CN102643859A - Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof - Google Patents
Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof Download PDFInfo
- Publication number
- CN102643859A CN102643859A CN2012100935240A CN201210093524A CN102643859A CN 102643859 A CN102643859 A CN 102643859A CN 2012100935240 A CN2012100935240 A CN 2012100935240A CN 201210093524 A CN201210093524 A CN 201210093524A CN 102643859 A CN102643859 A CN 102643859A
- Authority
- CN
- China
- Prior art keywords
- hninl
- homo
- gene
- lentiviral vector
- pgcsil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof. The lentiviral vector aiming at ShRNA of the hNINL gene is experimentally constructed; a synthetic DNA (Deoxyribonucleic Acid) segment aiming at the ShRNA is mediated through the lentiviral vector, and is in cotransfection 293 T cell culture with two vectors of pHelper 1.0 and pHelper 2.0; and after the recombinant lentiviral vector is obtained, a target cell is cotransfected, so that RNA interference aiming at the hNINL gene is realized. The adopted inactive third-generation lentiviral vector (SIN) has the advantages of safety, reliability, capability of infecting nondividing cells, long-duration expression of integrating target genes into target cell gene groups, small immune reaction and the like, and is an ideal vector. According to the lentiviral vector, the interference effect on human breast cancer cells MCF-7 reaches 60-85 percent, so that the recombinant lentiviral vector lays a good experimental foundation for further research of relevant hNINL genes, and can be widely used for in vivo gene treatment and gene function research.
Description
Technical field
The invention belongs to molecular biology, biological medicine and gene engineering technology field relate generally to RNA interference recombinant lentivirus vector (LV-sh-hNINL) and preparation thereof to hNINL (humanNinein-like) gene.
Background technology
Tumour be body under various tumorigenesis effect of factors, the cell of local organization loses the normal regulation to its growth on gene level, cause the not enough and local lump that forms of clonal abnormality hyperplasia and apoptosis.Under the effect of tumorigenesis factor, the gene of cell is undergone mutation in vivo and in vitro, causes normal cell to change tumour cell into, and form, function and metabolism are acted in an unreasonable way unusually, thereby has obtained new biological property.
See from cell levels, cancer be utmost point haphazard part.See that from heredity cancer all is by a cell development, by a cell development that loses propagation control.Human body has the cell of million, all has every day tens cells to divide, and almost any one cell all might the canceration by transgenation in theory, but in fact, tumour is a gradual process, relates to the accumulation of reaction of high order and sudden change.In this process, the clone of canceration is the not control of the interior regulation mechanism of acceptor more and more, and infect to healthy tissues gradually.After pernicious transformation took place cell, cancer cells continued the accumulation sudden change, gives mutant cell new characteristic, makes cancer cells have more danger.
The large protein that molecular weight of BRCA1 genes encoding is 220kD, this albumen has a plurality of functional zone, can with many important protein binding; As oncogene protein (c-Myc, E2F), suppressor gene protein (p53; Rb, BRCA2, ATM); DNA repairs GAP-associated protein GAP, cyclin and transcription regulaton factor etc.BRCA1 can not only cell growth inhibiting, also participates in cell cycle regulating, and genetic transcription is regulated, and multiple important cells activities such as dna damage reparation and apoptosis play an important role in keeping genome stability
Bacp/Nlp (BRCA1 associated centrosome protein/Ninein-like protein) albumen is by Ninein-like (NINL) genes encoding; Be one and the common localized new albumen of BRCA1 existence, and same γ-tubulin is positioned centrosome altogether.Research shows; All can raise γ-TuRC (tubulin ring complex) composition γ-Tublin and hGCP4 during Bacp/Nlp albumen is tested in vivo and in vitro, point out this albumen maybe be as a candidate's GTBp (γ-Tublin complex binding protein) member.Simultaneously, Bacp/Nlp promotes the microtubule nucleus to form, and it is necessary at m period from the formation that centrosome dissociates for spindle body, explains that this albumen plays an important role in chromosomal normal separation and division of cytoplasm.
Compare with healthy tissues; Extensively there is the proteic expression phenomenon of crossing of Bacp/Nlp in the tumor tissues such as human breast cancer, lung cancer; After the proteic expression of Bacp/Nlp is suppressed by siRNA; The phenomenon of a plurality of centrosomies can appear in cell, and division of cytoplasm is suppressed and can not accomplishes, and causes cell to contain a plurality of nucleus; And with the NIH3T3 cell of Bacp/Nlp high expression level after nude mice is injected, can cause nude mice to become knurl.These find prompting, and Bacp/Nlp albumen possibly take place in tumour, play an important role in the evolution.
