enzyme site is replaced into the lentiviral vectors that U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin fragment obtains, is called again pUETP.Described U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin fragment is U6 promotor, strong promoter EF1 α, multiple clone site MCS, label protein Flag, shear protein P2A, fluorescin Tomato, shear protein T2A, eucaryon resistance marker Puromycin.
Preferably, described lentiviral vectors, for the fragment of (comprising hUbC Promoter and EGFP) between the Pac I of lentiviral vectors FUGW and EcoR I restriction enzyme site is replaced into the lentiviral vectors that U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin fragment obtains, is called again pUEGH.Described U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin fragment is U6 promotor, strong promoter EF1 α, multiple clone site MCS, label protein Flag, shear protein P2A, fluorescin copGFP, shear protein T2A, eucaryon resistance marker Hygromycin.
Preferred, the nucleotide sequence of described U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin fragment is as shown in SEQ ID NO.2 in sequence table; The nucleotide sequence of described U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin fragment is as shown in SEQ ID NO.3.
The present invention also provides a kind of recombined lentivirus vector, and it is to take lentiviral vectors of the present invention as carrier, has inserted exogenous nucleic acid.
Preferably, the shRNA that described exogenous nucleic acid is goal gene, described exogenous nucleic acid inserts in the U6 promotor of described lentiviral vectors.
Preferred, described exogenous nucleic acid inserts between the EcoR I and BamH I site of U6 promotor.
Preferably, the cDNA that described exogenous nucleic acid is goal gene, described exogenous nucleic acid inserts the multiple clone site MCS of described lentiviral vectors.
The present invention also provides a kind of slow virus particle, it is obtained by the method preparation comprising the following steps: by described lentiviral vectors or described recombined lentivirus vector and three kinds of packing helper plasmid Gag pol, VSVG, REV is transfection 293T cell together, obtains slow virus particle in cell culture fluid.
The application of lentiviral vectors described in the present invention also provides in gene clone or in expressing.
Meeting on the basis of this area general knowledge, above-mentioned each optimum condition, can arbitrary combination, obtains the preferred embodiments of the invention.
The raw material that the present invention is used or reagent except special instruction, equal commercially available obtaining.
Positive progressive effect of the present invention is:
The present invention for the carrier that sets out, is that the two marks of polycistron based on 2A shear protein are expressed lentiviral vectors with known carrier FUGW after improvement.Utilize original hUbc-promoter and EGFP element in gene engineering method excision FUGW, and be reintroduced back to U6-EF1 α-MCS-T2A-copGFP/Tomato-P2A-hygromycin/puromycin element.This element comprises U6 promotor, strong promoter EF1 α, multiple clone site MCS, label protein Flag, shear protein P2A, fluorescin copGFP or Tomato, label protein HA, shear protein T2A, eucaryon resistance marker Puromycin or Hygromycin.
U6 promotor of the present invention, it is the promotor that a kind of RNA polymerase III relies on, promotor self element is all positioned at the upstream of transcriptional domain, can make hairpin RNA (small hairpin RNA, shRNA) expression in mammalian cell, point-device at the synthetic RNA of the position transcriptional start from a fixed range of promotor, running into 4-5 continuous U stops, and make transcription product cut next at second uridylic place, but also can in mammalian cell, express more microRNA.The RNA that transcribes out forms after hair fastener spline structure, can form 2 outstanding uridylics at 3 ' end, and this is similar to natural siRNA, thereby is extremely conducive to double-stranded RNA and brings out RNAi.
Promotor EF1 α of the present invention, is a kind of promotor of strongly expressed, can make foreign gene wide expression in mammalian cell, even can in primary cell and stem cell, express.
Fluorescin Tomato of the present invention, this has the strongest albumen fluorescent brightness.It is a kind of orange derivative of original fruit albumen, and two copies that comprise Tomato are linked by the joint of 12 amino-acid residues.
Fluorescin copGFP of the present invention, is green fluorescent protein, and stability is high, and fluorescent brightness is strong, and its fluorescent brightness can be 3 times of EGFP.
