CN101307085B - SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof - Google Patents
SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof Download PDFInfo
- Publication number
- CN101307085B CN101307085B CN2007100753608A CN200710075360A CN101307085B CN 101307085 B CN101307085 B CN 101307085B CN 2007100753608 A CN2007100753608 A CN 2007100753608A CN 200710075360 A CN200710075360 A CN 200710075360A CN 101307085 B CN101307085 B CN 101307085B
- Authority
- CN
- China
- Prior art keywords
- iron
- dna
- rna
- shrna
- slow virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses an RNA with little interference for inhibiting the expression of an iron regulating element regulatory protein (HJV). The RNA with little interference is in reverse complementation with the iron regulating element regulatory protein gene mRNA, and the length of the RNA is 19-27bp. The invention further discloses a DNA for coding the corresponding shRNA of the RNA with little interference and a recombined slow virus capable of expressing the shRNA. The RNA with little interference, the DNA capable of coding the shRNA and the recombined slow virus can effectively inhibit the expression of the iron regulating element regulatory protein in vivo, improve the level of the iron regulating element and reduce the level of serum iron in vivo, thereby reaching the aim of curing diseases related to iron metabolism.
Description
Technical field
The present invention relates to molecular biology, biological medicine and gene engineering technology field; Be specifically related to utilize the RNA perturbation technique of slow virus (Lentivirus) mediation; Make up to iron and transfer the plain slow virus interference system (PLT-HJVi) of regulating albumen (HJV) gene, and it is applied in the middle of drug development preparation of iron metabolism relative disease.
Background technology
RNAi refers to when importing with endogenous mRNA coding region homologous double-stranded RNA in the cell, and this mRNA degraded takes place and causes the reticent phenomenon of genetic expression.
The RNA interfering process mainly contains 2 steps: (1) long dsrna is cut into the short dsrna of 21-23 base pair by the special nucleicacidase of the double-stranded RNA of cell source, be called little interferential RNA (small interfering RNA, siRNA).(2) some enzyme of little interferential RNA and cell source and protein form complex body; Be called RNA inductive silencing complex (RNA-inducedsilencing complex; RISC); This complex body can be discerned the mRNA that homologous sequence is arranged with little interferential RNA, and in special site this mRNA is cut off.
1998; Andrew's method strategic point (Andrew Z.Fire) etc. carries out finding when sense-rna suppresses experiment in Caenorhabditis elegans (C.elegans); The double-stranded RNA that adds is compared normal chain or anti-chain RNA has demonstrated stronger inhibition effect (Fire et al., 1998) as contrasting.From considering that with the mol ratio of said target mrna therefore the inhibition effect when the inhibition effect of the double-stranded RNA of adding is better than 1:1 pairing is in theory inferred in the process of inhibition of double-stranded RNA guiding, to have certain amplification effect and have certain enzymic activity to participate.Subsequently; Find to have the double-stranded RNA that the active Dicer of RNase III can be processed into long double-stranded RNA the weak point that 21～23nt of being referred to as siRNA (small interfering RNA) and 3 ' distal process go out again in succession; SiRNA and several albumen are formed the RNA albumen composition that is referred to as RISC mixture (RNA-induced silencing complex), and by the leading RNAi effect of this mixture.Calendar year 2001, Tuschl etc. import to short siRNA in the mammalian cell and have solved the Interferon, rabbit effect that causes when in mammalian cell, importing long double-stranded RNA thus, have expanded RNAi application prospect in gene therapy thus.RNAi mechanism is prevalent in the biological species, and gene expression regulation conservative relatively on therefore being considered to evolve is machine-processed.A kind of hypothesis is that RNAi mechanism exists as the defense mechanism of on rna level, resisting poisoning intrusion.Find more relevant factors such as endogenous in the RNAi mechanism at present
Double-stranded RNA and protein factor can be regulated and control genetic expression on multiple level; Its scope has surmounted PTGS (post transcriptional gene silencing), has participated in equally in the gene expression regulation process on the transcriptional level like RNAi mechanism.2006, Andrew's method strategic point obtains Nobel's physiology with Daniel Craig plum Lip river (Craig C.Mello) owing to the contribution in the RNAi Mechanism Study and medical science is encouraged.