RNA disturb (RNA interference, RNAi) be meant high conservative during evolution, by double-stranded RNA (double-stranded RNA, phenomenon that dsRNA) bring out, the efficient specificity degraded of homologous mRNA.Owing to use the RNAi technology can specificity to reject or close the expression of specific gene, so should technology be widely used in exploring the field of gene of gene function and communicable disease and malignant tumour.
Allogenic gene random integrations such as virogene, artificial transgene, transposon and when utilizing host cell to transcribe, often produce some dsRNA in the host cell gene group.Host cell immediately produces reaction to these dsRNA, the endonuclease Dicer in its kytoplasm with dsRNA cut into a plurality of small fragment RNAs with length-specific and structure (about 21～23bp), i.e. siRNA.SiRNA unwinds into positive-sense strand and antisense strand under the effect of intracellular rna helicase; Continue by antisense siRNA again with body in some enzymes (comprising restriction endonuclease, excision enzyme, helicase etc.) combine to form the reticent mixture of RNA inductive (RNA-induced silencing complex, RISC).RISC carries out specificity with the homologous region of the mRNA of expression of exogenous genes and combines, and RISC has the function of nucleicacidase, at combining site cutting mRNA, cleavage site promptly be with siRNA in the complementary bonded of antisense strand two ends.Fracture mRNA after being cut degrades immediately, thereby brings out the DeR of host cell to these mRNA.SiRNA can not only guide RISC cutting homology strand mRNA; And can be used as primer and target RNA knot and be incorporated in RNA polymerase (RNA-dependent RNApolymerase; RdRP) the down synthetic more how new dsRNA of effect; New synthetic dsRNA produces a large amount of secondary siRNA by the Dicer cutting again, thereby the effect of RNAi is further amplified, and said target mrna is degraded fully the most at last.
ShRNA (short hairpin RNA) is that short hairpin RNA comprises two short inverted repeats, and one of them and goal gene are complementary, and middle loop sequence is separated and formed hairpin structure.ShRNA is processed to the siRNA goal gene of effectively degrading and suppresses its expression in vivo.But to this technology be applied to clinical treatment, need to solve the RNA interference fragment and express major issues such as continuing to reach expression efficiency.
The means of transferring of goal gene adopts virus vector more in the gene therapy at present, and is wherein commonly used with retroviral vector and adenovirus carrier.Because retroviral vector can only infect the division stage cell, the dna fragmentation length of holding foreign gene is no more than 8kb; During the adenovirus carrier cells infected, viral DNA is free in the nucleus, is not incorporated on the karyomit(e), can not realize stable long-term expression in vivo, and application causes immunoreation easily repeatedly.Lentiviral vectors with human immunodeficiency virus-1 (HIV-1) source more and more receives people's attention.Discover that the maximum characteristics of lentiviral vectors are to infect non-division stage cell, people successfully use lentiviral vectors and have infected neurocyte, liver cell, hemopoietic stem cell, islet cells, muscle cell, retinal pigment epithelium, airway epithelia cell etc.In addition, the fragment that lentiviral vectors holds exogenous target gene is big, can longer in vivo expression, and immunoreation is little, and security is better.
It is suicide property (self-inactivating that the present invention selects third generation replication defect type lentiviral vectors for use; SIN) virus; In vivo can longer expression and safe, can solve the problem such as target property, security, integration efficiency of RNA perturbation technique gene therapy.Therefore RNA interference effect long-term existence in target cell of lentiviral vectors mediation can be better performance interference effect and creates conditions.
Summary of the invention
An object of the present invention is to provide a kind of to hNINL gene RNA interferential recombined lentivirus vector; This carrier is the third generation lentiviral vectors SIN of self inactivation; It is characterized in that; Described carrier S IN contains pGCSIL-GFP/U6-Sh hNINL recombinant vectors, and described pGCSIL-GFP/U6-Sh hNINL recombinant vectors is in the MCS of pGCSIL-GFP carrier, to have connected double chain DNA fragment; The sequence of described double chain DNA fragment is a kind of (wherein S represents positive-sense strand, and AS represents antisense strand) in the following sequence:
