CN102352360B - Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) - Google Patents
Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) Download PDFInfo
- Publication number
- CN102352360B CN102352360B CN201110357481A CN201110357481A CN102352360B CN 102352360 B CN102352360 B CN 102352360B CN 201110357481 A CN201110357481 A CN 201110357481A CN 201110357481 A CN201110357481 A CN 201110357481A CN 102352360 B CN102352360 B CN 102352360B
- Authority
- CN
- China
- Prior art keywords
- hiv
- sequence
- dlhrna
- gene
- original paper
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to construction and function test of a double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1), belonging to the technical field of gene engineering. In accordance with the design principle of siRNA and the conservative analysis of the HIV-1 sequence, an HIV-1 capsid protein gag gene (532-552), an envelope protein env gene (1428-1448), a non-structural protein tat gene (131-151) and a vpu gene (143-161) are selected and designed into a corresponding siRNA sequence; through a two-step PCR (Polymerase Chain Reaction) method, a double-long-hairpin RNA expression element (the sequence list is shown as SEQ ID No.1) is finally constructed; and through microscopic fluorescent observation and flow cell analysis quantitative test, the inhibition effect of the double-long-hairpin RNA expression element on the eukaryotic expression of an HIV gene EGFP (Enhanced Green Fluorescent Protein) fusion protein is tested. Experiments prove that the dlh RNA expression element can effectively inhibit the expression of multiple HIV genes.
Description
Technical field
The invention belongs to gene engineering technology field.
Background technology
AIDS, promptly (Acquired Immunodeficiency Syndrome, AIDS), (Human Immunodeficiency Virus, HIV) infection causes AIDS, is one of the most serious prevailing disease by human immunodeficiency virus.Can effectively improve AIDS patient's life situation and suppress duplicating of HIV-1, also be the necessary laboratory facilities of HIV-1 correlative study simultaneously.At present, the method for inhibition HIV-1 comprises: through methods such as RTI, proteinase inhibitor, receptor analogs and RNA interference.
(RNA interference is through suppress the method for the genetic expression of HIV-1 at gene transcription level RNAi) in the RNA interference.The method that realizes RNAi comprises: the little siRNA fragment of chemosynthesis is directly carried out RNAi, or expresses artificial RNAi through genophore and induce precursor to carry out RNAi.Chemosynthesis siRNA is difficult to be widely used because cost is higher.Expressing artificial RNAi through genophore induces precursor to carry out RNAi; Rna plymerase iii (the Pol III that normally relies on through DNA; U6 or H1 promotor) the folding hairpin structure that forms of short rna of transcriptional expression, be called short hairpin RNA (short hairpin RNA, shRNA).Nearly 200 siRNA or shRNA sequences that detect effect through experiment have been reported at present, for the choosing of RNAi target site of HIV-1 provides bulk information and reference frame to HIV-1.But, make single RNAi effectively not suppress effect simultaneously because HIV-1 duplicates rapidly, mutation rate is high.Mathematical model and relevant experimental data show, need the siRNA of 4 different target sites just can effectively suppress HIV-1 generation escape sudden change at least.Should adopt the mode of many target position RNAi to the RNAi gene therapy of HIV-1.Carry out a plurality of independent inhibition if adopt a plurality of independent shRNA to express original paper, tend to normal cell RNA noise channel is disturbed, therefore can adopt a plurality of RNAi to realize through single promotor.The present invention adopts single promoter expression RNA, forms special two long hair card structures, a plurality of genes of HIV-1 is carried out RNAi suppress.
Summary of the invention
The objective of the invention is the gene of a plurality of HIV-1 to be suppressed in order to realize; Design is to the siRNA sequence in the different target genes of HIV-1 zone; Method through Two-Step PCR makes up the expression original paper to the dlhRNA-VGTE of HIV-1, and is implemented in vector plasmid.It suppresses the effect of HIV gene fusion EGFP expression plasmid system to set up experiment in vitro research, in the experiment in vitro cell levels, detects the effect that it suppresses HIV-1 genetic expression through microscopic fluorescence and flow cytometry.Realize that single expression original paper suppresses a plurality of HIV-1 expression of gene.
The present invention at first provides the gene order that suppresses two long hair card structure rna expression original papers (dlhRNA-VGTE) of HIV-1, and this sequence is the sequence shown in the sequence table SEQ ID No.1, and sequence labelling is seen accompanying drawing 4; This expresses original paper in eukaryotic cell, and the effect through polysaccharase is transcribed into RNA, is folded into the secondary structure of dlhRNA, under the effect of nucleicacidase Dicer, be cut into four independently siRNA (19nt) exercise the RNA interference effect respectively.