The double-stranded RNA of the length that is imported by the external world at first is known as Dicer and has the little double-stranded RNA that the active RNA enzyme of RNaseIII cuts into 21～23 base pairs; This RNA is known as smallinterfering RNA (siRNA), it is characterized in that 3 ' end is with respect to outstanding two bases of complementary strand.After accomplishing said process, the last combination of siRNA RNAi protein factor, and form the RNA-albumen composition that is called RISC (RNA-induced silencing complex).In the RISC mixture, siRNA depends on the strand that converts into of ATP/ or ATP dependent/non-dependent, and then RISC is activated.Activated form RISC receives to become the siRNA guiding (guide strand) of strand, is combined in target mRNA sequence-specific and goes up and cut off target mRNA, causes the specificity of said target mrna and decomposes.Several and the RNAi proteins associated factor that comprise Dicer have been identified up to now.In fruit bat (Drosophila melanogaster) RISC, the known factor that is called Argonaute2 (AGO2) that exists, when the proteic expression of AGO2 was suppressed, RNAi effect disappearance that is to say that AGO2 is the necessary factor of fruit bat RNAi mechanism.Research shows that the Argonaute family protein has RNA nickase active (slicer activity), and RNAi mechanism is active leading by the RNA nickase of Argonaute family protein just.In addition, several rna helicase enzymes (RNA helicase) also are accredited as the factor of participating in RNAi mechanism.The factor necessary in the RNAi of Caenorhabditis elegans (C.elegans) has EGO1, and this is a kind of RdRP (RNA-dependent RNA Polymerase), also has this albumen homologue in the plant.Among the RNAi RdRP be with target mRNA as template, as the synthetic RNA of primer, in cell, be directed to the enzyme of the synthetic novel siRNA of target mRNA with the dsRNA (or siRNA) that imports.This is reflected at is necessary among some biological RNAi, and the RdRP activity is nonessential in the RNAi of people and fruit bat, though basic framework of this explanation RNAi mechanism between different plant species is identical, but exists delicate difference.
RNAi has high efficiency and a simplicity aspect gene silencing, so be the important tool of gene functional research.Most drug belongs to the suppressor factor of target gene (or disease gene), so RNAi simulated the effect of medicine, and the research method that this function is lost (LOF) obtains (GOF) method than traditional functions and has more advantage.Therefore, RNAi is the important tool that drug targets is confirmed in the pharmaceutical industries of today.Simultaneously, those proof effective siRNA/shRNA in the target experiment itself can also be developed further into the medicine into RNAi.
Aspect drug targets discovery and affirmation, the RNAi technology has obtained to use widely.Cell is introduced in the RNAi library that it is good that biotech company or drugmaker utilize foundation usually, and the phenotype through observation of cell changes the gene of finding to have function then.As can find to suppress the gene of tumour through the growth of tumour cell of RNAi library mediation.In case the base of being found
But because of the target that belongs to medication (as expressed proteins on cytolemma or secreted the extracellular), just can be directed against this target and carry out large-scale drug screening.In addition, the also available RNAi technology of found target is further confirmed in cell levels or animal body.
Aspect disease treatment, double-chain small molecule RNA or siRNA have been used to clinical trial and have been used for several kinds of disease treatments, as looking macular degeneration old age.
Yet to the RNA perturbation technique be applied to clinical treatment, need to solve the RNA interference fragment and express major issues such as lasting and expression efficiency.
ShRNA is short hairpin RNA (short hairpin RNA).In the RNAi course of infection; Effective ways that produce dsRNA are exactly to express a short hairpin RNA in vivo; This shRNA comprises two short inverted repeats (one of them and goal gene complementation), and is middle by a loop sequence separation, forms hairpin structure.ShRNA can be processed to siRNA in vivo, thereby the degraded goal gene suppresses its expression.
It is a newfound in recent years micromolecule polypeptide that iron is transferred plain (hepcidin), mainly synthetic by liver.It is the transmitter of iron metabolism conditioning signal between liver, small intestine and the reticuloendothelial system, is the centering control person of body iron balance.When any reason causes that circulation iron increases; Liver cell increases synthetic and secretion iron is transferred the plain blood that gets into, and iron is transferred and plainly is transported to the absorption site duodenum of iron and the main position scavenger cell that iron stores through blood flow, combines with film iron transfer albumen 1 (Ferroportin1) on the cytolemma; And degradative membrane iron transfer albumen 1; Get into blood thereby suppress iron from enteric cavity, reduce scavenger cell secretion iron simultaneously and get into blood, the blood iron level is reduced.When circulation iron was low, liver is synthetic transferred plain the minimizing with excretory iron.The degraded of intestinal absorption epithelium GAP-associated protein GAP reduces, and intestines iron absorbed dose increases, and iron level is returned to normally.