The more existing conventional lentiviral vectors of lentiviral vectors of the present invention has more advantage.
1) the shRNA sequence of goal gene is inserted to U6 promotor, can reticent goal gene; Or the cDNA of goal gene is inserted to multiple clone site MCS region, can cross expression goal gene; Therefore, can carry out the reply of inducibility function to the gene having disturbed, for having more convictive functional verification experiment.
2) copGFP and Tomato that the fluorescin that the present invention uses is latest generation, fluorescence intensity is high, and form is more stable, and is monomer.
3) the present invention adopts the short and small 2A polypeptide of structure, make same high efficient expression of cistron while express a plurality of albumen, avoided upstream and downstream to express uneven, P2A has efficiently started the expression of fluorescin (copGFP or Tomato), and T2A has efficiently started resistance protein (puromycin or hygromyin).
4) the present invention adopts the short and small 2A polypeptide of structure, effectively raises virus titer, and the slow virus that is applicable to large fragment carrier builds.
5) lentiviral vectors of the present invention is applicable more extensive, and efficiency is higher, is more conducive to the application of lentiviral vectors in clinical and scientific research, has good practical value and application prospect.
Accompanying drawing explanation
Fig. 1 shows carrier collection of illustrative plates.Wherein, Figure 1A is carrier FUGW, and Figure 1B is carrier pUETP, and Fig. 1 C is carrier pUEGH.
Fig. 2 shows the electrophorogram for the connection product of vector construction.Wherein, Fig. 2 A is U6-EF1 α-MCS-FLAG fragment (1015bp) electrophorogram; Fig. 2 B is amplification P2A-Tomato-T2A-Puromycin fragment (1454bp) electrophorogram; Fig. 2 C is amplification copGFP-Hygromycin fragment (1926bp) electrophorogram.Wherein, 1,2,3 represent the nucleic acid fragment sample in revision test, and M represents molecular weight marker.
Fig. 3 shows pUETP-shCDH1 carrier transfection fluorogram.Wherein, A is pUETP light field figure; B is pUETP details in a play not acted out on stage, but told through dialogues figure; C is pUETP-shCDH1 light field figure; D is pUETP-shCDH1 details in a play not acted out on stage, but told through dialogues figure.
Fig. 4 shows CDH1knockdown checking.Wherein, 1, pUETP; 2, pUETP-shCDH1.
Fig. 5 shows pUEGH-CDH1 carrier transfection fluorogram.Wherein, A is pUEGH light field figure; B is pUEGH details in a play not acted out on stage, but told through dialogues figure; C is pUEGH-CDH1 light field figure; D is pUEGH-CDH1 details in a play not acted out on stage, but told through dialogues figure.
Fig. 6 shows that CDH1 crosses expression checking electrophorogram.1，pUEGH；2，pUEGH-CDH1。a，CDH1(130kD)；b，β-Actin。
Embodiment
Mode below by embodiment further illustrates the present invention, but does not therefore limit the present invention among described scope of embodiments.The experimental technique of unreceipted actual conditions in the following example, according to ordinary method and condition, or selects according to catalogue.
Embodiment 1U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puro(is called for short pUETP) lentiviral vectors structure
(1) increase respectively U6, EF1 α-MCS-FLAG, Tomato and Puromycin
1. U6 promotor increases
1) the synthetic U6 sequence of full gene
The synthetic U6 fragment of artificial full gene, sequence is as shown in SEQ ID NO.1.
