CN116179546A

CN116179546A - sgRNA for knocking down HS3ST5 gene, knocking down vector and application thereof

Info

Publication number: CN116179546A
Application number: CN202211248564.8A
Authority: CN
Inventors: 袁红; 白兴文; 卢曾军; 黄磊; 宫晓华; 刘在新; 孙普; 李平花; 包慧芳; 李冬; 马雪青; 陈应理; 曹轶梅; 付元芳; 赵志荀; 张婧; 王健
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2022-10-12
Filing date: 2022-10-12
Publication date: 2023-05-30

Abstract

The invention provides sgRNA for knocking down HS3ST5 genes, a knocking-down vector and application thereof, and belongs to the technical field of gene knockout. The invention constructs a recombinant vector for knocking down HS3ST5 by utilizing sgRNA of a targeted HS3ST5 gene, and after lentiviral packaging, the recombinant vector is infected with a BHK-21 cell line to obtain the BHK-21 recombinant cell line for knocking down the HS3ST 5. Experiments show that BHK-21 recombinant cell line after knocking down HS3ST5 has obviously reduced replication capacity and proliferation capacity to FMDV. Therefore, the sgRNA for stably knocking down the HS3ST5 can be used as an effective tool to be applied to the treatment of virus infection by using the HS as a receptor, and provides a new idea for resisting the virus infection.

Description

sgRNA for knocking down HS3ST5 gene, knocking down vector and application thereof

Technical Field

The invention belongs to the technical field of gene knockout, and particularly relates to sgRNA for knocking down HS3ST5 genes, and a knocking-down vector and application thereof.

Background

With the advent of gene editing tools such as CRISPR, TALENs and ZFNs and rapid development, it has become possible to develop economically efficient recombinant cell lines by artificially manipulating cell genomes. These gene editing tools are sequence-specific endonucleases that help to manipulate the activation or silencing of DNA at specific sites on the genome of interest. According to the practical demands of scientific research and industrial production, gene editing tools allow integration or deletion of single or multiple sites on target genes, enabling researchers to directly edit or modulate DNA functions of any type of cell, ultimately identifying and revealing genomic functions at a systemic level. The gene editing technology advances the development of new generation therapeutic drugs and the emergence of gene therapy, and also becomes a potential method for antiviral therapy.

CRISPR is found in the genome of prokaryotes such as bacteria and archaea, and this sequence is derived from DNA fragments of phage for detecting and disrupting phage-like DNA. A CRISPR-associated protein (Cas 9) is a protease that uses a CRISPR sequence as a guide to recognize and cleave specific DNA complementary to the CRISPR sequence. Cas9 has two cleavage domains, termed RuvC and HNH, and the two nuclease domains of Cas9 mediate cleavage of the target DNA, leaving a blunt end at the cleavage. The CRISPR/Cas9 system comprises a Cas9 enzyme and crRNA and transcriptional activation crRNA (tracrRNA). The crRNA and tracrRNA combine to form a chimeric RNA structure called a gRNA or sgRNA that is effective to activate and guide Cas9 to a specific motif downstream of the sgRNA-targeted 20 nucleotide sequence, the Protospacer Adjacent Motif (PAM), thereby cleaving the target DNA sequence in the invaded DNA. The targeting specificity of the CRISPR/Cas9 system is determined by the 20 nucleotide sequence of the 5' end of the sgRNA. For the streptococcus pyogenes CRISPR/Cas9 system, the required target sequence must precede the 5' -NGG PAM motif. The CRISPR/Cas9 gene editing technology has the advantages of low off-target effect and high knocking-down efficiency, and the technology can accurately cut complementary double-stranded DNA through sgRNA specificity recognition of viral genome or host target gene locus, thereby playing an antiviral role. The sgRNA has been applied to inhibiting various viruses such as novel coronaviruses, human immunodeficiency viruses, influenza viruses and the like, and shows that the sgRNA can be applied to antiviral infection as a broad-spectrum antiviral tool.