We are nearest discovers and has at first reported brain in the world and had the ability to express iron and transfer plain.Also oneself transfers element can reduce iron level in the brain by the preliminary intracerebral ventricle injection iron that shows in our experiment, explain that iron transfers element can regulate the brain iron metabolism, the keeping of participation brain iron balance.As far back as 1991, we have found that the imbalance and the iron inductive oxidative stress of brain iron, be the major incentive that promotes neurodegeneration.Experimental data shows that the imbalance of brain iron is one of the reason that starts of the onset of some nerve degenerative diseases (for example: parkinson's disease PD and senile dementia AD) at least.
Iron is transferred plain adjusting albumen, and (Hemojuvelin HJV) is a kind of important iron metabolism adjusting albumen of recent findings.2004, Papanikolaou etc. went out this new gene No. 1 the short arm of a chromosome isolation identification first.The research demonstration that comes 2 years, Hemojuvelin is that a kind of very important adjusting iron is transferred plain (hepcidin) expressed proteins, thereby transfers plain expression in iron metabolism, to play a significant role through participating in regulating and control iron more.Comprehensive other results of study and our research show; The expression of HJV and iron transfer the expression level of plain (hepcidin) to be negative correlativing relation; Transfer the plain proteic expression of regulating through suppressing iron; Can raise the level that iron is transferred element in the body, reduce intravital serum levels of iron level, thereby reach the purpose of treatment iron metabolism relative disease.
Summary of the invention
The object of the invention is exactly the problems referred to above to prior art, can effectively suppress the plain little interferential RNA (siRNA) of regulating iron level in the protein expression control agent of iron accent in the body thereby provide a kind of.
Another object of the present invention is to provide coding to contain the DNA of the shRNA (short hairpin RNA) of above-mentioned little interferential RNA.
A purpose more of the present invention is to provide to be had the above-mentioned shRNA of good target property, security and continuous expression and then suppresses the recombinant slow virus that iron transfers plain adjusting albumen (HJV) to express.
A purpose more of the present invention is to provide above-mentioned DNA and the application of recombinant slow virus aspect the preparation medicine.
For realizing above-mentioned purpose, the present invention has adopted following technical scheme:
The invention discloses a kind of inhibition iron and transfer the plain little interferential RNA (siRNA) that albumen (HJV) is expressed of regulating, said little interferential RNA and iron are transferred the plain protein gene mRNA reverse complemental of regulating, and its length is 19-27bp.
Preferably, said little interferential RNA contains following sequence:
Seq?ID?No.1：5’-CAAUCUUCCUGCAGCCUUUGA-3’
Seq?ID?No.2：3’-GUUAGAAGGACGUCGGAAACU-5’
The present invention further discloses a kind of coding and contain the DNA of shRNA of positive-sense strand and the antisense strand of above-mentioned little interferential RNA.
Preferably, said DNA also contains promotor and PolyA termination message sequence, and promotor is preferably the U6 promotor.
Preferably, said DNA contains the sequence shown in Seq ID No.3 in the ordered list and/or the Seq ID No.4.
In the preferred embodiment of the present invention, said DNA is a double-stranded DNA, and template strand is the sequence shown in the Seq ID No.3 in the sequence table, and coding strand is the sequence shown in the Seq ID No.4 in the sequence table.
The invention also discloses a kind of inhibition iron and transfer the plain recombinant slow virus that albumen (HJV) is expressed of regulating, said recombinant slow virus contains above-mentioned DNA and lentiviral vectors.
Preferably, said lentiviral vectors is self inactivation lentiviral vectors (SIN).
The present invention further discloses above-mentioned little interferential RNA, above-mentioned DNA and above-mentioned recombinant slow virus and be used for treating the application of the medicine of iron metabolism disorders in preparation.
Said iron metabolism disorders such as senile dementia, parkinsonism, nerve degenerative diseases etc.
Owing to adopted above technical scheme, made the present invention possess following beneficial effect:
The DNA of little interferential RNA of the present invention, coding shRNA and recombinant slow virus can effectively suppress iron accent element adjusting protein expression in the body, raise the level of iron accent element in the body and reduce intravital serum levels of iron level, thereby reach the purpose of treating the iron metabolism relative disease.