2) take the synthetic U6 fragment of full gene is template, by overlapping extension PCR, removes Asc I and the Nhe I restriction enzyme site in U6 fragment, introduces EcoR I and BamH I restriction enzyme site simultaneously in sequence.Wherein, in first round PCR, with U6-F1 and U6-R1 primer PCR, amplify U6-1 fragment, with U6-F2 and U6-R2 primer amplification, go out U6-2 fragment.Second, take turns in PCR, take U6-1 and U6-2 fragment is template, take U6-F1 and U6-R2 as primer carries out pcr amplification, obtains the U6 fragment with EcoR I and BamH I restriction enzyme site.Primer sequence used is as follows:
U6-F1：5’-TTAATTAATTTCCCATGATTCC-3’
U6-R1：5’-GAATTCCTCGACGGATCCTCGTCCTTTCCACAAG-3’
U6-F2：5’-GGATCCGTCGAGGAATTCAGTTATTAATAGTAATC-3’
U6-R2：5’-CGCAGATCCTTAATTAAAACGCGGAAC-3’。
Adopt KOD-Plus PCR reagent (purchased from Toyobo company) to carry out PCR reaction.Pcr amplification system following (lower same):
PCR program following (lower same):
2. EF1 α-MCS-FLAG increases
The pMIRNA1 carrier (purchased from System Biosciences, SBI) of take is template, take hEF1-F and hEF1-MCS-R as primer, carries out qPCR amplification, and introduce MCS fragment in hEF1-MCS-R primer sequence, obtains EF1 α-MCS fragment.Using Flag – F and Flag – R primer simultaneously as pcr template and primer, and reaction and system are carried out as follows pcr amplification and are obtained FLAG fragment.Take EF1 α-MCS and FLAG as template, with hEF1-F and FLAG-R primer, carry out pcr amplification, obtain EF1 α-MCS-FLAG fragment.
EF1 α-MCS amplimer:
hEF1-F：5’-TTAATTAAGGATCTGCGATCGCTC-3’；
hEF1-MCS-R：
5’-GCTAGCtccTCTAGACGTCGACGGCGCGCCCATGGTGGCgGCGAT?CGCGTAGGCGCCGGTCACAG-3’。
FLAG amplimer:
FLAG-F：
5’-
CGTCTAGAggaGCTAGCggaTTCGAAGACTACAAAGACCATGACG?GTGATT
ACAAGGATGACGATGAC-3’；
FLAG-R：
5’-GCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCGTTAAC?CTTGTCATCGTCATCCTTGT-3’。
FLAG fragment PCR reaction system
PCR program is as follows:
3. P2A-Tomato and T2A-puromycin increase
The pLVX-IRES-td Tomato carrier (purchased from Clontech) of take is template, with Tomato-F and Tomato-R primer PCR, amplifies Tomato, introduces P2A in Tomato upstream simultaneously.The pMIRNA1 carrier (purchased from System Biosciences, SBI) of take is template, with Puro-F and Puro-R primer amplification, goes out Puromycin, introduces T2A in Puromycin upstream simultaneously.Wherein, primer sequence is as follows:
Tomato-F：
5’-
CAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGG?ACCTATGGTGAGCAAGGGCGAG-3’；
Tomato-R：
5’-CTCTCCGCTTCCATTTAAATaGTTAACGGCGTAGTCAGGCACGTC?GTAAGGATACTTGTACAGCTCGTCC-3’；
Puro-F：
5’-
GAAGCGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACG?TGGAGGAGAATCCCGGCCCTATGACCGAGTA-3’；
Puro-R：5’-TCAGCTATTTAAATGGCACCGGGCTTGCGGGTC-3’。
(2) overlapping extension PCR amplification U6-EF1 α-MCS-FLAG and P2A-Tomato-T2A-Puromycin
1. U6-EF1 α-MCS-FLAG increases
U6 and the EF1 α-MCS-FLAG of above-mentioned preparation of take is template, with U6-F1 and P2A-SpeI-R primer amplification, goes out U6-EF1 α-MCS-FLAG, introduces SpeI restriction enzyme site simultaneously, simultaneously pcr amplification 3 pipes, product is as shown in Figure 2.Wherein, primer sequence is as follows:
U6-F1：5’-TTAATTAATTTCCCATGATTCC-3’；
P2A-SpeI-R：5’-cgat?act?agt?GTT?AAC?CTT?GTC?ATC?GTC?ATC?C-3’。
2. amplification P2A-Tomato-T2A-Puromycin amplification