Heparan Sulfate (HS) is a class of linear sulfated heterogeneous polysaccharides capable of binding a large number of ligands, including growth factors, morphological factors, cytokines, chemokines, enzymes, matrix proteins, and virions, and the like, thereby exerting regulatory activities in a variety of biological processes of cells, such as receptor activation, signal transduction, cytoskeletal assembly, and extracellular matrix remodeling, and the like. Meanwhile, HS can recognize and combine the virus particles with positive charge characteristics through weak interaction, so that the quantity of adsorbed viruses on the cell surface is increased, and the infection capacity of the virus particles to host cells is enhanced. Heparan sulfate 3-O-sulfate transferase 5 (HS 3ST 5) is an HS biosynthetic enzyme capable of catalyzing the transfer of sulfate groups from sulfate donors to the 3-OH position of glucosamine to form 3-O-sulfated HS, thereby regulating the performance of HS biological functions. At present, the research on the influence of HS3ST5 on virus infection is few, and no report on designing a novel antiviral drug by taking HS3ST5 as a target point exists.

Disclosure of Invention

Therefore, the invention aims to provide the sgRNA for knocking down the HS3ST5 gene, which has the function of strongly knocking down the HS3ST5 gene and provides a new thought for antagonizing virus infection using HS as a receptor.

The invention provides a sgRNA for knocking down HS3ST5 genes, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1.

The invention provides a recombinant vector for knocking down HS3ST5 genes, which is a LenigCRISPRV 2 vector containing the sgRNA.

The invention provides a recombinant lentivirus for knocking down HS3ST5 genes, which is obtained by rescuing co-transfected cells of a recombinant vector and an auxiliary plasmid.

Preferably, the helper plasmids are a psPAX2 helper plasmid and a pMD2.G helper plasmid;

at the time of co-transfection, the mass ratio of the recombinant vector, the psPAX2 helper plasmid and the pMD2.G helper plasmid is 4:3:1.

Preferably, the co-transfection is performed using the transfection reagent Lipofectamine 2000.

The invention provides application of the sgRNA, the recombinant vector or the recombinant lentivirus in knocking down HS3ST5 genes in cells.

The invention provides a recombinant BHK-21 cell line for stably knocking down HS3ST5 mediated by sgRNA.

The invention provides an application of a reagent for knocking down HS3ST5 genes in preparing cells for reducing virus proliferation or preparing medicaments for resisting virus infection.

Preferably, the agent is the sgRNA, the recombinant vector, the recombinant lentivirus, or the recombinant BHK-21 cell line;

the viruses include viruses that invade cells using HS receptors.

The invention provides a medicine for resisting viral infection, which takes sgRNA, recombinant vector or recombinant lentivirus as active ingredients and also comprises pharmaceutically acceptable auxiliary materials.

The invention provides a sgRNA for knocking down HS3ST5 genes, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1. The invention designs the sgRNA targeting HS3ST5 by taking the HS3ST5 gene as a template. The sgRNA is introduced into cells by lentiviruses, the HS3ST5 gene is targeted and knocked out, and compared with a blank control group, the sgRNA can obviously reduce the HS3ST5 gene expression in the cells.

The invention provides an application of a reagent for knocking down HS3ST5 genes in preparing cells for reducing virus proliferation or preparing medicaments for resisting virus infection. Experiments of the invention show that the gene replication capacity and proliferation capacity of viruses in cells are reduced by knocking down the expression level of HS3ST5 genes in the cells. Therefore, the invention can be used for preparing cells for reducing virus proliferation or preparing medicaments for resisting virus infection by knocking down HS3ST5 genes, thereby providing a new idea for resisting virus infection.

Drawings

FIG. 1 shows the results of analysis of HS3ST5 expression levels in BHK-21 recombinant cell lines knocked down with HS3ST5, (a) the results of HS3ST5 protein levels in BHK-21 recombinant cell lines knocked down with HS3ST 5; (b) Results of knockdown of HS3ST5 mRNA levels in the BHK-21 recombinant cell line of HS3ST 5; wherein, compared with NC group, the expression level of HS3ST5 gene in the cells of the experimental group is obviously reduced, and P is less than 0.05;

FIG. 2 shows the results of analysis of HS3ST5 expression levels in knockdown HS3ST5 recombinant monoclonal cells, (a) the results of HS3ST5 protein levels in HS3ST5 knockdown monoclonal recombinant cells; (b) Results of knockdown of HS3ST5 mRNA levels in the HS3ST 5-knockdown monoclonal recombinant cells; * Indicating that relative expression levels of HS3ST5 protein in knockdown HS3ST5 recombinant cell lines are extremely significantly reduced, P <0.01, compared to BHK-21 cells;

FIG. 3 shows the effect of sgRNA-42 knockdown HS3ST5 on FMDV gene replication;

FIG. 4 is a graph showing the effect of sgRNA-42 knockdown HS3ST5 on FMDV proliferation, showing that the relative expression level of HS3ST5 gene in knockdown HS3ST5 recombinant cell line is extremely significantly reduced, P <0.01, compared to BHK-21 cells.