(1)hNINL-homo-284：
hNINL-homo-284-S：
5’-GATCCTGTGGCTGTGTTGTCTTCATTCAAGAGATGAAGACAACACAGCCACATTTTTTG-3’
hNINL-homo-284-AS：
5’-AATTCAAAAAATGTGGCTGTGTTGTCTTCATCTCTTGAATGAAGACAACACAGCCACAG-3’
(2)hNINL-homo-810：
hNINL-homo-810-S：
5’-GATCCGATCAAGACGGAGACGGCATTCAAGAGATGCCGTCTCCGTCTTGATCTTTTTTG-3’
hNINL-homo-810-AS：
5’-AATTCAAAAAAGATCAAGACGGAGACGGCATCTCTTGAATGCCGTCTCCGTCTTGATCG-3’
(3)hNINL-homo-3283：
hNINL-homo-3283-S：
5’-GATCCGGGCTCTGGAGAAACATGTTTCAAGAGAACATGTTTCTCCAGAGCCCTTTTTTG-3’
hNINL-homo-3283-AS：
5’-AATTCAAAAAAGGGCTCTGGAGAAACATGTTCTCTTGAAACATGTTTCTCCAGAGCCCG-3’
Another object of the present invention provides described preparation method to hNINL gene RNA interferential recombined lentivirus vector; It is characterized in that; According to hNINL mRNA sequence, double chain DNA fragment has been synthesized in design, and described double chain DNA fragment is a kind of in the following sequence:
(1)hNINL-homo-284：
hNINL-homo-284-S：
5’-GATCCTGTGGCTGTGTTGTCTTCATTCAAGAGATGAAGACAACACAGCCACATTTTTTG-3’
hNINL-homo-284-AS：
5’-AATTCAAAAAATGTGGCTGTGTTGTCTTCATCTCTTGAATGAAGACAACACAGCCACAG-3’
(2)hNINL-homo-810：
hNINL-homo-810-S：
5’-GATCCGATCAAGACGGAGACGGCATTCAAGAGATGCCGTCTCCGTCTTGATCTTTTTTG-3’
hNINL-homo-810-AS：
5’-AATTCAAAAAAGATCAAGACGGAGACGGCATCTCTTGAATGCCGTCTCCGTCTTGATCG-3’
(3)hNINL-homo-3283：
hNINL-homo-3283-S：
5’-GATCCGGGCTCTGGAGAAACATGTTTCAAGAGAACATGTTTCTCCAGAGCCCTTTTTTG-3’
hNINL-homo-3283-AS：
5’-AATTCAAAAAAGGGCTCTGGAGAAACATGTTCTCTTGAAACATGTTTCTCCAGAGCCCG-3’
Then described dna fragmentation is connected in the MCS of pGCSIL-GFP carrier and is built into pGCSIL-GFP/U6-Sh hNINL recombinant vectors; With pGCSIL-GFP/U6-Sh hNINL recombinant vectors, pHelper1.0,2.0 3 kinds of carrier cotransfections of pHelper 293T cell cultures, obtain described recombined lentivirus vector again.
As preferably, at terminal BamH I and the EcoR I restriction enzyme site introduced of described double chain DNA fragment.
As preferably, with BamH I and EcoRI enzyme pGCSIL-GFP carrier enzyme is cut, reclaim after the big fragment it is connected back transformed competence colibacillus bacterium, picking recombinant clone with said double chain DNA fragment.
Can specificity reduce the hNINL expression of gene behind this carrier transfectional cell, thereby possibly be applied to gene therapy or gene functional research.LV-sh-hNINL most important characteristics provided by the invention is to provide target property hNINL gene inhibition effect, and with recombined lentivirus vector as carrier, make interference effect obtain the persistence effect.Whole process of preparation is all used plasmid, avoids the traditional method adenovirus to pollute.The present invention is through the most effective hNINL interference sequence of screening, and synthetic its double-stranded DNA is connected in the slow virus skeleton plasmid carrier, with helper plasmid cotransfection instrument cell 293T cell, prepares hNINL interference recombinant lentivirus vector: LV-sh-hNINL.
Usefulness of the present invention is:
1, the pGCSIL-GFP carrier that adopts of the present invention contains the U6 promotor, can be in host cell continuous expression the little RNA of interference effect is arranged.This plasmid can be expressed the GFP GFP by the CMV promoters driven simultaneously, transfection efficiency when convenient virus is packed, and the detection of the efficiency of infection of host cells infected.The gag gene that contains HIV virus in pHelper 1.0 plasmids, the structural protein that coding virus is main; The pol gene, the enzyme of coding virus-specific; The rev gene, the regulatory factor of coding and regulating gag and pol genetic expression.The VSVg gene that contains the hsv source in pHelper 2.0 plasmids provides the virus packing needed capsid protein.Above three kinds of carrier corotation are gone into the third generation lentiviral vectors (SIN) that the 293T cell can efficiently be assembled self inactivation; Increased by two security features: one of which has made up the lentiviral vectors of self inactivation (SIN); Promptly deleted the 3 ' LTR in U3 district; Make carrier lose HIV-1 enhanser and promoter sequence, even exist all viral proteins can not transcribe out RNA.Second characteristic is to have removed the tat gene to replace the allogeneic promoter sequence, primary HIV gene like this, and 9 genes in the group have only kept 3 (gag, pol and rev) in the HIV lentiviral vectors that makes up.Therefore third generation HIV slow virus carrier system is safer.