Tomato and the Puromycin of above-mentioned preparation of take is template, with P2A-SpeI-F and Puro-R primer amplification, go out Tomato-Puromycin, and introduce SpeI restriction enzyme site, simultaneously pcr amplification 3 pipes, product is as shown in Figure 2.Wherein, primer sequence is as follows:
P2A-SpeI-F：
5’-cgat?act?agt?GGA?AGC?GGA?GCT?ACT?AAC?TTC?AGC?CTG?CTG?AAG?C-3’；
Puro-R：5’-TCAGCTATTTAAATGGCACCGGGCTTGCGGGTC-3’。
(3) overlapping extension PCR amplification U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin
1., after respectively U6-EF1 α-MCS-FLAG and P2A-Tomato-T2A-Puromycin enzyme being cut, connect and be cloned in pJET1.2/blunt carrier (Fermentas).Wherein enzyme is cut system and linked system is as follows:
Enzyme is cut system:
Linked system:
2. U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin increases
PJET1.2-U6-EF1 α-MCS-FLAG carrier that the previous step of take builds is template together with pJET1.2-P2A-Tomato-T2A-Puromycin carrier, take U6-F1 and Puro-R as primer carries out pcr amplification, obtain U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin fragment.Wherein, primer is as follows:
U6-F1：5’-TTAATTAATTTCCCATGATTCC-3’；
Puro-R：5’-TCAGCTATTTAAATGGCACCGGGCTTGCGGGTC-3’。
3. U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin is cloned in lentiviral vectors FUGW, produces pUETP
Enzyme is cut system:
FUGW enzyme is cut product and is filled:
FUGW enzyme is cut product and is filled rear dephosphorylation:
U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin product phosphorylation:
Linked system:
Obtain U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puro lentiviral vectors (being called for short pUETP), Fig. 1 is shown in by its collection of illustrative plates.
Embodiment 2U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin(is called for short pUEGH) lentiviral vectors structure
(1) increase respectively U6, EF1 α-MCS-FLAG, P2A-copGFP and T2A-Hygromycin
1. U6, EF1 α-MCS-FLAG increase
The same pUETP of method.
2. T2A-Hygromycin increases
The linearizing fragment of linear hygro (purchased from Clontech) of take is template, by overlapping extension PCR point mutation, removes the EcoR I restriction enzyme site in Hygromycin.Wherein, in first round PCR, take linear hygro as template, is that primer amplification goes out Hygro-1 with Hygro-F and Hygro-R, with Hygro-MF and Hygro-MR, is that primer amplification goes out Hygro-2.Second, take turns in PCR, take Hygro-1 and Hygro-2 as template, take Hygro-F and Hygro-MR as primer PCR amplification, obtain the Hygromycin without EcoR I restriction enzyme site, and introduce T2A in Hygromycin upstream.Wherein primer sequence is as follows:
Hygro-F：
5’-GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAG?AATCCTGGACCTtATTTAAATATGAAAAAGCC-3’；
Hygro-R：
5’-TCAGCTATTTAAATTTCCTTTGCCCTCGGACG-3’；
Hygro-MF：5’-ATTGGGGAGTTCAGCGAG-3’；
Hygro-MR：5’-CTCGCTGAACTCCCCAAT-3’。
3. copGFP increases
Take pMIRNA1 carrier as template, with copGFP-F and copGFP-R primer amplification, go out copGFP, PCR system and program are the same.Wherein, primer sequence is as follows:
copGFP-F：5’-CAGCCTGCTGAAGCAGGCTG-3’；
copGFP-R：
5’-TCCTCTGCCCTCTCCGCTTCCGTTAACGGCGTAGTCAGGCACGT?CGTAAGGATAGCGAGATCCGGTGGAG-3’。
(2) overlapping extension PCR amplification U6-EF1 α-MCS-FLAG and copGFP-T2A-Hygromycin
1. U6-EF1 α-MCS-FLAG increases
The same pUETP of method.