The present invention is according to HIV-1 sequence conservation and RNAi target sequence characteristics; 4 genes of HIV have been selected respectively: 2 structure gene env; Gag and 2 regulatory gene vpu, tat is as suppressing target spot, and following four RNAi target sequences of the said sequence target of claim 1 HIV-1 are chosen in design:
Above-mentioned sequence is carried out the homology analysis and is turned out to be the HIV-1 conserved sequence with Blast is online.
Secondly; The invention provides the construction process of said pair of long hair card structure rna expression original paper (dlhRNA-VGTE) sequence; This method obtains (long hairpin RNA through Two-step PCR method; LhRNA) long hair card rna expression original paper is that template obtains (double long hairpin RNA, dlhRNA) two long hair card rna expression original papers through Two-step PCR method again with lhRNA; Concrete grammar is following:
1) contain the structure that lhRNA expresses the expression plasmid pGMT-lhRNA-VG of original paper:
First round PCR
Upstream sequence: 5 '-AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-CTGGGTCAGGGACATAAATCTTGTGGGGTGGCTCCCTATTGCCACTGTCTTCTGCT CCGACTCTCGTCCTTTCCACAAG-3 '
PCR reaction system and condition:
Second takes turns PCR
Upstream sequence: AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-AAAAAAGGAGCAGAAGACAGTGGCAATGGGGAGCC
ACCCCACAAGATTTACGTCTGGGTCAGGGACATAAATC-3’
PCR reaction system and condition:
PCR through agarose gel electrophoresis, is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product and reclaims purifying 376bp fragment in 20 μ l; Get 7 μ l, connect test kit through the pGMT of TIANGEN company (VT202-1) carrier and connect; 16 ℃ of connections are spent the night, transform the back and extract plasmid, with EcoRI (NEB, R3103) enzyme is cut evaluation, filters out to contain the segmental positive colony of inhibition; Enzyme is cut evaluation figure and is seen accompanying drawing 1.
2) contain the structure that dlhRNA-VGTE expresses the plasmid pGMT-dlhRNA-VGTE of original paper
First round PCR
Upstream sequence: 5 '-AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-CTGGGTCAGGGACATTATATAATTCACTTCTCCAACTC
TTCCTGCCATAGGAGATGCCAAGGAGCAGAAGACAGTGGCAAT-3’
PCR reaction system and condition:
Second takes turns PCR
Upstream sequence: 5 '-AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-AAAAAAGGCATCTCCTATGGCAGGAAGGTTGGAGA
AGTGAATTATATATGGGTCAGGGACAT-3’
PCR reaction system and condition:
PCR through agarose gel electrophoresis, is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product and reclaims purifying 487bp fragment in 20 μ l; Get 7 μ l, connect test kit through the pGMT of TIANGEN company (VT202-1) carrier and connect; 16 ℃ of connections are spent the night, transform the back and extract plasmid, with EcoRI (NEB, R3101) enzyme is cut evaluation, filters out to contain the segmental positive colony of inhibition, enzyme is cut evaluation figure and is seen accompanying drawing 2.