Especially, recombinant slow virus of the present invention has improved the security and the target property of carrier greatly through selecting third generation lentiviral vectors----self-inactivating lentiviral vectors (SIN).Lentiviral vectors can selectivity insert in the karyomit(e), the situation of inactivation can not occur inserting.Slow virus is carried shRNA and gets into target cell, can be integrated into the genome of cell, continues the relevant shRNA of secular expression, and can not cause the toxic action of pair cell.Slow virus interference system of the present invention has good target property, security and expresses persistence, can effectively promote iron and transfer plain (hepcidin) expression amount, reduces the concentration of serum levels of iron, and without any side effects to normal cell.Recombinant slow virus of the present invention is inserted into the U6 promotor in the self-inactivating slow virus system, utilizes humanized's U6 promotor to start segmental the transcribing of insertion, has advantages such as efficient, accurate.Through repeatedly experiment, prove that all slow virus interference system of the present invention can effectively regulate iron and transfer plain expression.
The shRNA of the present invention design through in the body and experiment in vitro prove, can effectively suppress HJV and express more than 95%, and the iron that can raise accordingly transfers plain level, effectively regulate the level of serum levels of iron.
Description of drawings
Fig. 1 is the MCS figure of PLT lentiviral vectors;
Fig. 2 is that interference fragment of the present invention connects upward people source U6 promotor synoptic diagram;
Fig. 3 is a PLT-HJVi system constructing schema;
After Fig. 4 is PLT-HJVi system infectosome cell, the proteic expression figure of HJV;
After Fig. 5 was PLT-HJVi system infectosome cell, secondary caused iron accent fibroin (Hepcidin) up-regulated figure;
Fig. 6 raises the SD rat through the high ferro feed, makes up high serum levels of iron animal model, utilizes the PLT-HJVi system to carry out experiment in the body then, reduces serum levels of iron level figure as a result.
Embodiment
The present invention utilizes the pathogeny of iron metabolism relative disease, regulates the expression of HJV targetedly, designs the DNA of specific little interferential RNA and coding shRNA, thereby reduces the infringement of serum levels of iron for cell.Little interferential RNA of the present invention and the coded shRNA of DNA, ability specific recognition sequence: CAATCTTCCTGCAGCCTTTGA, this sequence is positioned at HJV (AK098165) 953-973 base place.
The DNA of coding shRNA of the present invention is a double-stranded DNA, and its template strand is the sequence shown in the SeqID No.3 in the sequence table, and coding strand is the sequence shown in the Seq ID No.4 in the sequence table.It is through after the lentiviral vectors mediation, effective continuous expression shRNA in vivo, and this shRNA ability specific recognition sequence: CAATCTTCCTGCAGCCTTTGA, this sequence is positioned at HJV (AK098165) 953-973 base place.In sequence Seq ID No.3 of the present invention and Seq IDNo.4, designed and comprised polyA tail signal.
To the RNA perturbation technique be applied to clinical treatment, just need to solve the RNA interference fragment and express major issues such as lasting and expression efficiency.We utilize the inactivation lentiviral vectors to carry the dna profiling of RNA interference fragment, and it is transcribed into shRNA in vivo, have perfectly solved RNA and have disturbed target property, the security of gene therapy and the problem of expressing persistence.
The present invention is through synthetic interference fragment, and U6 promotor orientation is connected interference fragment 5 ' end, and the order-checking back confirms the exactness of its sequence, the dna profiling of U6+shRNA is connected in the middle of the lentiviral vectors again.The transfection recombinant chou is gone into the 293T cell, obtains viral supernatant, and the interior experiment proof of external and body can effectively suppress HJV.
In the preferred embodiment of the present invention, made up iron and transferred the plain slow virus interference system (PLT-HJVi) of regulating albumen (HJV), and obtained good inhibition effect.
Through concrete embodiment the present invention is made further detailed description below.
Embodiment 1
Transfer plain adjusting albumen (HJV) sequence (AK098165) according to iron, and add 20bpU6 sequence joint and PolyA termination message sequence according to humanized U6 sequence.3 ' end adds the XhoI restriction enzyme site, send Invitrogen company composition sequence.Through screening, obtain the most significant HJV of the present invention of interference effect and disturb the segment sequence following:
Template strand (Seq ID No.3):
5’-GTGGAAAGGACGAAACACCGTCAAAGGCTGCAGGAAGATTGTTGATATCCGCAATCTTCCTGCAGCCTTTGACTTTTTCTCGAGCTGGA-3’
Coding strand (Seq ID No.4):
5’-TCCAGCTCGAGAAAAAGTCAAAGGCTGCAGGAAGATTGTTGATATCCGCAATCTTCCTGCAGCCTTTGACGGTGTTTCGTCCTTTCCAC-3’
Embodiment 2
The PLT-HJVi system constructing
Make up reorganization PLT-HJVi plasmid such as accompanying drawing 2,3 shown in.It is three big steps that building process is divided into:
One, obtains people U6 promotor;
A) add 1mlSNET solution cracking 1X10 under the room temperature
10Individual Humanized cell strain HEK293;
B) from mortar, draw in the EP pipe of cell pyrolysis liquid to a 2ml, add 40ul Proteinase K and 2ulRNA enzyme;
C) sealing EP pipe, the horizontal positioned centrifuge tube is in 55 degree water-baths, and slowly vibration digestion is at least 3 hours;
D) take out the EP pipe, add 1ml phenol-chloroform mixed solution, softly put upside down 3 times.Slow vibration 30min to the shaking table.(<60rpm)；
E) desk centrifuge (13000rpm) centrifugal 5min the most at a high speed under the room temperature;
F) the careful separation water adds the equal-volume Virahol to new EP pipe, puts upside down mixing gently;
G) 4 ℃, the centrifugal (15min of 14000rpm-20000g);
H) softly remove Virahol;
I) add 1ml75% ethanol (need not blow and beat resuspended, soak get final product);
J) the centrifugal 10000rpm of room temperature, 3min;
K) carefully remove ethanol, exhaust residual droplets;
1) stink cupboard dries 10min;
M) 50ul is preheated to 60 ℃ ddH
2The O dissolving is put 60 ℃, 30min;
N) 4 ℃ of preservations.
O) get said gene group DNA1ul as template, utilize U6 promoter primer pcr amplification to go out the U6 promotor, preserve and-20 ℃ behind the purifying.
Two, utilize repeatedly the mode of PCR to anneal synthetic HJV interference fragment (Seq ID No.3 and Seq ID No.4), PAGE glue purification annealing product.Utilize purified product and the people U6 promotor that obtains in advance to carry out the PCR reaction again, obtain the U6+HJVi segment, the glue purification product, concrete steps are following:
1. set up 1
StThe PCR system
5ul 10xbuffer
6ul 2.5mM?dNTP
1ul 50mM?MgSO4
0.05nM template strand Seq ID No.3
0.05nM coding strand Seq ID No.4
0.5ul high-fidelity polysaccharase
Complement to 50ul with tri-distilled water, put on ice after 5 minutes, put into the PCR appearance, 35 circulations of increasing.
2. system 12%1x TAE polyacrylamide gel is got the above-mentioned PCR product of 10ul and is run glue 200V1h.The band about 80bp is downcut in EB dyeing back, puts and boils in the 50ul tri-distilled water 5 minutes.
3. set up 2
NdThe PCR system
5ul 10xbuffer
6ul 2.5mM?dNTP
1ul 50mM?MgSO4
0.05nM U6 promotor upstream primer
0.05nM coding strand Seq ID No.4
0.5ul high-fidelity polysaccharase
The U6 promotor of 2ul purifying
1ul 1
StPcr amplification product
Complement to 50ul with tri-distilled water, put on ice after 5 minutes, put into the PCR appearance, 35 circulations of increasing.
4. get 5ul2
NdThe PCR product runs agarose electrophoresis, downcuts the band of 420bp, utilizes test kit (invitrogen) purified product.
Three, enzyme is cut purified product and the PLT lentiviral vectors (the PLT carrier system is a kind of of SIN Virus Type) in (XbaI and XhoI) above-mentioned second step; After glue purification reclaims; Be connected 24 hours with room temperature with the T4 ligase enzyme, after transformation and selection, obtain correctly clone.Send the order-checking of Invitrogen company to identify called after PLT-HJVi system.The concrete operations step is following:
1. make up the plasmid enzyme restriction system
XbaI 10U
XhoI 10U
10xBuffer 5ul
BSA 0.5ul
PLT plasmid 10ul
Water is supplied 50ul, and 37 ℃, 2h.
2. make up 2
NdPCR product enzyme is cut system
XbaI 10U
XhoI 10U
10x?Buffer 5ul
BSA 0.5ul
2
NdPCR product 30ul
Water is supplied 50ul, and 37 ℃, 2h.
3. utilize the above-mentioned enzyme of test kit (invitrogen) glue purification to cut product respectively.
4. structure connected system
10x?Buffer 2ul
T4 ligase enzyme 1ul
The PLT enzyme is cut product 1ul
The 2ndPCR enzyme is cut product 5ul
Water is supplied 20ul, and 16 ℃, 16h.