Detailed Description

The invention provides a sgRNA for knocking down HS3ST5 gene, the nucleotide sequence of which is shown as SEQ ID NO. 1 (CACCGGTACTGGGAAGCCTTGCCGT).

In the invention, the sgRNA has the characteristic of targeting and knocking down the HS3ST5 gene, and compared with a blank control group, the sgRNA treatment group can effectively reduce the expression quantity of the HS3ST5 gene in cells.

In the method for constructing the recombinant vector, the forward and reverse sequences of the sgRNA are annealed to obtain double-stranded DNA fragments;

connecting the double-stranded DNA fragment with a linearized LenigirSPRV 2 carrier to obtain a connection product;

and identifying the connection product to obtain the recombinant vector.

In the present invention, the forward and reverse sequences of the sgRNA are preferably as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The reaction sequence of the annealing is preferably as follows: 30min at 37℃for 5min at 95℃for 5min at 5℃for 25min.

In the present invention, the linearized LenigirSPRV 2 vector is preferably enzyme-tangential using BsmB I. The method of ligation is preferably accomplished using T4 ligase. The method of the present invention for ligating the T4 ligase is not particularly limited, and may be performed by using ligation protocols well known in the art. The identification method is preferably that the connection product is transferred into escherichia coli for culture, then the recombinant plasmid is extracted, and the recombinant plasmid which is identified as positive by agarose gel electrophoresis is sent to a company for sequencing. The nucleotide sequence of the primer for sequencing is preferably shown as SEQ ID NO. 5. The sequence measured contained the sgRNA sequence, indicating successful construction of the recombinant vector.

In the present invention, the helper plasmids are preferably a psPAX2 helper plasmid and a pMD2.G helper plasmid. At the time of the co-transfection, the mass ratio of the recombinant vector, psPAX2 helper plasmid and pmd2.G helper plasmid was 4:3:1. The cotransfection is performed using the transfection reagent Lipofectamine 2000. After 6h of co-transfection, the treated cells were cultured in DMEM complete medium for 48h, cell supernatants were collected, lentivirus titers were determined, and recombinant lentiviruses were rescued. The temperature of the culture is preferably 37 ℃. The titer of the assay is preferably determined using a lentivirus rapid assay card. In the embodiment of the invention, the lentivirus rapid detection card is purchased from Beijing Boolone immune technology Co.

In the present invention, the agent is preferably the sgRNA, the recombinant vector or the recombinant lentivirus.

In the present invention, the virus preferably includes a virus that invades cells using HS receptors. In the embodiment of the invention, after taking foot-and-mouth disease virus as an example, the effect of cells on gene replication and proliferation of the virus after knocking down the HS3ST5 gene is described.

In the method for reducing the virus proliferation cells, preferably, the sgRNA is cloned into a knockout plasmid LentidISPRV 2 to obtain a recombinant vector;

packaging the recombinant vector into a recombinant lentivirus;

and infecting the recombinant lentivirus into cells, and screening the cells obtained by resistance to obtain the cells with the knockdown HS3ST5 genes.

In the present invention, the cells are preferably BHK-21 cell line. The resistance screen is preferably treated with a medium containing puromycin. The concentration of puromycin is preferably 4. Mu.g/mL. The time for infecting the cells is preferably 6 to 7d.

In view of the fact that the gene replication and proliferation capacity of viruses in cells can be reduced by knocking down the expression of HS3ST5 genes in the cells, the invention provides a medicine for resisting viral infection, which takes sgRNA, the recombinant vector or the recombinant lentivirus as an active ingredient and also comprises pharmaceutically acceptable auxiliary materials.

The auxiliary materials are not particularly limited, and the auxiliary materials of the gene therapy medicine known in the art can be adopted. The preparation method of the drug is not particularly limited, and the preparation method of the gene therapy drug known in the art can be adopted.

The sgrnas for knocking down HS3ST5 gene, and knocking-out vectors and applications thereof provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction method of sgRNA for knocking down HS3ST5 gene and knocking-down vector thereof

1. Material

1.1 cells, plasmids and viruses

BHK-21 and HEK-293T cells were derived from China center for type culture Collection, and pMD2.G, psPAX2 and pLKO.1 plasmids were purchased from Invitrogen corporation, classical O-type foot-and-mouth disease vaccine strain O/HN/CHA/93 (Cathay) was supplied by China national foot-and-mouth disease reference laboratory.