The present invention also provides the structure that detects the required HIV gene EGFP fusion protein expression plasmid pGag-EGFP/pEnv-EGFP/pTat-EGFP/pVpu-EGFP of above sequence table SEQ ID No.1 said pair of long hair card structure rna expression original paper (dlhRNA-VGTE) functional nucleotide sequence; Specifically comprise:
HIV gene EGFP fusion expression plasmid carrier is selected pEGFP-N1; The EcoRI at selection MCS place and BamHI, are placed on EcoRI in the upstream primer during design primer as restriction enzyme site; BamHI is placed in the downstream primer, guarantees that simultaneously the reading frame of the EGFP gene of back does not change; The vpu gene all is a total length, and gag, tat and env contain the portion gene sequence that suppresses target spot;
Each primer sequence is following:
Vpu upstream primer: 5 '-CGGAATTCCGATGACGCAACCTATACCAATAGTAGC-3 '
Vpu downstream primer: 5 '-CGGGATCCCGCAGATCATCAACATCCCAAGGAGC-3 '
Gag upstream primer: 5 '-CGGAATTCCGATGGGATCAGAAGAACTTAGATC-3 '
Gag downstream primer: 5 '-CGGGATCCCGCCCTGCATGCACTGGATGC-3 '
Tat upstream primer: 5 '-CGGAATTCCGATGGAGCCAGTAGATCCTAG-3 '
Tat downstream primer: 5 '-CGGGATCCCGCTTTGATAGAGAAGCTTGATGAG-3 '
Env upstream primer: 5 '-CGGAATTCCGATGTGGCAGGAAGTAGGAAAAGC-3 '
Env downstream primer: 5 '-CGGGATCCCGTGCTGCTCCCAAGAACCCAAGG-3 '
PCR reaction system and condition:
PCR through agarose gel electrophoresis, is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product and reclaims purifying Vpu250bp, Gag452bp, Tat213bp, Env303bp fragment in 40 μ l; The PCR recovery product of 40 μ l is all carried out EcoRI and BamHI double digestion; Again the double digestion product is reclaimed test kit through BIOMIGA company (DC3511/DC3514-01) sepharose and be recovered in 20 μ l; Getting 7 μ l reclaims enzyme and cuts product and be connected with Takara company (D2011A) T4DNA Ligase ligase enzyme with the pEGFP-N1 plasmid of same double digestion processing; 16 ℃ of connections are spent the night, transform the back and extract plasmid, with EcoRI (NEB, R3101) with BamHI (NEB, R3136) while double digestion evaluation filters out the positive colony that contains corresponding target gene fragment, enzyme is cut evaluation figure and is seen accompanying drawing 3.
The present invention also provides cell levels to detect the method for above sequence table SEQ ID No.1 said pair of long hair card structure rna expression original paper (dlhRNA-VGTE) functional nucleotide sequence, and practical implementation is following:
Cultivate 293T cell, each porocyte density 5 * 10 in 6 orifice plates (FALCON, 353046)
6Individual.
Cotransfection expression plasmid and corresponding HIV gene fusion plasmid after 24 hours.
Wherein pGMT-dlhRNA-VGTE with Gag-EGFP all be each 1 μ g; Because Tat albumen is worn film and is activated the promotor effect; Tat-EGFP is used 0.5 μ g; 3 multiple holes are done in each inhibition, and the pGMT plasmid only carries out transfection (plasmid: PEI=1: 5) with PEI as contrast.
Change liquid after 8 hours after the transfection, observe fluorescence after 48 hours and carry out flow cytometer showed.
Fluirescence observation: (OLYMPUS 1X71) observes bright field cell and fluorescence intensity, and Taking Pictures recording with the fluorescence inverted microscope.
Flow cytometry:
Sop up the substratum in 6 orifice plates, every hole adds 500 μ l (2%) trysinizations 3 minutes.
After time arrives, pat and make the cell dispersion.Add stop buffer 500 μ l, the piping and druming mixing.
Be drawn onto in the new 1.5ml centrifuge tube, in whizzer (Eppendorf, Centrifuge5424) under the 3000rpm condition centrifugal 5 minutes.
Discard supernatant, blow and beat mixing after adding 500 μ l PBS solution, in whizzer (Eppendorf, Centrifuge5424) under the 3000rpm condition centrifugal 5 minutes.
Discard supernatant, and add 1ml (1%) Paraformaldehyde 96, fixedly 30min.(BD FACSCalibur) carries out data determination and analyzes the EGFP positive cell rate through flow cytometer then.The dlhRNA-VGTE Expression element to HIV gene EGFP fusion rotein (Gag-EGFP) inhibition expressed can arrive respectively: 20%, 30%, 58%, 29.5%.
Advantage of the present invention and beneficial effect:
(1) the present invention has designed dlhRNA-VGTE unique, that can express two long hair card secondary structures and has expressed original paper, in the RNA of single expression sequence, comprises two complementary strands of four pairs of different siRNA folded formations.Under the effect of intracellular nucleic acid enzyme Dicer, can be cut into four independently siRNA functionatings.Realized the many target position RNAi under the effect of single U6 promotor.
(2) the HIV gene EGFP expressing fusion protein system that the present invention adopted detects RNAi efficient, and is convenient, safety, and easy handling, and can detect heterogeneic inhibition efficient one by one to HIV.