2. copGFP-Hygromycin increases
CopGFP and the Hygromycin of above-mentioned preparation of take is template, goes out copGFP-Hygromycin, and introduce SpeI restriction enzyme site with P2A-SpeI-F and Hygro-MR primer amplification, and PCR product as shown in Figure 2.Wherein, primer sequence is as follows:
P2A-SpeI-F：
5’-cgat?act?agt?GGA?AGC?GGA?GCT?ACT?AAC?TTC?AGC?CTG?CTG?AAG?C-3’；
Hygro-MR：5’-CTCGCTGAACTCCCCAAT-3’。
(3) overlapping extension PCR amplification U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin
Overlapping extension PCR amplification U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin, the same pUETP of method, except primer sequence used.Primer sequence is as follows:
U6-F1：5’-TTAATTAATTTCCCATGATTCC-3’；
Hygro-MR：5’-CTCGCTGAACTCCCCAAT-3’。
U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin is cloned in the lentiviral vectors FUGW that PacI and EcoRI enzyme cut, produces pUEGH, the same pUETP of method.
Obtain U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin lentiviral vectors (being called for short pUEGH), Fig. 1 is shown in by its collection of illustrative plates.
The application example of embodiment 3pUETP and pUEGH lentiviral vectors
(1) pUETP is applied to the structure that CDH1 gene RNAi is stablized strain
1.CDH1 gene shRNA design of primers
According to shRNA design of primers principle, for CDH1 gene (No. NCBI: NM_004360.3) design 1 pair of shRNA primer.
shCDH1-F：
5’-GATCCGGCGATTCAAAGTGGGCACAGATGGTACCATCTGTGCC?CACTTTGAATCGTTTTTG-3’；
shCDH1-R：
5’-AATTCAAAAACGATTCAAAGTGGGCACAGATGGTACCATCTGT?GCCCACTTTGAATCGCCG-3’。
2. build pUETP-shCDH1 lentiviral vectors
With primers F (10 μ M) 10 μ l, primer R(10 μ M) 10 μ l, 10 * annealing buffer, 5 μ l, ddH
2the reaction system of O25 μ l is positioned over water-bath in 100 ℃ of thermostat water baths and, after 5 minutes, naturally cools to room temperature and anneal.Obtain after CDH1shRNA two strands, be connected in the EcoR I and BamH I site that the present invention transforms lentiviral vectors U6.Reaction system is: shRNA primer 4 μ l, lentiviral vectors 2 μ l, ddH
2o2 μ l, 10 * T4 damping fluid, 1 μ l, Roche T4 ligase enzyme 1 μ l, room temperature is placed 2 hours.Be transformed in GeneHogs competence Bacillus coli cells, coat containing on the solid LB culture plate of penbritin, cultivate after 14 hours, choose full positive colony and increase for 37 ℃, Promega plasmid purification test kit extracts plasmid, the checking of KpnI single endonuclease digestion.EB gel electrophoresis, visible two bands are the DNA fragmentation of 2.8Kb and 7.2Kb clearly, conforms to theory.Obtain pUETP-shCDH1 lentiviral vectors.
3.pUETP-shCDH1 slow virus packing
By pUETP-shCDH1 lentiviral vectors and three kinds packing helper plasmids (REV, purchased from Invitrogen for Gag pol, VSVG) together transfection 293T cell, after 24h, observe fluorescence situation.As shown in Figure 3, can find out that red fluorescence expression intensity is high, illustrate that P2A can efficiently start the expression of Tomato.And 48h and 72h collect the thick liquid of viral supernatant after transfection respectively.The virus liquid supernatant of collecting is after centrifugal removal residual cells and cell debris, and Millex-HV0.45 μ m membrane filtration is further to remove remaining cell debris.The titre that fluorometric determination records the thick liquid of virus is 3E7TU/ml.