5. get 5ul and connect product transformed competence colibacillus cell, behind the coated plate, the penbritin screening.
6. the picking sun is cloned, and plasmid in a small amount increases.
7. cut the evaluation plasmid with xbaI and XhoI enzyme, select the positive findings plasmid, order-checking is preserved.
Embodiment 3
The Production Flow Chart of recombinant slow virus PLT-HJVi
1, inoculation 293T cell 1.5X10
7Individual cell in 9cm petridish (Coming), 37 ℃, 5%CO
2Overnight cultures;
2, transfection renewed bright substratum in preceding 20 minutes;
3, according to the ratio of 9:8:1 the PLT-HJVi plasmid is mixed with slow virus packaging plasmid P8.2 and P-VSV (all available from Invitrogen company);
4, get above-mentioned plasmid mixture of 20ul and DMEM substratum 500ul mixing, be labeled as the A pipe, other gets 20ul liposome and 500ul DMEM substratum mixing, is labeled as the B pipe.With A pipe and B pipe mixing, room temperature is placed 30min, mixture is added gently in the substratum of the 9cm petridish in the 1st step overnight cultures;
5, adding the 7.5ml substratum after 24 hours continues to cultivate 48 hours;
6, collecting cell supernatant and with 0.45um filter filtration, cell can enlarged culturing, continue to collect viral supernatant.
7, measure viral supernatant titre, adjust cell titer to 1000VP/ml with PH8.0Tris-HCl.
8, be packaged into (every bottle contains 1ml) in the 2ml cillin bottle, be stored in-80 ℃.
9, virus is carried out thermal source detection, microorganism detection, guaranteeing does not have thermal source, and no bacterium, fungi, wild virus pollute.
Embodiment 4
Recombinant slow virus PLT-HJVi experiment in vitro
Recovery neuronal cell strain P12 is inoculated in 6 orifice plates, every hole 1X10
6Individual.Get PLT-HJVi slow virus liquid, the ratio that adds 1ul virus liquid (1000VP/ml) according to every milliliter of substratum adds in the P12 cell culture medium, gently left and right sides mixing; With abundant cells infected strain; Handle 0h, 6h, 12h, 24h, 48h respectively, collecting cell utilizes the real-time round pcr to carry out quantitatively determined HJV mRNA expression; With 0h is control group, and the 12h that is expressed in of visible HJV receives obvious suppression afterwards.Like Fig. 4.
Recovery neuronal cell strain P12 is inoculated in 6 orifice plates, every hole 1X10
6Individual.Utilize PLT-HJVi slow virus infection cell strain; Handle 0h, 6h, 12h, 24h, 48h respectively, collecting cell utilizes the western-blot technology to carry out the expression that quantitatively determined iron is transferred plain hepcidin; With 0h is control group, and the 12h that is expressed in of visible hepcidin obviously raises afterwards.Like Fig. 5.
Embodiment 5
Experiment in the recombinant slow virus PLT-HJVi body
Select male female each 10 of 3 monthly age SD rats, be divided into two groups at random by sex, two groups of experimental rats were all fed 3 months with high ferro feed (available from SIGMA), made up high serum levels of iron rat model, and measured serum iron.
Afterwards, experimental group injection PLT-HJVi virus liquid, each dosage is 500ul virus liquid (1000VP/ml), injects once in per 3 days, 3 times is a course of treatment; Control group injection PBS isotonic saline solution;
After finishing for one course of treatment,, utilize the serum biochemistry appearance to measure serum iron by ordinary method respectively at 3,6,9,12,15,18 days extraction serum.
The result finds that since the 6th day, virus group serum iron began decline, reaches the normal serum iron level in 12 days.Like Fig. 6.
Above content is to combine concrete preferred implementation to the further explain that the present invention did, and can not assert that practical implementation of the present invention is confined to these explanations.For the those of ordinary skill of technical field under the present invention, under the prerequisite that does not break away from the present invention's design, can also make some simple deduction or replace, all should be regarded as belonging to protection scope of the present invention.Can be implemented among the present invention too with the dna profiling of the corresponding shRNA of the little interferential RNA of every other 19-27 base sequence of the mRNA reverse complemental of HJV, this type of little interferential RNA of encoding and the recombinant slow virus that contains these dna profilings.
Sequence table
< 110>Qian Zhongming
Ge Xiaohu
Ke Ya
Wang Chengyuan
< 120>suppress iron and transfer plain regulate proteic RNA interference, recombinant slow virus and application thereof
<130>0710199PJE
<160>4
<170>PatentIn?version3.3
<210>1
<211>21
<212>RNA
< 213>oligonucleotide
<400>1
<210>2
<211>21
<212>RNA
< 213>oligonucleotide
<400>2
<210>3
<211>89
<212>DNA
< 213>oligonucleotide
<400>3
<210>4
<211>89
<212>DNA
< 213>oligonucleotide
<400>4
Claims (10)
1. one kind is suppressed the little interferential RNA that iron transfers plain adjusting albumen HJV to express, and it is characterized in that: said little interferential RNA is following sequence:
Seq?ID?No.1：5’-CAAUCUUCCUGCAGCCUUUGA-3’
Seq?ID?No.2：3’-GUUAGAAGGACGUCGGAAACU-5’
2. the DNA of the shRNA that encodes, it is characterized in that: said shRNA contains the positive-sense strand of the described little interferential RNA of claim 1 and the shRNA of antisense strand.
3. the DNA of a kind of shRNA that encodes according to claim 2 is characterized in that: said DNA also contains U6 promotor and PolyA termination message sequence.
4. the DNA of a kind of shRNA that encodes according to claim 2 is characterized in that: said DNA contains the sequence shown in the Seq ID No.3 in the ordered list.
5. the DNA of a kind of shRNA that encodes according to claim 4 is characterized in that: said DNA is a double-stranded DNA, and template strand is the sequence shown in the Seq ID No.3 in the sequence table, and coding strand is the sequence shown in the Seq ID No.4 in the sequence table.
6. one kind is suppressed the recombinant slow virus that iron transfers plain adjusting albumen HJV to express, and it is characterized in that: said recombinant slow virus contains any described DNA and lentiviral vectors in the claim 2～5.
7. a kind of iron that suppresses according to claim 6 is transferred the plain recombinant slow virus of regulating protein expression, and it is characterized in that: said lentiviral vectors is self inactivation lentiviral vectors SIN.
8. any described DNA is used for treating the application of the medicine of iron metabolism disorders in the claim 2～5 in preparation.
9. claim 6 or 7 described recombinant slow virus are used for treating the application of the medicine of iron metabolism disorders in preparation.
10. the described little interferential RNA of claim 1 is used for treating the application of the medicine of iron metabolism disorders in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100753608A CN101307085B (en) | 2007-08-01 | 2007-08-01 | SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100753608A CN101307085B (en) | 2007-08-01 | 2007-08-01 | SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101307085A CN101307085A (en) | 2008-11-19 |
| CN101307085B true CN101307085B (en) | 2012-06-13 |
Family
ID=40123786
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100753608A Expired - Fee Related CN101307085B (en) | 2007-08-01 | 2007-08-01 | SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101307085B (en) |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101875931B (en) * | 2009-04-28 | 2013-06-12 | 香港理工大学深圳研究院 | siRNA recombinant slow virus for inhibiting human hephaestin gene expression and application |
| KR102035357B1 (en) * | 2011-01-19 | 2019-10-23 | 페루맥스 파마수티컬스, 인코포레이티드 | Compositions for regulating iron homeostasis and methods of using same |
| CN103169948B (en) * | 2011-12-22 | 2019-10-25 | 中国科学院上海生命科学研究院 | Adjustment effect and its application of the hepcidin regulatory protein to immunity of organism |
| SG11201507226YA (en) | 2013-03-15 | 2015-10-29 | Protagonist Therapeutics Inc | Hepcidin analogues and uses therof |
| CN103251932A (en) * | 2013-04-17 | 2013-08-21 | 钱忠明 | Application of hepcidin in preparation of medicine for treating iron-associated neurodegenerative diseases |
| RS62392B1 (en) | 2014-05-16 | 2021-10-29 | Protagonist Therapeutics Inc | Alpha4beta7 integrin thioether peptide antagonists |
| CN107075574A (en) * | 2014-06-27 | 2017-08-18 | 领导医疗有限公司 | Hepcidin and Mini-hepcidin analog and application thereof |
| SG11201700327WA (en) | 2014-07-17 | 2017-02-27 | Protagonist Therapeutics Inc | Oral peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory bowel diseases |
| AU2015328002A1 (en) | 2014-10-01 | 2017-04-27 | Protagonist Therapeutics, Inc. | Novel alpha4beta7 peptide monomer and dimer antagonists |
| US10787490B2 (en) | 2015-07-15 | 2020-09-29 | Protaganist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| WO2017117411A1 (en) | 2015-12-30 | 2017-07-06 | Protagonist Therapeutics, Inc. | Analogues of hepcidin mimetics with improved in vivo half lives |
| CA3089868A1 (en) | 2018-02-08 | 2019-08-15 | Protagonist Therapeutics, Inc. | Conjugated hepcidin mimetics |
| AU2020311395A1 (en) | 2019-07-10 | 2022-02-03 | Protagonist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| BR112022013957A2 (en) | 2020-01-15 | 2022-10-11 | Janssen Biotech Inc | PEPTIDE INTERLEUKIN-23 RECEPTOR INHIBITORS AND THEIR USE TO TREAT INFLAMMATORY DISEASES |
| CN111647083B (en) * | 2020-04-28 | 2022-06-03 | 武汉百杰康生物科技有限公司 | Recombinant mouse anti-human hemojulin monoclonal antibody, preparation method and application |
| JP7397239B2 (en) | 2020-11-20 | 2023-12-12 | ヤンセン ファーマシューティカ エヌ．ベー． | Compositions of peptide inhibitors of interleukin-23 receptors |
-
2007
- 2007-08-01 CN CN2007100753608A patent/CN101307085B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| lan lin等.Competitive regulation of hepcidin mRNA by soluble and cell-associated hemojuvelin.《Blood》.2005,第106卷(第8期),2884-2889. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101307085A (en) | 2008-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101307085B (en) | SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof | |
| Zhou et al. | miR-30a negatively regulates TGF-β1–induced epithelial-mesenchymal transition and peritoneal fibrosis by targeting Snai1 | |
| US8962583B2 (en) | Treatment of inflammatory diseases using miR-124 | |
| CN108368487A (en) | The excretion body of nucleic acid is packed | |
| CN101842381A (en) | Composition of asymmetric RNA duplex as microrna mimetic or inhibitor | |
| Israsena et al. | Inhibition of rabies virus replication by multiple artificial microRNAs | |
| US20090136544A1 (en) | Interfering RNAs Targeting the Morbillivirus Nucleoprotein Gene | |
| CN103667286B (en) | The siRNA of Schistosoma japonicum PGMRC2 gene and application thereof | |
| CN103740722A (en) | shRNA (short hairpin ribonucleic acid) inhibiting retinal pigment epithelium apoptosis and application thereof | |
| CN110129319B (en) | siRNA of PRALR and application thereof | |
| KR20140046339A (en) | Method for differentiation into retinal cells from stem cells using inhibition of mirna-203 | |
| US11155819B2 (en) | Double-stranded RNA molecule targeting CKIP-1 and use thereof | |
| CN108517335B (en) | A kind of Lentiviral and its construction method of liver cell miR-199b low expression | |
| CN101538569B (en) | RNA and recombinant for inhibiting human DMT1 protein and application thereof | |
| CN101921763B (en) | siRNA capable of inhibiting expression of PAR-1 gene and application thereof | |
| CN104745635B (en) | A kind of method of OASL genes in silence DF-1 cell lines | |
| WO2023145884A1 (en) | SARS-CoV-2-DERIVED POLYNUCLEOTIDE AND USE THEREOF | |
| CN114574486B (en) | siRNA, DNA, construct and application acting on OPLAH | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN101875931B (en) | siRNA recombinant slow virus for inhibiting human hephaestin gene expression and application | |
| CN103103189A (en) | Novel method for overexpression of single MicroRNA (Micro Ribonucleic Acid) mature body sequence | |
| CN102604994B (en) | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector | |
| CN101538568B (en) | RNA and recombinant for inhibiting human ferroportin and application thereof | |
| CN116622652A (en) | Lentivirus for neuroblastoma gene therapy and preparation method and application thereof | |
| CN101532013A (en) | RNA for inhibiting Hepcidin, recombinant and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: HONG KONG POLYTECHNIC UNIVERSITY SHENZHEN INSTITUT Free format text: FORMER OWNER: QIAN ZHONGMING Effective date: 20100108 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20100108 Address after: A216 room, Shenzhen Virtual University Park, Nanshan District Science Park, Guangdong, Shenzhen Province, China: 518057 Applicant after: Shenzhen Inst., Hongkong Science &. Engineering Univ. Address before: Postal code of R2-A6 building, Nanshan District science and Technology Park, Shenzhen, Guangdong, China: 518057 Applicant before: Qian Zhong Ming Co-applicant before: Ge Xiaohu Co-applicant before: Ke Ya Co-applicant before: Wang Chengyuan |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120613 Termination date: 20140801 |
|
| EXPY | Termination of patent right or utility model |