Description of drawings
Fig. 1: the pGMT-lhRNA-VG enzyme is cut evaluation figure
Fig. 2: the pGMT-dlhRNA-VGTE enzyme is cut evaluation figure
Fig. 3: HIV gene EGFP fusion protein expression plasmid is identified figure
Fig. 4: dlhRNA-VGTE expresses original paper sequence and note, wherein, and U6 promoter:U6 promotor, Sense sequence: positive-sense strand, Antisense sequence: antisense strand;
Fig. 5: dlhRNA-VGTE secondary structure synoptic diagram
Fig. 6: dlhRNA-VGTE expresses original paper and suppresses HIV gene EGFP expressing fusion protein microscopic fluorescence photograph,
Fig. 7: dlhRNA-VGTE expresses original paper and suppresses the quantitative analysis of HIV gene EGFP expressing fusion protein; Show among the figure, the dlhRNA-VGTE Expression element to HIV gene EGFP fusion rotein (Gag-EGFP) inhibition expressed can arrive respectively: 20%, 30%, 58%, 29.5%.
Fig. 8: the FG12-dlhRNA-VGTE cell levels detects and suppresses the analysis of HIV-1 (NL4.3) levels of replication, among the figure, and NC: non-infected cells experimental group, HIV:HIV-1 NL4.3 cells infected experimental group; FG12-VGTE:HIV-1 NL4.3 infects FG12-dlhRNA-VGTE slow virus infection experimental group; FG12:HIV-1NL4.3 infects FG12 slow virus infection experimental group.
Embodiment
The structure and the Function detection that suppress two long hair card structure rna expression original paper sequences of HIV-1
One, the structure that contains the expression plasmid pGMT-dlhRNA-VGTE of two long hair card structure rna expression original paper (dlhRNA-VGTE) sequences
Method feature is; Cross Two-step PCR method and obtain (long hairpin RNA; LhRNA) long hair card rna expression original paper is that template obtains (double long hairpin RNA, dlhRNA) two long hair card rna expression original papers through Two-step PCR method again with lhRNA; Concrete grammar is following:
1) contain the structure that lhRNA expresses the expression plasmid pGMT-lhRNA-VG of original paper:
First round PCR
Upstream sequence: 5 '-AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-CTGGGTCAGGGACATAAATCTTGTGGGGTGGCTCCCTATTGCCACTGTCTTCTGCT CCGACTCTCGTCCTTTCCACAAG-3 '
PCR reaction system and condition:
Second takes turns PCR
Upstream sequence: AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-AAAAAAGGAGCAGAAGACAGTGGCAATGGGGAGCC
ACCCCACAAGATTTACGTCTGGGTCAGGGACATAAATC-3’
PCR reaction system and condition:
PCR through agarose gel electrophoresis, is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product and reclaims purifying 376bp fragment in 20 μ l; Get 7 μ l, connect test kit through the pGMT of TIANGEN company (VT202-1) carrier and connect; 16 ℃ of connections are spent the night, transform the back and extract plasmid, with EcoRI (NEB, R3103) enzyme is cut evaluation, filters out to contain the segmental positive colony of inhibition; Enzyme is cut evaluation figure and is seen accompanying drawing 1.
2) contain the structure that dlhRNA-VGTE expresses the plasmid pGMT-dlhRNA-VGTE of original paper
First round PCR
Upstream sequence: 5 '-AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-CTGGGTCAGGGACATTATATAATTCACTTCTCCAACTC
TTCCTGCCATAGGAGATGCCAAGGAGCAGAAGACAGTGGCAAT-3’
PCR reaction system and condition:
Second takes turns PCR
Upstream sequence: 5 '-AAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-AAAAAAGGCATCTCCTATGGCAGGAAGGTTGGAGA
AGTGAATTATATATGGGTCAGGGACAT-3’
PCR reaction system and condition:
PCR through agarose gel electrophoresis, is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product and reclaims purifying 487bp fragment in 20 μ l; Get 7 μ l, connect test kit through the pGMT of TIANGEN company (VT202-1) carrier and connect; 16 ℃ of connections are spent the night, transform the back and extract plasmid, with EcoRI (NEB, R3101) enzyme is cut evaluation, filters out to contain the segmental positive colony of inhibition, enzyme is cut evaluation figure and is seen accompanying drawing 2.