4.A549 cell pUETP-shCDH1 stablizes strain screening
When the good object cell density of exponential phase growth conditions reaches 70%～80%, the processing of going down to posterity, and be inoculated in 24 orifice plates with suitable number, make second day cell density reach 30%～40% left and right.Use empty carrier slow virus liquid pUETP and pUETP-shCDH1 slow virus liquid to infect respectively A549 cell after 96 hours, add 0.4 μ g/ml puromycin to process cell 1 week, fluorescence infection proportion reaches 100%.Then puromycin concentration is down to 0.1 μ g/ml and continues enlarged culturing, obtain stable cell line, and collecting cell RNA sample and protein sample.The qPCR result of RNA sample CDH1 as shown in Figure 4, compare CDH1 inhibition in mRNA level and reach more than 97% with empty carrier pUETP by pUETP-shCDH1 slow virus infection group.A549 cell CDH1 gene RNAi is stablized the successful screening of strain, and the knockdown that can be effectively applied to goal gene in pUETP carrier is described, T2A can efficiently start the expression of puromycin simultaneously.
5. sum up
PUETP-shCDH1 stablizes the smooth structure of strain, the good authentication of CDH1 Gene silencing efficacy and high-intensity red fluorescence are expressed, element U6 on pUETP carrier has been described, Tomato, Puromycin is the high efficient expression of energy all, and it is uneven that on carrier, the application success of P2A and T2A has been avoided the expression of same cistron upstream and downstream.
(2) pUEGH crosses and expresses the structure of stablizing strain for large fragment CDH1
1. build pUEGH-CDH1 lentiviral vectors
The cDNA fragment of clone's CDH1 gene (2649bp), with cDNA fragment 4 μ l, the pUEGH carrier 2 μ l that cut through Asc I and Nhe I enzyme, Roche T4ligase1 μ l, 10 * T4buffer1 μ l, 2 μ l ddH
2the reaction system of O is positioned over 24 ℃ of water-baths and connects for 2 hours, connects product plasmid extraction after transforming, shaking bacterium and obtains pUEGH-CDH1 lentiviral vectors.
2.pUEGH-CDH1 slow virus packing
By pUEGH-CDH1 lentiviral vectors and three kinds packing helper plasmids (Gag pol, VSVG, REV) together transfection 293T cell, after 24h, observe fluorescence situation.As shown in Figure 5, can find out that green fluorescence expression intensity is high, its fluorescence intensity is 2 times of EGFP on former FUGW carrier, also illustrates that P2A can efficiently start the expression of copGFP simultaneously.And 48h and 72h collect the thick liquid of viral supernatant after transfection respectively.The virus liquid supernatant of collecting is after centrifugal removal residual cells and cell debris, and Millex-HV0.45 μ m membrane filtration is further to remove remaining cell debris.Utilizing GFP fluorescence observation method to measure the thick drop degree of pUEGH-CDH1 virus is 3X10
6tU/ml, and take FUGW, as carrier obtains, pFUGW-CDH1 lentiviral vectors is unpackaged goes out slow virus particle.
3.A549 cell CDH1 crosses to express and stablizes strain screening
When the good object cell density of exponential phase growth conditions reaches 70%～80%, the processing of going down to posterity, and be inoculated in 24 orifice plates with suitable number, make second day cell density reach 30%～40% left and right.Use empty carrier slow virus liquid pUEGH and pUEGH-CDH1 slow virus liquid to infect respectively A549 cell after 96 hours, add 100 μ g/ml Hygromycin to process cell 1 week, fluorescence infection proportion reaches 100%.Then Hygromycin concentration is down to 25 μ g/ml and continues enlarged culturing, obtain stable cell line, and collecting cell protein sample.As shown in Figure 6, the CDH1 of pUEGH-CDH1 group had significantly expression effect to the western blot result of albumen sample.A549 cell CDH1 gene overexpression is stablized the successful screening of strain, illustrates that in pUEGH carrier, can be effectively applied to crossing of large fragment gene expresses, and has also illustrated that T2A can efficiently start the expression of hygromycin simultaneously.
4. sum up
PUEGH-CDH1 crosses and expresses successful screening and the checking of stablizing strain, and EF1 α, coGFP and the high efficient expression of the equal energy of Hygromycin on pUEGH carrier have been described, it is uneven that on carrier, the application success of P2A and T2A has been avoided the expression of same cistron upstream and downstream.Meanwhile, the successful packing of CDH1 gene (size is 2649bp) slow virus liquid, illustrates that pUEGH carrier can be for the slow virus packing of the above large fragment gene of 2Kb.