1.2 major reagents

Rabbit HS3ST5 polyclonal antibody was purchased from Novus, murine beta-actin monoclonal antibody was purchased from Kagaku century, RNeasy Mini Kit was purchased from Qiagen, high sugar DMEM, MEM medium, lipofectamine 2000, opti-MEM medium and pancreatin was purchased from Invitrogen, fetal Bovine Serum (FBS) and puromycin was purchased from Gibco, lentivirus rapid detection card was purchased from Beijing bloolon immunotechnology Co., ltd, chamQ SYBR qPCR Master Mix was purchased from Norweizan.

2. Method of

2.1 design and Synthesis of sgRNA to knock down HS3ST5

Based on the HS3ST5 gene sequence, the CRISPOR software was used to design sgrnas targeting the HS3ST5 gene, the sequences are shown in table 1. The designed sgrnas were synthesized by Jin Weizhi biotechnology company.

TABLE 1 sgRNA sequences

2.2 construction of Lenti-sgRNA recombinant lentiviral plasmid

Annealing the synthesized sgrnas to form double-stranded DNA, the annealing system is shown in table 2, and the annealing conditions are: 30min at 37℃for 5min at 95℃for 5min at 5℃for 25min. This allows the phosphorylation and annealing of sgrnas to double-stranded DNA. Taking annealed product with ddH ₂ O is as follows: 200 dilution, with BsmB I linear LentiCRISPRV2 carrier connection, connection products plasmid transformation and plasmid extraction. The constructed sgRNA recombinant lentiviral plasmid is firstly subjected to enzyme digestion preliminary identification, and then the positive plasmid is sent to Jin Weizhi biotechnology company for sequencing, and the sequencing primer is 5'-ATGGACTATCATATGCTTACCGTA-3' (SEQ ID NO: 3). Plasmid DNA was extracted in large quantities from the plasmids identified as correct and helper plasmids pMD2.G and psPAX 2.

TABLE 2 annealing System of sgRNA

Construction and identification results of Lenti-sgRNA recombinant lentiviral plasmid

The linearized product of the LenigirSPRV 2 vector is identified by agarose gel electrophoresis, and the fragment of about 13000bp is recovered by gel and then is connected with the double-stranded DNA product of sgRNA. After preliminary identification of the ligation product by agarose gel electrophoresis, the positive clone was sent to the company for sequence determination, and the result shows that the recombinant lentiviral plasmid of Lenti-sgRNA-42 was successfully constructed, and the positive plasmid with correct sequence was greatly extracted and stored for later use.

Example 2

Rescue of recombinant lentiviruses

HEK-293T cells were plated in 10cm cell culture dishes and when the cells were well-conditioned and at a density of 70%, plasmid transfection was performed using Lipofectamine 2000 (10. Mu.g of the Lenti-sgRNA-42 recombinant lentiviral plasmid prepared in example 1+7.5. Mu.g of the psPAX2 helper plasmid+2.5. Mu.g of the pMD2.G helper plasmid). After 6 hours, 4ml of DMEM complete medium was added, and the culture was continued in an incubator at 37 ℃. After 48h, the cell supernatant was collected, lentiviral titer was measured using a lentiviral rapid assay card, and lentiviral fluid was saved for use after filtration with a 0.45 μm filter.

Transfecting positive Lenti-sgRNA-42 recombinant lentiviral plasmid into HEK-293T cells, dripping cell supernatant into a lentivirus rapid detection card after 48 hours, wherein the lentivirus rapid detection card is dark red, and the converted lentivirus titer is about 1.25x10 ^6-7 TU/ml indicated successful packaging of the recombinant lentivirus.

Example 3

Determination of 1 puromycin screening concentration

BHK-21 cells were plated in six well plates, after cell density was 80%, puromycin at 1, 2, 3, 4, 5 and 6 μg/mL concentrations were added, and the drug treatment was re-administered every 24h, and cell survival was observed for 7 days continuously, selecting the lowest drug concentration for cell-free survival as the optimal concentration for puromycin screening.

Construction of BHK-21 recombinant cell line for stably knocking down HS3ST5 by 2sgRNA

The recombinant lentivirus constructed in example 2 and complete cell culture medium were prepared according to 1:1 volume of the mixed culture medium is prepared by mixing evenly. Normal BHK-21 was plated in six well plates and incubated with mixed media. After the cells grow into six pore plates, transferring the cells into a T25 cell culture flask, continuously adding the mixed culture medium for culture, and replacing the mixed culture medium every 24 hours. Lentiviral infected cells were treated with the optimal concentration of puromycin after 7d, and the complete medium with puromycin was changed every 24 h. Cell samples were harvested after 7d and HS3ST5 expression levels were detected using real-time fluorescent quantitative PCR (RT-qPCR) and Western blot hybridization assays (Western blot). The digested positive recombinant cells were counted, diluted into single cells in a medium, and then plated in 96-well plates. After the cells grow fully, the monoclonal recombinant cells are subjected to expansion culture and cryopreservation, and the expression condition of HS3ST5 in the monoclonal recombinant cells is detected by using RT-qPCR and Western Blot. Wherein, the primer for the HS3ST5 gene qPCR detection reagent is as follows: the upstream primer was 5'-CCATTTGCCCTGTTGAAAGCC-3' (SEQ ID NO: 4) and the downstream primer was 5'-CCGGAATTCATGCAGCAGAC-3' (SEQ ID NO: 5). The upstream primer of the internal reference GAPDH was 5'-CAAGAAGGTGGTGAAGCA-3' (SEQ ID NO: 6) and the downstream primer was 5'-AAGTGGAAGAGTGAGTGTC-3' (SEQ ID NO: 7) which were synthesized by Jin Weizhi Biotechnology Inc. The reverse transcription system of the RT-qPCR method is shown in Table 3, and the reverse transcription procedure is 15min at 37℃and 5s at 85 ℃. The amplification system of the RT-qPCR method is shown in Table 4, and the amplification reaction procedure is 30s pre-denaturation at 95 ℃;95 ℃ for 5 seconds, 60 ℃ for 30 seconds, 72 ℃ for 30 seconds, 40 cycles; 95℃15s,60℃1min,95℃30s,60℃15s. The relative mRNA copy number of HS3ST5 was calculated using the ΔΔct method. The primary antibodies used in the Western Blot test were rabbit HS3ST5 polyclonal antibody and mouse beta-actin monoclonal antibody, and the secondary antibodies used were HRP-labeled goat anti-mouse IgG and HRP-labeled goat anti-rabbit IgG.

TABLE 3 RT-qPCR reverse transcription System of HS3ST5

Table 4 RT-qPCR amplification System of HS3ST5

Establishment and identification results of BHK-21 recombinant cell line for stably knocking down HS3ST5 by sgRNA

BHK-21 cells were plated into six well plates, after cell density was 80%, BHK-21 cells were treated with puromycin at gradient concentration, and it was observed that BHK-21 cells were all dead after 7d of puromycin screening at minimum concentration of 4. Mu.g/mL. Thus, 4. Mu.g/mL was the optimal puromycin concentration for screening BHK-21 recombinant cell lines.

After BHK-21 cells were screened for 7d by recombinant lentivirus infection and optimal concentration of puromycin, western Blot and RT-qPCR were used to identify if the recombinant cell line was successfully established. The results are shown in FIG. 1, and the results of WesternBlot and RT-qPCR show that the levels of HS3ST5 protein and mRNA in BHK-sgHS3ST5-42-KD are significantly reduced, indicating that the establishment of the BHK-21 recombinant cell line knocked down HS3ST5 is successful. Subsequently, 50 monoclonal cell lines were selected from the recombinant cell lines and plated onto 12-well plates, and after collecting samples, the HS3ST5 protein and mRNA expression levels in the recombinant monoclonal BHK-21 cells were detected using WesternBlot and RT-qPCR.

FIG. 2 shows 3 monoclonal recombinant cell lines selected from BHK-sgHS3ST5-42-KD recombinant cell lines, in which both HS3ST5 protein and mRNA levels were significantly lower than those in normal BHK-21 cells. The results show that the BHK-21 monoclonal recombinant cell strain knocked down by HS3ST5 is successfully constructed by utilizing sgRNA, wherein the knockdown effect of the BHK-sgHS3ST5-42-35-KD recombinant cell strain is best.

Example 4

Effect of sgRNA stable knockdown HS3ST5 on FMDV Gene replication

The recombinant BHK-21 cells constructed in example 3 and normal BHK-21 cells were plated in 12-well plates, and when the cell density reached 90%, the two cells were inoculated with FMDV having MOI of 1, respectively, and after placing in a 37℃incubator for 4, 8, 10, 12 and 16 hours, samples were collected, respectively. Sample RNA was extracted and tested for FMDV 3D mRNA levels by RT-qPCR, as described in example 3.

As shown in FIG. 3, FMDV infected normal BHK-21 cells and BHK-sgHS3ST5-42-35-KD recombinant cell lines, respectively, peaked in viral mRNA levels at 12 h. At this time, FMDV mRNA levels in BHK-sgHS3ST5-42-35-KD were reduced by 50% compared to normal cells. Furthermore, the FMDVmRNA levels in the BHK-sgHS3ST5-42-35-KD recombinant cell line knockdown HS3ST5 were significantly reduced compared to normal BHK-21 cells for all time point samples. The above results indicate that stable knockdown of sgRNA by HS3ST5 significantly inhibits gene replication of FMDV.

Example 5

Effect of sgRNA stable knockdown HS3ST5 on FMDV proliferation

Recombinant BHK-21 cells and normal BHK-21 cells were plated in 12-well plates, when cell density reached 90%, the two cells were inoculated with FMDV having MOI of 1, and after placing in 37℃incubator, samples were collected after 4, 8, 10, 12 and 16 hours, respectively, and Plaque Forming Units (PFU) of the collected samples were measured by plaque assay.

Samples of FMDV infected normal BHK-21 cells and BHK-sgHS3ST5-42-35-KD recombinant cells were collected and the resulting progeny virus was quantified by plaque formation assays. As a result, as shown in FIG. 4, the number of FMDV plaques in the 12h sample peaked, at which time the number of viral plaques in the BHK-HS3ST5-KD recombinant cell strain knocked down HS3ST5 was reduced by 45% compared to control cells. For all time-point harvested samples, the number of FMDV plaques in BHK-sgHS3ST5-42-35-KD recombinant cell lines knocked down HS3ST5 was significantly reduced compared to normal BHK-21 cells. The results show that the sgRNA stably knockdown HS3ST5 significantly inhibits the proliferation of FMDV.

From the results of the above examples, the invention uses sgRNA targeting HS3ST5 to construct BHK-21 recombinant cell line knockdown HS3ST5, and the effect of the sgRNA knockdown HS3ST5 on FMDV replication ability and proliferation ability is evaluated by FDMV infection of BHK-21 recombinant cell line knockdown HS3ST 5. The results show that sgRNA knockdown HS3ST5 significantly inhibited FMDV replication levels and proliferation capacity. Therefore, the sgRNA for stably knocking down HS3ST5 can be used as an effective tool to be applied to the treatment of various virus infections such as FMDV and the like which utilize HS as a receptor.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. The sgRNA for knocking down the HS3ST5 gene is characterized in that the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1.

2. A recombinant vector for knocking down HS3ST5 gene, wherein the recombinant vector is a Lennticrisprv 2 vector comprising the sgRNA of claim 1.

3. A recombinant lentivirus for knocking down HS3ST5 gene is characterized in that the recombinant lentivirus is obtained by rescuing a co-transfected cell of a recombinant vector and a helper plasmid according to claim 2.

4. A recombinant lentivirus according to claim 3, wherein the helper plasmids are a psPAX2 helper plasmid and a pmd2.G helper plasmid;

5. The recombinant lentivirus of claim 3, wherein the co-transfection is performed using the transfection reagent Lipofectamine 2000.

6. Use of the sgRNA of claim 1, the recombinant vector of claim 2 or the recombinant lentivirus of any one of claims 3 to 5 for knocking down the HS3ST5 gene in a cell.

7. A recombinant BHK-21 cell line of the sgRNA-mediated stable knockdown HS3ST5 of claim 1.

8. An application of a reagent for knocking down HS3ST5 genes in preparing cells for reducing virus proliferation or preparing medicaments for resisting virus infection.

9. The use according to claim 8, wherein the agent is an sgRNA according to claim 1, a recombinant vector according to claim 2, a recombinant lentivirus according to any one of claims 3 to 5 or a recombinant BHK-21 cell line according to claim 7;

the viruses include viruses that invade cells using HS receptors.

10. An antiviral medicament, characterized in that the sgRNA of claim 1, the recombinant vector of claim 2 or the recombinant lentivirus of any one of claims 3 to 5 is used as an active ingredient, and pharmaceutically acceptable auxiliary materials are also included.