Two, the structure of HIV gene EGFP fusion protein expression plasmid pGag-EGFP/pEnv-EGFP/pTat-EGFP/pVpu-EGFP:
HIV gene EGFP fusion expression plasmid carrier is selected pEGFP-N1; The EcoRI at selection MCS place and BamHI, are placed on EcoRI in the upstream primer during design primer as restriction enzyme site; BamHI is placed in the downstream primer, guarantees that simultaneously the reading frame of the EGFP gene of back does not change; The vpu gene all is a total length, and gag, tat and env contain the portion gene sequence that suppresses target spot;
Each primer sequence is following:
Vpu upstream primer: 5 '-CGGAATTCCGATGACGCAACCTATACCAATAGTAGC-3 '
Vpu downstream primer: 5 '-CGGGATCCCGCAGATCATCAACATCCCAAGGAGC-3 '
Gag upstream primer: 5 '-CGGAATTCCGATGGGATCAGAAGAACTTAGATC-3 '
Gag downstream primer: 5 '-CGGGATCCCGCCCTGCATGCACTGGATGC-3 '
Tat upstream primer: 5 '-CGGAATTCCGATGGAGCCAGTAGATCCTAG-3 '
Tat downstream primer: 5 '-CGGGATCCCGCTTTGATAGAGAAGCTTGATGAG-3 '
Env upstream primer: 5 '-CGGAATTCCGATGTGGCAGGAAGTAGGAAAAGC-3 '
Env downstream primer: 5 '-CGGGATCCCGTGCTGCTCCCAAGAACCCAAGG-3 '
PCR reaction system and condition:
PCR through agarose gel electrophoresis, is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product and reclaims purifying Vpu250bp, Gag452bp, Tat213bp, Env303bp fragment in 40 μ l; The PCR recovery product of 40 μ l is all carried out EcoRI and BamHI double digestion; Again the double digestion product is reclaimed test kit through BIOMIGA company (DC3511/DC3514-01) sepharose and be recovered in 20 μ l; Getting 7 μ l reclaims enzyme and cuts product and be connected with Takara company (D2011A) T4DNA Ligase ligase enzyme with the pEGFP-N1 plasmid of same double digestion processing; 16 ℃ of connections are spent the night, transform the back and extract plasmid, with EcoRI (NEB, R3101) with BamHI (NEB, R3136) while double digestion evaluation filters out the positive colony that contains corresponding target gene fragment, enzyme is cut evaluation figure and is seen accompanying drawing 3.
Three, cell levels detects the method for above sequence table SEQ ID No.1 said pair of long hair card structure rna expression original paper (dlhRNA-VGTE) functional nucleotide sequence, and practical implementation is following:
Cultivate 293T cell, each porocyte density 5 * 10 in 6 orifice plates (FALCON, 353046)
6Individual.
Cotransfection expression plasmid and corresponding HIV gene fusion plasmid after 24 hours.
Wherein pGMT-dlhRNA-VGTE with Gag-EGFP all be each 1 μ g; Because Tat albumen is worn film and is activated the promotor effect; Tat-EGFP is used 0.5 μ g; 3 multiple holes are done in each inhibition, and the pGMT plasmid only carries out transfection (plasmid: PEI=1: 5) with PEI as contrast.
Change liquid after 8 hours after the transfection, observe fluorescence after 48 hours and carry out flow cytometer showed.
Fluirescence observation: (OLYMPUS 1X71) observes bright field cell and fluorescence intensity, and Taking Pictures recording with the fluorescence inverted microscope.
Flow cytometry:
Sop up the substratum in 6 orifice plates, every hole adds 500 μ l (2%) trysinizations 3 minutes.
After time arrives, pat and make the cell dispersion.Add stop buffer 500 μ l, the piping and druming mixing.
Be drawn onto in the new 1.5ml centrifuge tube, in whizzer (Eppendorf, Centrifuge5424) under the 3000rpm condition centrifugal 5 minutes.
Discard supernatant, blow and beat mixing after adding 500 μ l PBS solution, in whizzer (Eppendorf, Centrifuge5424) under the 3000rpm condition centrifugal 5 minutes.
Discard supernatant, and add 1ml (1%) Paraformaldehyde 96, fixedly 30min.(BD FACSCalibur) carries out data determination and analyzes the EGFP positive cell rate through flow cytometer then.The dlhRNA-VGTE Expression element to HIV gene EGFP fusion rotein (Gag-EGFP) inhibition expressed can arrive respectively: 20%, 30%, 58%, 29.5%.
Making up FG12-dlhRNA-VGTE slow virus inhibition HIV-1 (NL4.3 type strain) duplicates
One, the structure of slow virus expression vector pFG12-dlhRNA-VGTE
Upstream sequence: 5 '-GCTCTAGAGCAAGATCTGGGCAGGAAGAGGG-3 '
Downstream sequence: 5 '-CCGCTCGAGCGGAAAAAAGGCATCTCCTATGGCAG
GAAGGTTGGAGAAGTGAATTATATATGG-3’
Above-mentioned sequence all adopts the synthesizing single-stranded oligonucleotide of chemical synthesis process.
The PCR method obtains the dlhRNA fragment
The PCR product is reclaimed test kit through the PCR of BIOMIGA company (DC3511/DC3514-01) product reclaim purifying DNA fragment in 40 μ l.Dna fragmentation that purifying is obtained and plasmid vector FG12 use respectively XbaI (NEB, R0145) and XhoI (NEB, R0146) double digestion.The double digestion product reclaims test kit through BIOMIGA company (DC3511/DC3514-01) product and reclaims.Getting the T4DNALigase of Takara company (D2011A) ligase enzyme carries out 16 ℃ of connections and spends the night.Transformed into escherichia coli DH5 α is through the Amp resistance screening.Extract plasmid, (NEB, R0145) (NEB, R0146) double digestion evaluation simultaneously again filter out and contain the segmental positive colony of inhibition with XhoI with XbaI.
Two, the preparation of slow virus FG12-dlhRNA-VGTE
Plasmid pFG12-dlhRNA-VGTE with its helper plasmid cotransfection 293T cell, can be packed out expression FG12-dlhRNA-VGTE and expresses slow virus.Packaging system is: pFG12-dlhRNA-VGTE: pRRE-m: pHCMV-G: pRSV-Rev :=4: 2: 1.5: 1.
FG12-dlhRNA-VGTE virus packaging step:
In the culture plate of 15 centimetres of diameters, cultivate 293T cell, every dish cell density 1.2 * 10
7Individual.
Get pFG12-dlhRNA-VGTE 25 μ g, pRRE-m 12.5 μ g, pHCMV-G 7.5 μ g, pRSV-Rev5 μ g after 24 hours, with plasmid: PEI=1: 5 cotransfection 293T cells.
Transfection was changed liquid after 8 hours, collected viral supernatant in the 50ml centrifuge tube in 60 hours.In whizzer (Anke, TDL-40B) under the 2500rpm condition centrifugal 10 minutes.
With supernatant through 0.45 μ m membrane filtration to the ultra luxuriant core barrel.(Beckman Coulter OptimaL-100XP) surpasses from 90 minutes under 4 ℃ of 32000rpm conditions in ultra luxuriant scheming.
Ultra after finishing, inhale and remove supernatant, add the two no substratum of 200 μ l and spend the night for 4 ℃.Be sub-packed in the PCR pipe every pipe 20 μ l on the 2nd day.And measure this viral titre TCID50/ml, be stored at last in-70 ℃ or the liquid nitrogen.
Contrast slow virus FG12 preparation method is identical, just the pFG12-dlhRNA-VGTE plasmid is changed to pFG12.
Three, FG12-VGTE virus detects the inhibition of HIV-1NL4-3 is active
The tat gene of HIV-1NL4-3 virus can activate luciferase gene and expressing luciferase in the TZM-bl cell; Adding substrate (Promega; E253B) can develop the color after; (Applied Biosystem, TR717) fluorescence intensity is judged the infection intensity of NL4-3 through Chemiluminescence Apparatus.The detection step is following:
In 96 orifice plates (FALCON, REF 353072), cultivate TZM-bl cell, every porocyte density 4 * 10
3Individual.
Add HIV-1 virus N L4-3 after 24 hours and infect TZM-bl cell, MOI=0.015 during infection.Infect changing fresh culture into after 8 hours, add therapeutic virus FG12-dlhRNA-VGTE (MOI=0.015) and contrast viral FG12 (MOI=0.015) this moment.
Divide 4 times and added in 24 hours at interval FG12-dlhRNA-VGTE (MOI=0.015) and contrast viral FG12 (MOI=0.015) later on.
96 orifice plates (FALCON, REF 353072) are taken out cell culture incubator in the 6th day, place room temperature.Remove 50 μ l substratum (also surplus 50 μ l substratum) from every hole with 200 μ l pipettors, add 50 μ l lysate and substrate (Promega, E253B).Room temperature vibration 5min on decolorization swinging table.At last cracked enchylema is transferred to 96 hole blanks, through Chemiluminescence Apparatus (Applied Biosystem, TR717) fluorescence intensity.
Measure fluorescent value, fluorescence intensity is high more, and the HIV-1 levels of replication is high more.The levels of replication that can reflect HIV-1 through ratio with the fluorescence reading of HIV-1 cell not.As shown in Figure 8, the result shows that FG12-dlhRNA-VGTE can suppress HIV-1 and duplicate and reach 55.4%.
SEQUENCE?LISTING
< 110>Nankai University
< 120>structure and the Function detection of two long hair card structure rna expression original papers of inhibition HIV-1
<130>
<160> 1
<170> PatentIn?version?3.3
<210> 1
<211> 466
<212> DNA
<213> Artificial
<220>
< 223>nucleotide primer of synthetic carries out PCR again and obtains.
<220>
<221> U6?promoter
<222> (1)..(21)
<223> aagatctgggcaggaagaggg
<220>
<221> vpu?sense?sequence
<222> (259)..(279)
<223> ggagcagaagacagtggcaat
<220>
<221> gag?sense?sequence
<222> (281)..(301)
<223> gggagccaccccacaagattt
<220>
<221> loop
<222> (302)..(315)
<223> atgtccctgaccca
<220>
<221> gag?antisense?sequence
<222> (316)..(336)
<223> aaatcttgtggggtggctccc
<220>
<221> vpu?antisense?sequence
<222> (338)..(358)
<223> attgccactgtcttctgctcc
<220>
<221> tat?sense?sequence
<222> (361)..(381)
<223> ggcatctcctatggcaggaag
<220>
<221> env?sense?sequence
<222> (383)..(403)
<223> gttggagaagtgaattatata
<220>
<221> loop
<222> (404)..(417)
<223> atgtccctgaccca
<220>
<221> env?antisense?sequence
<222> (418)..(438)
<223> tatataattcacttctccaac
<220>
<221> tat?antisense?sequence
<222> (440)..(460)
<223> cttcctgccataggagatgcc
<220>
<221> terminator
<222> (461)..(466)
<223> tttttt
<400> 1
aagatctggg?caggaagagg?gcctatttcc?catgattcct?tcatatttgc?atatacgata 60
caaggctgtt?agagagataa?ttagaattaa?tttgactgta?aacacaaaga?tattagtaca 120
aaatacgtga?cgtagaaagt?aataatttct?tgggtagttt?gcagttttaa?aattatgttt 180
taaaatggac?tatcatatgc?ttaccgtaac?ttgaaagtat?ttcgatttct?tggctttata 240
tatcttgtgg?aaaggacggg?agcagaagac?agtggcaata?gggagccacc?ccacaagatt 300
tatgtccctg?acccaaaatc?ttgtggggtg?gctccccatt?gccactgtct?tctgctcctt 360
ggcatctcct?atggcaggaa?gagttggaga?agtgaattat?ataatgtccc?tgacccatat 420
ataattcact?tctccaaccc?ttcctgccat?aggagatgcc?tttttt 466
Claims (3)
1. suppressing the gene order of two long hair card structure rna expression original paper dlhRNA-VGTE of HIV-1, is the sequence shown in the sequence table SEQ ID No.1; This expresses original paper in eukaryotic cell, and the effect through polysaccharase is transcribed into RNA, is folded into the secondary structure of dlhRNA, under the effect of nucleicacidase Dicer, be cut into four independently siRNA exercise the RNA interference effect respectively.
2. sequence as claimed in claim 1 is characterized in that, according to HIV-1 sequence conservation and RNAi target sequence characteristics; 4 genes of HIV have been selected respectively: 2 structure gene env; Gag and 2 regulatory gene vpu, tat is as suppressing target spot, following four RNAi target sequences of design target HIV-1; The RNAi target sequence is sense strand, and anti-sense strand and sense strand are complementary:
Above-mentioned sense strand sequence is carried out the homology analysis and is turned out to be the HIV-1 conserved sequence with Blast is online.