Should be understood that, after having read foregoing of the present invention, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (7)
1. a lentiviral vectors, it is to improve for the carrier that sets out with lentiviral vectors FUGW, it is characterized in that, described lentiviral vectors is for being replaced into by the fragment that comprises hUbC promotor and EGFP between the Pac I of lentiviral vectors FUGW and EcoR I restriction enzyme site the lentiviral vectors that U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin fragment obtains; Or, described lentiviral vectors is for the fragment that comprises hUbC Promoter and EGFP between the Pac I of lentiviral vectors FUGW and EcoR I restriction enzyme site is replaced into the lentiviral vectors that U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin fragment obtains, and the nucleotide sequence of described U6-EF1 α-MCS-FLAG-P2A-Tomato-T2A-Puromycin fragment is as shown in SEQ ID NO.2 in sequence table; The nucleotide sequence of described U6-EF1 α-MCS-FLAG-P2A-copGFP-T2A-Hygromycin fragment is as shown in SEQ ID NO.3 in sequence table.
2. a recombined lentivirus vector, is characterized in that, it take lentiviral vectors claimed in claim 1 as carrier, has inserted exogenous nucleic acid.
3. recombined lentivirus vector as claimed in claim 2, is characterized in that, the shRNA that described exogenous nucleic acid is goal gene, and described exogenous nucleic acid inserts in the U6 promotor of described lentiviral vectors.
4. recombined lentivirus vector as claimed in claim 3, is characterized in that, described exogenous nucleic acid inserts between the EcoR I and BamH I site of U6 promotor.
5. recombined lentivirus vector as claimed in claim 2, is characterized in that, the cDNA that described exogenous nucleic acid is goal gene, and described exogenous nucleic acid inserts the multiple clone site of described lentiviral vectors.
6. a slow virus particle, it is characterized in that, it is obtained by the method preparation comprising the following steps: by lentiviral vectors claimed in claim 1 or recombined lentivirus vector claimed in claim 2 and three kinds of packing helper plasmid Gag pol, VSVG, REV is transfection 293T cell together, obtains slow virus particle in cell culture fluid.
7. the application of lentiviral vectors as claimed in claim 1 in gene clone or in expressing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310125062.0A CN103352052B (en) | 2012-04-11 | 2013-04-11 | Construction and application of multi-cistron double-label expression lentivirus vector |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210106252 | 2012-04-11 | ||
| CN201210106252.3 | 2012-04-11 | ||
| CN201310125062.0A CN103352052B (en) | 2012-04-11 | 2013-04-11 | Construction and application of multi-cistron double-label expression lentivirus vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103352052A CN103352052A (en) | 2013-10-16 |
| CN103352052B true CN103352052B (en) | 2014-11-26 |
Family
ID=49308463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310125062.0A Active CN103352052B (en) | 2012-04-11 | 2013-04-11 | Construction and application of multi-cistron double-label expression lentivirus vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103352052B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3853366A4 (en) * | 2018-09-19 | 2022-06-22 | The Trustees of Indiana University | Vectors expressing color and selectable markers |
| CN109295102B (en) * | 2018-10-09 | 2021-06-01 | 新乡医学院 | Tumor specific gene expression cassette, recombinant expression vector, construction method and application |
| CN115433741A (en) * | 2022-06-23 | 2022-12-06 | 广西大学 | Construction method of recombinant virus taking Gatas virus as vector to express reporter protein |
| CN116218844B (en) * | 2022-09-07 | 2024-05-14 | 吉满生物科技(上海)有限公司 | Bidirectional promoter, over-expression vector thereof, lentiviral expression plasmid and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101100677A (en) * | 2007-06-08 | 2008-01-09 | 中日友好医院 | Method of preparing stem cell line for excreting insulin by using slow virus vectors of coding multiple exogenous gene |