2, the present invention is directed to the hNINL target gene and design four interference sequences, through the slow virus interference carrier system constructing packing acquisition LV-sh-hNINL of reorganization, through detecting hNINL mrna expression in the target cell; Filter out the most effectively interference fragment; Not only overcome the low transfection efficiency of non-virus carrier, the immunogenicity of also having avoided recombinant adenovirus to produce, expression time is than shortcomings such as weak points; Can be incorporated in host's the genome and stably express; Can not cause inserting inactivation, make interference effect more lasting, have and to infect Unseparated Cell, goal gene and be integrated into advantages such as target cell gene group leader time-histories is expressed, immunoreation is little; For good experiment basis is established in the further research of relevant hNINL gene, and can be widely used in vivo gene treatment and gene functional research.
Description of drawings
Fig. 1 is a slow virus skeleton plasmid pGCSIL-GFP carrier structure synoptic diagram.
Fig. 2 is to hNINL genetic expression interference effect picture behind the LV-sh-hNINL virus infection MCF-7 cell 72h.
Negative control group adds the groups of cells sample of negative control virus infection;
HNINL-homo-284 organizes, and adds the groups of cells sample of hNINL-homo-284 virus infection;
HNINL-homo-810 organizes, and adds the groups of cells sample of hNINL-homo-810 virus infection;
HNINL-homo-1983 organizes, and adds the groups of cells sample of hNINL-homo-1983 virus infection;
HNINL-homo-3283 organizes, and adds the groups of cells sample of hNINL-homo-3283 virus infection.
Embodiment
The present invention combines accompanying drawing and embodiment to be further described.
Embodiment 1: the lentiviral vectors to gene hNINL makes up
1, the design of oligonucleotide and synthetic
Utilize the online RNAi Series Design software BLOCK-iTRNAiDesigner of Invitrogen company; Design is to 4 interference target sequences (seeing table) of hNINL gene mRNA sequence (NM_025176.4), and synthetic corresponding double-stranded DNA (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Loop structure in the LV3-shRNA template has selected for use TTCAAGAGA to avoid forming termination signal.5 ' end of positive-sense strand template has added GATCC, cuts the cohesive end complementation that the back forms with the BamHI enzyme; 5 ' end of antisense strand template has added AATTC, cuts the cohesive end complementation that the back forms with the EcoRI enzyme.
| Sequence code | The sequence title | Target sequence |
| N351 | hNINL-homo-284 | TGTGGCTGTGTTGTCTTCATT |
| N352 | hNINL-homo-810 | GATCAAGACGGAGACGGCATT |
| N353 | hNINL-homo-1983 | GAGACCAAGGTAAATTACTTT |
| N354 | hNINL-homo-3283 | GGGCTCTGGAGAAACATGTTT |
Double-stranded DNA answer print segment information separately is following:
(1)hNINL-homo-284：
hNINL-homo-284-S：
5’-GATCCTGTGGCTGTGTTGTCTTCATTCAAGAGATGAAGACAACACAGCCACATTTTTTG-3’
hNINL-homo-284-AS：
5’-AATTCAAAAAATGTGGCTGTGTTGTCTTCATCTCTTGAATGAAGACAACACAGCCACAG-3’
(2)hNINL-homo-810：
hNINL-homo-810-S：
5’-GATCCGATCAAGACGGAGACGGCATTCAAGAGATGCCGTCTCCGTCTTGATCTTTTTTG-3’
hNINL-homo-810-AS：
5’-AATTCAAAAAAGATCAAGACGGAGACGGCATCTCTTGAATGCCGTCTCCGTCTTGATCG-3’
(3)hNINL-homo-1983：
hNINL-homo-1983-S：
5’-GATCCGAGACCAAGGTAAATTACTTTCAAGAGAAGTAATTTACCTTGGTCTCTTTTTTG-3’
hNINL-homo-1983-AS：
5’-AATTCAAAAAAGAGACCAAGGTAAATTACTTCTCTTGAAAGTAATTTACCTTGGTCTCG-3’
(4)hNINL-homo-3283：
hNINL-homo-3283-S：
5’-GATCCGGGCTCTGGAGAAACATGTTTCAAGAGAACATGTTTCTCCAGAGCCCTTTTTTG-3’
hNINL-homo-3283-AS：
5’-AATTCAAAAAAGGGCTCTGGAGAAACATGTTCTCTTGAAACATGTTTCTCCAGAGCCCG-3’
ShDNA with above-mentioned sequence can produce following transcripton respectively in vivo after transcribing:
(1) hNINL-homo-284 transcripton:
TGTGGCTGTGTTGTCTTCATTCAAGAGATGAAGACAACACAGCCACATT
(2) hNINL-homo-810 transcripton:
GATCAAGACGGAGACGGCATTCAAGAGATGCCGTCTCCGTCTTGATCTT
(3) hNINL-homo-1983 transcripton:
GAGACCAAGGTAAATTACTTTCAAGAGAAGTAATTTACCTTGGTCTCTT
(4) hNINL-homo-3283 transcripton:
GGGCTCTGGAGAAACATGTTTCAAGAGAACATGTTTCTCCAGAGCCCTT
Above-mentioned transcripton forms the double-stranded RNA with loop structure through self pairing, through the enzyme Dieer of specific recognition double-stranded RNA, the mode that relies on ATP progressively be cut into 21～23nt the small molecules interference RNA fragment (small interfering RNAs, siRNA).
In the effective stage, siRNA is double-stranded combine with the ribozyme mixture formation RNA induce reticent mixture (RNA-induced silencing complex, RISC).RISC activates with ATP dependency mode, siRNA sex change among the RISC, and two strands is untied; Unload positive-sense strand, antisense strand still is combined on the mixture, and guiding RISC combines with homologous target RNA; Under the effect of endonuclease, said target mrna is cut off, thereby reach the effect that blocking gene is expressed.
2, the annealing of LV3-shDNA template
The synthetic double chain DNA fragment is used TE (pH8.0) dissolving respectively, and concentration is 100uM.Get corresponding positive-sense strand and antisense strand oligomer solution, according to following proportioning configuration annealing reaction system.
| Component | Volume (ul) |
| 10 * shDNA annealing buffer (1M NaCl, 0.5M Hepes, pH7.4) | 5 |
| Positive-sense strand (100uM) | 5 |
| Antisense strand (100uM) | 5 |
| Distilled water | 35 |
| Total amount | 50 |
On the PCR appearance, carry out anneal according to following program: 95 ℃ 5 minutes; 85 ℃ 5 minutes; 75 ℃ 5 minutes; 70 ℃ 5 minutes; 4 ℃ of preservations.Obtaining concentration after the anneal is the shDNA template of 10 μ M.With 50 times of gained template solution dilutions, final concentration is 200nM, is used for ligation.
3, the linearizing of LV3 carrier
Get 5ug LV3 carrier; Utilize BamHI and EcoRI restriction enzyme and the conventional double digestion system of NEB company to cut 1 hour in 37 ℃ of enzymes; Agarose electrophoresis; Use agarose gel DNA purification kit (TaKaRa company) to reclaim the linearizing carrier segments, the electrophoresis detection estimated concentration, weaker concn is to 50ng/ul.
4, the structure of LV3-shRNA carrier
1) carry out the ligation of carrier according to the T4 dna ligase system of NEB company, condition is roughly following:
| Component | Volume (ul) |
| 10 * T4 connects damping fluid | 2 |
| LV3 carrier (BamHI+EcoRI double digestion) | 1 |
| ShDNA template (100nM) | 1 |
| The T4DNA ligase enzyme | 1 |
| Distilled water | 15 |
| Total amount | 20 |
22 ℃ connect 1hr, are converted into JM 109 competent cells.
2) 5 bacterium colonies of each ligation picking; Being inoculated into the LB that contains the 50ug/ml penbritin cultivates concentrated; The bacterium liquid that shakes out is chosen 2 at random and is sent to order-checking; The bacterial strain that checks order correct adopts amount extraction agent box (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) extracting in the high purity plasmid, and the gained plasmid can be used for conventional molecular biology experiment and cytologic experiment.If cytotoxicity is bigger when being used for cell transfecting, can be converted into again in the bacillus coli DH 5 alpha, prepare more high purity plasmid with test kit or CsCl ultracentrifugation then.
Encapsulating of embodiment 2:hNINL gene RNA interference recombinant lentivirus
Draw high purity and do not have the recombinant virus plasmid pGCSIL-sh-hNINL (20 μ g) that the intracellular toxin extracting prepares; Helper plasmid pHelper 1.0 (15 μ g) and pHelper 2.0 (10 μ g) carry out cotransfection 293T cell by Invitrogen company Lipofectamine 2000 operation instructions.
8h is replaced by perfect medium after the transfection, in 37 ℃, 5%CO
2After continuing in the incubator to cultivate 48h, collect and be rich in slow virus particulate cell conditioned medium liquid.4 ℃, 4000g removed behind the cell debris in centrifugal 10 minutes and to obtain slow virus with 0.45 μ M filter filtering supernatant subsequent use, can satisfy general test cell line.If will obtain the slow virus liquid concentrator that the slow virus of higher concentration obtains high titre after can be to it further concentrated and purified, packing virus liquid concentrator-80 ℃ prolonged preservation is got wherein one and is carried out the viral biology titer determination according to the following steps.
1.293T when cell was cultured to the 80-90% fusion in the 6cm petridish, the nutrient solution that inclines was used twice in 3ml D-Hank ' s solution washing cell.
2. (0.05%, Gibco), behind the mixing, the careful suction removed pancreatin solution, places 3-5 minute for 37 ℃ to add 1ml Trypsin-EDTA solution.
3. add 2ml again and contain the DMEM nutrient solution of 10%FBS, piping and druming makes cell form single cell suspension.
4. blood counting chamber is counted, with cell dilution to 3 * 10
5Cell/ml.
5. by 3 * 10
4The concentration of cells/well is inoculated 96 orifice plates, behind the mixing in 37 ℃ of 5%CO
2Cultivate 24h.
6. with DMEM training liquid ten times dilution 3-5 the gradient (according to cell state, if necessary can add Polybrene that final concentration be 5ug/ml) of slow virus stoste (10-20ul) with 15%FBS.
7. inhale and go the nutrient solution in 96 orifice plates, every hole to add the viral liquid of 100 μ l dilution, utilize Lentivirus-NC virus liquid (the lucky agate in Shanghai, 1 * 10 simultaneously
8TU/ml) set up negative control group, in 37 ℃ of 5%CO
2Cultivate 24h.
8. inhale and abandon the virus dilution liquid in 96 orifice plates, every hole adds the DMEM training liquid of 150 μ l 15%FBS, and (according to cell state, can tell 1/3-1/5 if necessary) is in 37 ℃ of 5%CO
2Continue cultivation 48,72h.
9. through fluorescent microscope or FACS counting fluorocyte, under fluorescent microscope, judge transfection efficiency (efficient is about more than 80%), calculate virus titer in conjunction with extension rate through observing the GFP expression.
Embodiment 3: target cell infects test and genetic expression suppresses effect analysis
1, target cell is infected test
According to the following steps human breast cancer cell MCF-7 (available from Shanghai Inst. of Life Science, CAS cell resource center) is carried out the virus infection experiment:
When 1) the MCF-7 cell was cultured to the 80-90% fusion in the 10cm petridish, the nutrient solution that inclines was used twice in 3ml D-Hank ' s solution washing cell.
2) (0.05%, Gibco), behind the mixing, the careful suction removed pancreatin solution, places 3-5 minute for 37 ℃ to add 1ml Trypsin-EDTA solution.
3) add 2ml DMEM nutrient solution again, piping and druming makes cell form single cell suspension.
4) blood counting chamber counting is by 10 * 10
5The concentration of cells/well is inoculated 6 orifice plates, 37 ℃ of 5%CO behind the mixing
2Cultivated 24 hours.
5) with slow virus stoste 200ul, with five times of dilutions of DMEM training liquid of 10%FBS.
6) suction goes the nutrient solution in 6 orifice plates, every hole to add the viral liquid of above-mentioned 1ml dilution, utilizes Lentivirus-NC virus liquid (the lucky agate in Shanghai, 1 * 10 simultaneously
8TU/ml) set up negative control group, in 37 ℃ of 5%CO
2Cultivate 24h.
7) the virus dilution liquid in 6 orifice plates is abandoned in suction, and every hole adds the DMEM training liquid of 1.5ml 10%FBS, and (according to cell state, can tell 1/3-1/5 if necessary) is in 37 ℃ of 5%CO
2Continue to cultivate, under fluorescent microscope, judge transfection efficiency (efficient is about more than 70%) through observation GFP expression, receive appearance behind the 72h, the gained cell is used for RNA extraction and follow-up Real-time PCR detection.
2, hNINL genetic expression suppresses effect analysis
1) extraction of total RNA
Carry out the extraction of total RNA according to the following steps:
(1) nutrient solution in 6 orifice plates is abandoned in suction, and every hole adds 1ml Trizol (Invitrogen).
(2) the rifle head piping and druming of handling with DEPC makes the complete cracking of cell.
(3) lysate is transferred in the 1.5ml EP pipe of DEPC processing, room temperature was placed 10 minutes.
(4) add 200 μ l trichloromethanes (analytical pure), the concuss mixing, room temperature was placed 10 minutes.
(5) 4 ℃ of 12000g centrifugal 10 minutes, draw supernatant liquid to new centrifuge tube, add isopyknic Virahol (analytical pure), precipitation at room temperature 10 minutes.
(6) 4 ℃ of 12000g centrifugal 15 minutes, abandon supernatant.
(7) deposition with 500 μ l, 75% washing with alcohol once.Centrifugal 5 minutes of 4 ℃ of 12000g reclaim deposition, abandon supernatant.
(8) normal temperature is inverted and was dried 10 minutes.
(9) with 20 μ l DEPC-H
2The O dissolution precipitation is measured OD
260, OD
280, calculate RNA concentration.
(10) integrity of agarose electrophoresis inspection RNA.
2) the RNA rt obtains cDNA
Utilize the M-MLV reversed transcriptive enzyme test kit of TaKaRa company, carry out the RNA rt, generate cDNA by its description of product.
3, Real-time PCR detects
1) adopt software design Real-time PCR to detect primer, primer sequence information is following, and is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
2) according to the form below preparation reaction system
| Component | Final concentration | Volume |
| 2 * Real-time PCR Master Mix (the lucky agate in Shanghai) | 1× | 10μl |
| ?FPrimer(20uM) | 0.1μM | 0.1μl |
| ?RPrimer(20uM) | 0.1μM | 0.1μl |
| The cDNA template | - | 2μl |
| RTaq archaeal dna polymerase (5U/ μ l) (TaKaRa) | 2.5U/μl | 0.4μl |
| Distilled water | To 20 μ l |
3) utilize Mx3000 Real-time PCR appearance (Stratagen) to react reaction conditions: 95 ℃, sex change in 3 minutes; 95 ℃, 30 seconds, 62 ℃, 40 seconds, totally 40 circulations.
, as confidential reference items hNINL mRNA content results behind each virus infection is handled with the hGAPDH gene, and calculated the ratio of hNINL mRNA in itself and the negative control.The result shows (see figure 2); To hNINL gene RNA interferential recombinant slow virus hNINL-homo-284, hNINL-homo-810, hNINL-homo-3283 all can effectively suppress the hNINL expression of gene; Suppress the about 60-85% of effect, can be used for the follow-up functional study of hNINL gene.And the inhibition effect of hNINL-homo-1983 is relatively poor, therefore in experiment from now on, will not adopt.
Claims (4)
1. one kind is directed against hNINL gene RNA interferential recombined lentivirus vector; This carrier is the third generation lentiviral vectors SIN of self inactivation; It is characterized in that; Described carrier S IN contains pGCSIL-GFP/U6-Sh hNINL recombinant vectors, and described pGCSIL-GFP/U6-Sh hNINL recombinant vectors is in the MCS of pGCSIL-GFP carrier, to have connected double chain DNA fragment; The sequence of described double chain DNA fragment is a kind of in the following sequence:
(1)hNINL-homo-284：
hNINL-homo-284-S：
5’-GATCCTGTGGCTGTGTTGTCTTCATTCAAGAGATGAAGACAACACAGCCACATTTTTTG-3’
hNINL-homo-284-AS：
5’-AATTCAAAAAATGTGGCTGTGTTGTCTTCATCTCTTGAATGAAGACAACACAGCCACAG-3’
(2)hNINL-homo-810：
hNINL-homo-810-S：
5’-GATCCGATCAAGACGGAGACGGCATTCAAGAGATGCCGTCTCCGTCTTGATCTTTTTTG-3’
hNINL-homo-810-AS：
5’-AATTCAAAAAAGATCAAGACGGAGACGGCATCTCTTGAATGCCGTCTCCGTCTTGATCG-3’
(3)hNINL-homo-3283：
hNINL-homo-3283-S：
5’-GATCCGGGCTCTGGAGAAACATGTTTCAAGAGAACATGTTTCTCCAGAGCCCTTTTTTG-3’
hNINL-homo-3283-AS：
5’-AATTCAAAAAAGGGCTCTGGAGAAACATGTTCTCTTGAAACATGTTTCTCCAGAGCCCG-3’。
2. the described preparation method to hNINL gene RNA interferential recombined lentivirus vector of claim 1 is characterized in that, according to hNINL mRNA sequence, double chain DNA fragment has been synthesized in design, and described double chain DNA fragment is a kind of in the following sequence:
(1)hNINL-homo-284：
hNINL-homo-284-S：
5’-GATCCTGTGGCTGTGTTGTCTTCATTCAAGAGATGAAGACAACACAGCCACATTTTTTG-3’
hNINL-homo-284-AS：
5’-AATTCAAAAAATGTGGCTGTGTTGTCTTCATCTCTTGAATGAAGACAACACAGCCACAG-3’
(2)hNINL-homo-810：
hNINL-homo-810-S：
5’-GATCCGATCAAGACGGAGACGGCATTCAAGAGATGCCGTCTCCGTCTTGATCTTTTTTG-3’
hNINL-homo-810-AS：
5’-AATTCAAAAAAGATCAAGACGGAGACGGCATCTCTTGAATGCCGTCTCCGTCTTGATCG-3’
(3)hNINL-homo-3283：
hNINL-homo-3283-S：
5’-GATCCGGGCTCTGGAGAAACATGTTTCAAGAGAACATGTTTCTCCAGAGCCCTTTTTTG-3’
hNINL-homo-3283-AS：
5’-AATTCAAAAAAGGGCTCTGGAGAAACATGTTCTCTTGAAACATGTTTCTCCAGAGCCCG-3’
Then described dna fragmentation is connected in the MCS of pGCSIL-GFP carrier and is built into pGCSIL-GFP/U6-Sh hNINL recombinant vectors; With pGCSIL-GFP/U6-Sh hNINL recombinant vectors, pHelper1.0,2.0 3 kinds of carrier cotransfections of pHelper 293T cell cultures, obtain described recombined lentivirus vector again.
3. the preparation method to hNINL gene RNA interferential recombined lentivirus vector according to claim 2 is characterized in that, at terminal BamH I and the EcoR I restriction enzyme site introduced of described double chain DNA fragment.
4. the preparation method to hNINL gene RNA interferential recombined lentivirus vector according to claim 2; It is characterized in that; With BamHI and EcoRI enzyme pGCSIL-GFP carrier enzyme is cut; After reclaiming big fragment it is connected back transformed competence colibacillus bacterium, picking recombinant clone with said double chain DNA fragment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100935240A CN102643859A (en) | 2012-04-01 | 2012-04-01 | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100935240A CN102643859A (en) | 2012-04-01 | 2012-04-01 | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102643859A true CN102643859A (en) | 2012-08-22 |
Family
ID=46656934
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100935240A Pending CN102643859A (en) | 2012-04-01 | 2012-04-01 | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102643859A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834691A (en) * | 2014-01-21 | 2014-06-04 | 宁波大学 | Construction method of target RNA-interfered recombinant lentivirus vector for IL-33 gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575615A (en) * | 2009-04-30 | 2009-11-11 | 中南大学 | Construction of recombined lentivirus vector aiming at PKC gamma gene RNA interference and application thereof |
| CN102041302A (en) * | 2009-10-16 | 2011-05-04 | 中国医学科学院肿瘤研究所 | Applications of Nlp (Ninein like protein) in breast cancer and lung cancer |
-
2012
- 2012-04-01 CN CN2012100935240A patent/CN102643859A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575615A (en) * | 2009-04-30 | 2009-11-11 | 中南大学 | Construction of recombined lentivirus vector aiming at PKC gamma gene RNA interference and application thereof |
| CN102041302A (en) * | 2009-10-16 | 2011-05-04 | 中国医学科学院肿瘤研究所 | Applications of Nlp (Ninein like protein) in breast cancer and lung cancer |
Non-Patent Citations (1)
| Title |
|---|
| LINLIN YU等: "Ninein-like protein is overexpressed in head and neck squamous cell carcinoma and contributes to cancer growth and resistance to apoptosis", 《ONCOLOGY REPORTS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834691A (en) * | 2014-01-21 | 2014-06-04 | 宁波大学 | Construction method of target RNA-interfered recombinant lentivirus vector for IL-33 gene |
| CN103834691B (en) * | 2014-01-21 | 2016-06-29 | 宁波大学 | The construction method of targeting IL-33 gene RNA interference recombinant lentivirus vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2022506515A (en) | Vector system for expressing regulatory RNA | |
| JP2015524264A (en) | Nucleic acids for down-regulation of gene expression | |
| CN107405357A (en) | Multiple shRNAs and its application | |
| US9222090B2 (en) | RNA interference target for treating AIDS | |
| CN107523569A (en) | The purposes and its related drugs of PDCD1 genes | |
| JP2022514955A (en) | Hematopoietic stem cell gene therapy for Wiskott-Aldrich syndrome | |
| CN105200059B (en) | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector | |
| RU2426788C1 (en) | Genetic make-ups for anti-hiv therapy | |
| CN103966219B (en) | The structure of the shRNA of the Inhibit the replication of HIV-1 that Human foamy spumavirus is carrier mediated and application | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| Cullen | Does RNA interference have a future as a treatment for HIV-1 induced disease | |
| CN103352052A (en) | Construction and application of multi-cistron double-label expression lentivirus vector | |
| CN102643859A (en) | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN116218906A (en) | RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method | |
| US11078495B2 (en) | Methods and compositions for integration defective lentiviral vectors | |
| Park et al. | Inhibition of simian immunodeficiency virus by foamy virus vectors expressing siRNAs | |
| CN111235150B (en) | shRNA for inhibiting replication of African swine fever virus and application thereof | |
| Terskikh et al. | Long-term persistence of a nonintegrated lentiviral vector in mouse hematopoietic stem cells | |
| CN102604994B (en) | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector | |
| CN109266684B (en) | Method for constructing animal model with pathogen infection sensitivity | |
| RU2533817C1 (en) | Improving genetic constructs for providing high efficacy of anti-hiv therapy | |
| RU2630644C1 (en) | Cartridge genetic construct expressing two biologically active sirnas effectively attacking targets in mrna of vpu and env genes of hiv-1 subtype a in russian patients, and one sirna aimed at ccr5 gene mrna | |
| Gao | Optimized expression of small therapeutic RNAs | |
| Chung et al. | Regulation of porcine endogenous retrovirus by dual LTR1+ 2 (Long Terminal Region) miRNA in primary porcine kidney cells | |
| WO2023125823A1 (en) | Sirna and shrna targeting hiv, and corresponding combination, expression cassette, cell, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120822 |