3. the construction process of two according to claim 1 long hair card structure rna expression original paper dlhRNA-VGTE sequences; It is characterized in that; Obtain long hairpin rna expression original paper through Two-step PCR method; Be called for short lhRNA and express original paper, expressing original paper with lhRNA again is that template is expressed original paper through Two-step PCR method acquisition dlhRNA; The final structure contained the plasmid pGMT-dlhRNA-VGTE that dlhRNA-VGTE expresses original paper.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110357481A CN102352360B (en) | 2011-11-11 | 2011-11-11 | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110357481A CN102352360B (en) | 2011-11-11 | 2011-11-11 | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102352360A CN102352360A (en) | 2012-02-15 |
| CN102352360B true CN102352360B (en) | 2012-10-10 |
Family
ID=45575998
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110357481A Expired - Fee Related CN102352360B (en) | 2011-11-11 | 2011-11-11 | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102352360B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015027334A1 (en) * | 2013-08-26 | 2015-03-05 | The Royal Institution For The Advancement Of Learning / Mcgill University | Antisense-based small rna agents targeting the gag open reading frame of hiv-1 rna |
| WO2020024019A1 (en) * | 2018-08-03 | 2020-02-06 | Commonwealth Scientific And Industrial Research Organisation | Rna molecules comprising non-canonical base pairs |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050222068A1 (en) * | 2003-10-23 | 2005-10-06 | Mourich Dan V | Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells |
-
2011
- 2011-11-11 CN CN201110357481A patent/CN102352360B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| Sheena et al.The Efficacy of Generating Three Independent Anti-HIV-1 siRNAs from a Single U6 RNA Pol III-Expressed Long Hairpin RNA.《PLoS ONE》.2008,第3卷(第7期),1-10. * |
| 江雪艳.HIV-Vif基因的RNA干扰试验研究.《中国优秀硕士学位论文全文数据库 医药卫生科技辑》.2009,(第8期),第38-40页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102352360A (en) | 2012-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Coyle et al. | The Tpr protein regulates export of mRNAs with retained introns that traffic through the Nxf1 pathway | |
| Ter Brake et al. | Lentiviral vector design for multiple shRNA expression and durable HIV-1 inhibition | |
| Lu et al. | Antisense-mediated inhibition of human immunodeficiency virus (HIV) replication by use of an HIV type 1-based vector results in severely attenuated mutants incapable of developing resistance | |
| Liu et al. | Combinatorial RNAi against HIV-1 using extended short hairpin RNAs | |
| Westerhout et al. | The virion-associated incoming HIV-1 RNA genome is not targeted by RNA interference | |
| Ter Brake et al. | Lentiviral vectors that carry anti‐HIV shRNAs: problems and solutions | |
| ter Brake et al. | A novel approach for inhibition of HIV-1 by RNA interference: counteracting viral escape with a second generation of siRNAs | |
| US20170283802A1 (en) | Design of nucleic acid binding molecules with non-watson crick and non-canonical pairing based on artificial mutation consensus sequences to counter escape mutations | |
| Janas et al. | Lentiviral delivery of RNAi in hippocampal neurons | |
| Liu et al. | RNAi-inducing lentiviral vectors for anti-HIV-1 gene therapy | |
| Doux et al. | Lentiviral vector delivery of siRNA and shRNA encoding genes into cultured and primary hematopoietic cells | |
| CN102206645B (en) | Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector | |
| Poling et al. | A lentiviral vector bearing a reverse intron demonstrates superior expression of both proteins and microRNAs | |
| Chumakov et al. | Efficient downregulation of multiple mRNA targets with a single shRNA-expressing lentiviral vector | |
| CN102352360B (en) | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) | |
| CN101684478B (en) | Method for constructing tandem expression small interfering RNA recombinant lentiviral vector | |
| JP2012167093A (en) | Random homozygous gene perturbation (rhgp) with thermal assymetric interlaced (tail)-pcr | |
| Bagasra | RNAi as an antiviral therapy | |
| Cullen | Does RNA interference have a future as a treatment for HIV-1 induced disease | |
| Gao et al. | Targets of small interfering RNA restriction during human immunodeficiency virus type 1 replication | |
| CN103255173A (en) | Double-promoter and double-expression specific shRNA (Short Hairpin Ribonucleic Acid) lentiviral vector and application thereof | |
| CN109266684B (en) | Method for constructing animal model with pathogen infection sensitivity | |
| CN109321574B (en) | Short hairpin shRNA (short hairpin ribonucleic acid) for inhibiting ILT5 expression, lentivirus and application of short hairpin shRNA and lentivirus | |
| Berkhout et al. | Design and Evaluation of AgoshRNAs with 3′-Terminal HDV Ribozymes to Enhance the Silencing Activity | |
| RU2630644C1 (en) | Cartridge genetic construct expressing two biologically active sirnas effectively attacking targets in mrna of vpu and env genes of hiv-1 subtype a in russian patients, and one sirna aimed at ccr5 gene mrna |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121010 Termination date: 20151111 |
|
| EXPY | Termination of patent right or utility model |