| WO2009134883A1 (en) * | 2008-04-29 | 2009-11-05 | Cornell University | Substances and compositions for enhancing dna repair and methods of use |
| WO2009152529A2 (en) * | 2008-06-13 | 2009-12-17 | Whitehead Institute For Biomedical Research Nine Cambridge Center | Programming and reprogramming of cells |
-
2013
- 2013-04-11 CN CN201310125062.0A patent/CN103352052B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101100677A (en) * | 2007-06-08 | 2008-01-09 | 中日友好医院 | Method of preparing stem cell line for excreting insulin by using slow virus vectors of coding multiple exogenous gene |
| WO2009134883A1 (en) * | 2008-04-29 | 2009-11-05 | Cornell University | Substances and compositions for enhancing dna repair and methods of use |
| WO2009152529A2 (en) * | 2008-06-13 | 2009-12-17 | Whitehead Institute For Biomedical Research Nine Cambridge Center | Programming and reprogramming of cells |
Non-Patent Citations (6)
| Title |
|---|
| ED-L2-LMP1-EGFP融合基因慢病毒载体的构建及鉴定;张庆玲等;《广东医学》;20070331;361－363 * |
| Sui G，Shi Y.Gene silencing by a DNA vector-based RNAi technology.《methods mol biol》.2005,205－218. * |
| 利用In-Fusion技术构建存活素-增强型绿色荧光蛋白融合基因重组慢病毒表达载体;林朝贵等;《心血管康复医学杂志》;20100228;10－13 * |
| 张庆玲等.ED-L2-LMP1-EGFP融合基因慢病毒载体的构建及鉴定.《广东医学》.2007,361－363. * |
| 林朝贵等.利用In-Fusion技术构建存活素-增强型绿色荧光蛋白融合基因重组慢病毒表达载体.《心血管康复医学杂志》.2010,10－13. * |
| 王洪权等.TAT-BACEsp-GFP三融合基因慢病毒载体的构建与鉴定.《西安交通大学学报（医学版）》.2008,7－9. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103352052A (en) | 2013-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| EP3505629A1 (en) | Sirna of human interleukin 6, recombinant expression car-t vector, and construction method and use thereof | |
| CN103352052B (en) | Construction and application of multi-cistron double-label expression lentivirus vector | |
| CN108064305B (en) | Programmable oncolytic virus vaccine system and applications thereof | |
| KR102409077B1 (en) | Programmable anti-cancer antivirus system and its application | |
| CN104928292A (en) | Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids | |
| CN105200059B (en) | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector | |
| CN116218906A (en) | RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method | |
| CN104762322A (en) | Retrovirus gene transfer system for prawn cell | |
| CN109136377B (en) | Therapeutic agent and diagnostic kit for adult T cell leukemia | |
| CN102220377B (en) | Novel interference vector for increasing animal lean meat percentage and application thereof | |
| CN110964727A (en) | shRNA lentiviral expression vector construction method for specifically inhibiting c-myc gene expression and application thereof | |
| CN110951733A (en) | siRNA for targeted inhibition of esophageal cancer EGFL6 gene expression, constructed expression vector and application | |
| CN103966259B (en) | A kind of restructuring of the siRNA based on J subgroup avian leucosis virus gag gene conserved sequence interference carrier and its preparation method and application | |
| CN111235150A (en) | shRNA for inhibiting replication of African swine fever virus and application thereof | |
| CN110438086A (en) | NDUFS3 Knockdown and/or the steady of overexpression turn strain and its construction method | |
| CN111254161A (en) | Method for establishing CRISPR-based gene-knocked-down lung cancer cell strain and cell strain | |
| CN113584085B (en) | Lentiviral vector for suspension cells and application thereof | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN104762325B (en) | A kind of method of IFNAR2 genes in 1 cell lines of silence DF | |
| CN114836472A (en) | PARP-1shRNA recombinant lentiviral vector, cell line stably transfected with HaCaT by vector and application of cell line | |
| CN101633930B (en) | Carrier for rapidly screening small interfering RNA and construction method thereof and application thereof | |
| CN111560374A (en) | Construction and application of lentivirus and recombinant vector for specifically inhibiting c-fos gene expression | |
| CN102643859A (en) | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN117070499A (en) | Application of Cas12g in preparation of mammal cell RNA editing product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |