CN102604994B

CN102604994B - Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector

Info

Publication number: CN102604994B
Application number: CN201210055624.4A
Authority: CN
Inventors: 党宁宁; 逄曙光; 马晓丽; 边红; 初晶学
Original assignee: Individual
Current assignee: Individual
Priority date: 2012-03-06
Filing date: 2012-03-06
Publication date: 2014-03-26
Anticipated expiration: 2032-03-06
Also published as: CN102604994A

Abstract

The invention relates to a recombinant lentivirus-based vector for implementing the RNA (Ribose Nucleic Acid) interference aiming at an FLG (filaggrin) gene and preparation of the recombinant lentivirus-based vector. A lentivirus-based vector of shRNA (shorthairpin RNA) aiming at the FLG gene is constructed through experiments; a synthesized DNA fragment aiming at the ShRNA is mediated by the lentivirus-based vector; 293T cells are subjected to co-transfection together by the lentivirus-based vector and two vectors pHelper1.0 and pHelper2.0 to carry out culture; and after the recombinant lentivirus-based vector is obtained, target cells are subjected to transfection so as to implement the RNA interference aiming at the FLG gene. The adopted self-inactivated third-generation lentivirus-based vector has the advantages of safety, reliability, capability of infecting nondividing cells, long-term expression of integrating a target gene to a target cell gene, small immune response and the like and is an ideal vector. The lentivirus-based vector disclosed by the invention has the interference effect reaching 75 to 95 percent on normal skin cells HACAT of people, and thus, the recombinant lentivirus-based vector disclosed by the invention lays a good experimental foundation for further research related to the FLG gene and can be widely used for the in-vivo gene therapy and the gene functional research.

Description

A kind of recombined lentivirus vector and preparation thereof of disturbing for FLG gene RNA

Technical field

The invention belongs to molecular biology, biological medicine and gene engineering technology field, relate generally to RNA interference recombinant lentivirus vector (LV-sh-FLG) and preparation thereof for silk polymeric protein (filaggrin, FLG) gene.

Background technology

Atopic dermatitis (atopic dermatitis, AD), is a kind of relevant with heredity, complicated, itch, chronic inflammatory diseases dermatoses.The cause of disease of AD and pathogenesis are complicated, lack the treatment means of special efficacy, have a strong impact on infant and grownup's quality of life.Think that at present the characteristic clinical of AD is tumor susceptibility gene, environmental factors, defective skin barrier function, the common interactional result of crucial immunological abnormality.In recent years, the effect of genetics in the pathogeny of AD becomes study hotspot.Relevant susceptible regional study has obtained progress to a certain degree in recent years.Recently, a lot of research finds that silk polymeric protein gene (filaggrin gene, FLG) sudden change is relevant with the morbidity of AD.In the gene studies of relevant ordinary type ichthyosis (IV), the karyomit(e) 1q21 of Epidermal differentiation complex (EDC) is identified, and depict the drafting figure of the Epidermal differentiation complex on karyomit(e) 1q21 of several IV familys, strengthened FLG and may be one have potential sudden change may be pathogenic this viewpoint of candidate gene.On this basis, the scholars of European Section in 2006 find the dependency of FLG and AD morbidity, and FLG is also a tumor susceptibility gene of AD.And confirmed in research from now on.

Silk polymeric protein (filaggrin, FLG) be mammalian epidermis cytodifferentiation a kind of cationic protein of end stage generation eventually, 1993 by the first successful and partial purification separated by people's epidermis such as Simon, it and the interaction such as Keratin sulfate, formation eukaryotic cell skeleton.The encoding gene FLG of mankind's silk polymeric protein is positioned at 1q21, comprise 3 exons, the equal coded protein not of exon1 (15bp) and exon2 (159bp) wherein, exon3 (12753bp) encode most tumor-necrosis factor glycoproteins and N-end, mainly 10～12 silk polymeric protein tumor-necrosis factor glycoproteinss that are about 1kb, consist of, the similarity of these tumor-necrosis factor glycoproteinss approaches 100%.Silk polymeric protein is an important constitutive protein of the cuticular cutin coating of epiderm skin (CE), and CE is the basis that forms epidermis mechanicalness defensive barrier, so the disappearance that filagghn expresses is relevant with xerosis cutis with minimizing.It will affect cuticular osmosis, causes the decline of water content of stratum corneum, also affects the ability that stops loss of moist simultaneously, causes the increase of epidermis loss of moist amount, causes xerosis cutis.Filaggrin plays an important role in epidermal barrier function, is also the abnormal one of the main reasons of AD skin barrier function.Many researchers has been studied FLG encoding mutant and has been caused contacting between stratum corneum barrier function disappearance and AD in recent years.The skin barrier function obstacle that FLG transgenation causes is being played the part of key player in AD morbidity, yet FLG transgenation has race and regional difference.R501X, 2282del4, R2447X, S3247X and 3702delG are the main mutational sites of European AD crowd FLG gene; And in Japanese AD crowd, S2554X, 3321delA, S2889X and S3296X are its main susceptibility loci; And R501X sudden change is only found in the research about Chinese AD crowd FLG in Hong Kong in 4 routine male patients.

It is the conventional means of inhibition of gene expression that RNA disturbs (RNA interference, RNAi) technology, is again gene silencing.When the principle that RNA disturbs is the double-stranded RNA importing when cell in endogenous mRNA coding region homology, this mRNA occurs to degrade and causes the phenomenon of genetic expression silence.

RNA interfering process mainly contains two steps: one, double-stranded RNA is cut into the short dsrna of 21-23 base pair by the specific nuclease of cell source double-stranded RNA, i.e. siRNA (smallinterference RNA, siRNA); Two, the antisense strand of siRNA and nuclease have formed reticent mixture (RNA-induced silencing complex, RISC), and this complex body has identification in conjunction with having the mRNA of homologous sequence with siRNA, and at specific site, this mRNA is cut off.RNA perturbation technique is widely used at present in gene therapy and research, and those prove that effective siRNA/shRNA itself can be developed further into the medicine into RNAi in target experiment simultaneously.ShRNA (shorthairpin RNA) is that short hairpin RNA comprises two short inverted repeats, and one of them and goal gene are complementary, and middle loop sequence is separated and formed hairpin structure.ShRNA is processed to the siRNA goal gene of effectively degrading and suppresses its expression in vivo.But this technology to be applied to clinical treatment, need to solve RNA interference fragment and express the major issues such as lasting and expression efficiency.

The carrier of gene therapy at present mainly contains non-virus carrier and virus vector, yet non-virus carrier cannot meet long expression, and this defect is filled up by virus vector undoubtedly.The RNA perturbation technique of lentivirus mediated has been obtained good start under study for action in recent years.Lentiviral vectors (lentivirus-based vector, LV) be retroviral a kind of, have retroviral basic structure, but have different retroviral component characteristics, this virus not only can transfection somatoblast but also can transfection Unseparated Cell.Viral genome can be integrated in host, makes the stable expression of gene length time, and slow virus has lower immunogenicity, and this makes slow virus become the optimum carrier that RNA disturbs, and is widely used at present the fields such as gene expression regulation, gene therapy.The third generation replication defect type lentiviral vectors that we select is suicide venereal disease poison, in vivo can longer expression and safe, can solve the problems such as targeting, security, integration efficiency of RNA perturbation technique gene therapy.Therefore RNA interference effect long-term existence in target cell of lentivirus-mediated, can be better performance interference effect and creates conditions.

Summary of the invention

An object of the present invention is to provide a kind of recombined lentivirus vector disturbing for FLG gene RNA, it is the third generation lentiviral vectors of self inactivation, it is characterized in that, described carrier is containing PGLV/H1/GFP-sh FLG recombinant vectors, and described PGLV/H1/GFP-sh FLG recombinant vectors is to have connected double chain DNA fragment in the multiple clone site of PGLV/H1/GFP carrier; The sequence of described double chain DNA fragment is a kind of (wherein S represents positive-sense strand, and AS represents antisense strand) in following sequence:

(1)FLG-homo--274：

FLG-homo-274-S：

5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’

FLG-homo-274-AS：

5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’

(2)FLG-homo-769：

FLG-homo-769-S：

5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’

FLG-homo-769-AS：

5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’

(3)FLG-homo-1627：

FLG-homo-1627-S：

5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’

FLG-homo-1627-AS：

5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’

Another object of the present invention is to provide the preparation method of the described recombined lentivirus vector disturbing for FLG gene RNA, it is characterized in that, according to FLG mRNA sequence, double chain DNA fragment has been synthesized in design, and described double chain DNA fragment is a kind of in following sequence:

(1)FLG-homo--274：

FLG-homo-274-S：

5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’

FLG-homo-274-AS：

5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’

(2)FLG-homo-769：

FLG-homo-769-S：

5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’

FLG-homo-769-AS：

5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’

(3)FLG-homo-1627：

FLG-homo-1627-S：

5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’

FLG-homo-1627-AS：

5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’

Then described DNA fragmentation is connected in the multiple clone site of PGLV/H1/GFP carrier and is built into PGLV/H1/GFP-shFLG recombinant vectors; By PGLV/H1/GFP-sh FLG recombinant vectors, pHelper1.0,2.0 3 kinds of carrier cotransfection 293T cell cultures of pHelper, obtain described recombined lentivirus vector again.

As preferably, at described double chain DNA fragment end, introduce BamH I and EcoR I restriction enzyme site.

As preferably, with BamH I and EcoRI enzyme, PGLV/H1/GFP carrier enzyme is cut to transformed competence colibacillus bacterium after after recovery large fragment, it being connected with described double chain DNA fragment, picking recombinant clone.

This carrier is transfectional cell or the tissue expression of specificity reduction FLG gene afterwards effectively, thereby may be applied to gene therapy or gene functional research.PGLV/H1/GFP-sh FLG most important characteristics provided by the invention is to provide targeting FLG gene inhibition effect, and with recombined lentivirus vector as carrier, make interference effect obtain persistence effect.Whole preparation process is all used plasmid, avoids traditional method adenovirus to pollute.The present invention is by the most effective FLG interference sequence of screening, and synthetic its double-stranded DNA, is connected in slow virus skeleton plasmid carrier, with helper plasmid cotransfection instrument cell 293T cell, prepares FLG interference recombinant lentivirus vector: PGLV/H1/GFP-sh FLG.

Usefulness of the present invention is:

1, the PGLV/H1/GFP carrier that the present invention adopts can be in host cell continuous expression have the little RNA of interference effect.This plasmid can be expressed the fluorescin GFP by CMV promoters driven simultaneously, transfection efficiency during convenient virus packing, and the detection of the efficiency of infection of host cells infected.The gag gene that contains HIV virus in pHelper 1.0 plasmids, the structural protein that coding virus is main; Pol gene, the enzyme of coding virus-specific; Rev gene, the regulatory factor of coding and regulating gag and pol genetic expression.The VSVg gene that contains hsv source in pHelper 2.0 plasmids, provides virus packing needed capsid protein.Above three kinds of carrier corotation are entered to the third generation lentiviral vectors that 293T cell can efficiently be assembled self inactivation, two security features have been increased: one has built the lentiviral vectors of self inactivation, delete the 3 ' LTR in LiaoU3 district, make carrier lose HIV-1 enhanser and promoter sequence, even if exist all viral proteins can not transcribe out RNA.Second feature is to have removed tat gene to replace allogeneic promoter sequence, original like this HIV gene, and 9 genes in group have only retained 3 (gag, pol and rev) in the HIV lentiviral vectors building.Therefore third generation HIV slow virus carrier system is safer.

2, the present invention is directed to FLG target gene and design four effective interference sequences according to online principle, slow virus interference carrier system constructing packing by restructuring obtains PGLV/H1/GFP-sh FLG, by detecting FLG mrna expression in target cell, filter out the most effective interference fragment, not only overcome the low transfection efficiency of non-virus carrier, also the immunogenicity of having avoided recombinant adenovirus to produce, the shortcomings such as expression time is shorter, the lentiviral vectors of this restructuring is " suicide " virus, safer, can be incorporated in host's genome and stably express, can not cause inserting inactivation, make interference effect more lasting, have and can infect Unseparated Cell, goal gene is integrated into target cell gene group leader time-histories and expresses, the advantages such as immune response is little, for good experiment basis is established in the further research of relevant FLG gene, and can be widely used in vivo gene treatment and gene functional research.

Accompanying drawing explanation

Fig. 1 is slow virus skeleton plasmid PGLV/H1/GFP carrier structure schematic diagram.

Fig. 2 is that slow virus is infected 293T cell 72h (96 orifice plate) picture (fluorescence).

Fig. 2 A is that C721 infects picture (200 *) after 293T 72h;

Fig. 2 B is that C722 infects picture (200 *) after 293T 72h;

Fig. 2 C is that C723 infects picture (200 *) after 293T 72h;

Fig. 2 D is that NC infects picture (200 *) after 293T 72h.

Fig. 3 is that slow virus is infected HACAT cell 72h (6 orifice plate) picture (fluorescence, visible ray).

Fig. 3 A is that C721 infects picture (200 *) after HACAT cell 72h;

Fig. 3 B is that C722 infects picture (200 *) after HACAT cell;

Fig. 3 C is that C723 infects picture (200 *) after HACAT cell;

Fig. 3 D is that NC infects picture (200 *) after HACAT cell.

Fig. 4 is Real-timePCR amplification curve.

Fig. 4 A is that NC infects GAPDH and FLG gene amplification curve after HACAT 72h;

Fig. 4 B is not for carrying out GAPDH and FLG gene amplification curve after the HACAT 72h of virus infection;

Fig. 4 C is that C721 infects GAPDH and FLG gene amplification curve after HACAT 72h;

Fig. 4 D is that C722 infects GAPDH and FLG gene amplification curve after HACAT 72h;

Fig. 4 E is that C723 infects GAPDH and FLG gene amplification curve after HACAT 72h;

Fig. 5 is Real-timePCR amplified production electrophorogram.

Wherein 1-11 swimming lane is respectively: molecular weight marker, GAPDH-B, GAPDH-NC, GAPDH-C721, GAPDH-C722, GAPDH-C723, FLG-B, FLG-NC, FLG-C721, FLG-C722, FLG-C723.

Fig. 6 is that PGLV/H1/GFP-sh FLG is to FLG genetic expression interference effect picture in HACAT cell.

NC, adds the groups of cells 72h sample of negative control virus infection;

B, does not infect the groups of cells 72h sample of any virus;

C721, adds the groups of cells 72h sample of FLG-homo-274 virus infection;

C722, adds the groups of cells 72h sample of FLG-homo-769 virus infection;

C723, adds the groups of cells 72h sample of FLG-homo-1627 virus infection.

Embodiment

The present invention is further described in conjunction with the accompanying drawings and embodiments.

Embodiment 1: the lentiviral vectors for gene FLG builds

1, the design of oligonucleotide and synthetic

Utilize the online RNAi Series Design software BLOCK-iT RNAi Designer of Invitrogen company, design is for 3 interference target sequences (seeing table) of FLG gene mRNA sequence (NM-002016.1), and synthetic corresponding double-stranded DNA (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Loop structure in LV3-shRNA template has selected TTCAAGAGA to avoid forming termination signal.5 ' end of positive-sense strand template has added GATCC, and the cohesive end of cutting rear formation with BamHI enzyme is complementary; 5 ' end of antisense strand template has added AATTC, and the cohesive end of cutting rear formation with EcoRI enzyme is complementary.

Sequence code	Sequence title	Target sequence
			C721	FLG-homo-274	GTTGGCTCAAGCATATTATTT
C722	FLG-homo-769	CACCACTGATAGTCTATTATT
			C723	FLG-homo-1627	CCACGAGCAATCGGTAAATTT

Double-stranded DNA answer print segment information is separately as follows:

(1)FLG-homo-274：

FLG-homo-274-S：

5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’

FLG-homo-274-AS：

5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’

(2)FLG-homo-769：

FLG-homo-769-S：

5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’

FLG-homo-769-AS：

5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’

(3)FLG-homo-1627：

FLG-homo-1627-S：

5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’

FLG-homo-1627-AS：

5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’

The shDNA with above-mentioned sequence can produce respectively following transcripton in vivo after transcribing, self match and form the double-stranded RNA with loop structure, enzyme Dicer through specific recognition double-stranded RNA, the mode relying on ATP is progressively cut into the small molecules interference RNA fragment (small interfering RNAs, siRNA) of 21～23nt.

(1) FLG-homo-274 transcripton:

GTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTT

(2) FLG-homo-769 transcripton:

GCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTT

(3) FLG-homo-1627 transcripton:

GCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTT

In the effective stage, the double-stranded formation RNA of being combined with ribozyme mixture of siRNA induces reticent mixture (RNA-induced silencing complex, RISC).RISC activates in ATP dependency mode, siRNA sex change in RISC, and two strands is untied, unload positive-sense strand, antisense strand is still combined on mixture, and guides RISC to be combined with the target RNA of homology, under the effect of endonuclease, said target mrna is cut off, thereby reach the effect that blocking gene is expressed.

2, the annealing of LV3-shDNA template

Use respectively TE (pH8.0) to dissolve synthetic double chain DNA fragment, concentration is 100uM.Get corresponding positive-sense strand and antisense strand oligomer solution, according to following proportioning configuration annealing reaction system.

Component	Volume (ul)
		10 * shDNA annealing buffer (1M NaCl, 0.5M Hepes, pH7.4)	5
Positive-sense strand (100uM)	5
		Antisense strand (100uM)	5
Distilled water	35
		Total amount	50

On PCR instrument, according to following program, carry out anneal: 95 ℃ 5 minutes; 85 ℃ 5 minutes; 75 ℃ 5 minutes; 70 ℃ 5 minutes; 4 ℃ of preservations.After anneal, obtaining concentration is the shDNA template of 10 μ M.By 50 times of gained template solution dilutions, final concentration is 200nM, for ligation.

3, the linearizing of LV3 carrier

Get 5ug LV3 carrier, utilize the BamHI of NEB company and EcoRI restriction enzyme and conventional double digestion system to cut 1 hour in 37 ℃ of enzymes, agarose electrophoresis, use agarose gel DNA purification kit (TaKaRa company) to reclaim linearizing carrier segments, electrophoresis detection estimated concentration, weaker concn is to 50ng/ul.

4, the structure of LV3-shRNA carrier

1) according to following system, carry out the ligation of carrier:

Component	Volume (ul)
		10 * T4 connects damping fluid	2
LV3 carrier (BamHI+EcoRI double digestion)	1
		ShDNA template (100nM)	1
T4DNA ligase enzyme (5weissU/ul)	1
		Distilled water	15
Total amount	20

22 ℃ connect 1hr, are converted into JM 109 competent cells.

2) 5 bacterium colonies of each ligation picking, the LB being inoculated into containing 50ug/ml penbritin cultivates concentrated, the bacterium liquid shaking out is chosen at random 2 and is sent to order-checking, the bacterial strain that checks order correct adopts in high purity plasmid and measures extraction agent box (Shanghai JiMa pharmacy Technology Co., Ltd) extracting, and gained plasmid can be for conventional molecular biology experiment and cytologic experiment.If cytotoxicity is larger when for cell transfecting, can again be converted in bacillus coli DH 5 alpha, then by test kit or CsCl ultracentrifugation, prepare more high purity plasmid.

Being coated with of embodiment 2:FLG gene RNA interference recombinant lentivirus

Draw the recombinant virus plasmid PGLV/H1/GFP-sh FLG (20 μ g) that high purity prepares without intracellular toxin extracting, helper plasmid pHelper1.0 (15 μ g) and pHelper 2.0 (10 μ g), carry out cotransfection 293T cell by Invitrogen company Lipofectamine 2000 operation instructions.

After transfection, 8h is replaced by perfect medium, in 37 ℃, 5%CO ₂in incubator, continue to cultivate after 48h, collect the cell conditioned medium liquid that is rich in slow virus particle.4 ℃, after 4000g removes cell debris in centrifugal 10 minutes and to obtain slow virus with 0.45 μ M filter filtering supernatant standby, can meet general test cell line.If obtain the slow virus concentrated solution that the slow virus of higher concentration obtains high titre after can be further concentrated and purified to it, packing virus concentrated solution-80 ℃ long-term preservation, gets wherein one and carries out according to the following steps viral biology titer determination.

When 1.293T cell is cultured to 80-90% fusion in 6cm culture dish, the nutrient solution that inclines, uses twice, 3ml D-Hank ' s solution washing cell.

2. add 1ml Trypsin-EDTA solution (0.05%, Gibco), after mixing, carefully suck pancreatin solution, place 3-5 minute for 37 ℃.

3. add 2ml to contain the DMEM nutrient solution of 10%FBS, piping and druming makes cell form single cell suspension again.

4. blood counting chamber is counted, by cell dilution to 3 * 10 ⁵cell/ml.

5. by 3 * 10 ⁴the concentration of cells/well is inoculated 96 orifice plates, after mixing in 37 ℃ of 5%CO ₂cultivate 24h.

6. slow virus stoste (10-20ul) is trained to ten times of dilution 3-5 gradients (according to cell state, can add if necessary final concentration is the Polybrene of 5ug/ml) of liquid with the DMEM of 15%FBS.

7. suck the nutrient solution in 96 orifice plates, every hole adds the virus liquid of 100 μ l dilutions, utilizes Lentivirus-NC virus liquid (Shanghai JiMa pharmacy Technology Co., Ltd, 1 * 10 simultaneously ⁸tU/ml) set up blank group, in 37 ℃ of 5%CO ₂cultivate 24h.

8. inhale and abandon the virus dilution liquid in 96 orifice plates, every hole adds the DMEM training liquid of 150 μ l 15%FBS, and (according to cell state, can separate 1/3-1/5 if necessary) is in 37 ℃ of 5%CO ₂continue cultivation 48,72h.

9. by fluorescent microscope or FACS counting fluorocyte, under fluorescent microscope, by observing GFP, express judgement transfection efficiency (efficiency is approximately more than 80%, referring to Fig. 2), in conjunction with extension rate, calculate virus titer.

By different detection methods, titre has a variety of causes difference to some extent, in process of the test, must note Biosafety requirement.

Embodiment 3: target cell is infected test and the analysis of genetic expression inhibition

1, target cell is infected test

According to the following steps people's normal skin cells HACAT is carried out to virus infection experiment:

1), when HACAT cell is cultured to 80-90% fusion in 10cm culture dish, the nutrient solution that inclines, uses twice, 3ml D-Hank ' s solution washing cell.

2) add 1ml Trypsin-EDTA solution (0.05%, Gibco), after mixing, carefully suck pancreatin solution, place 3-5 minute for 37 ℃.

3) add 2ml DMEM nutrient solution, piping and druming makes cell form single cell suspension again.

4) blood counting chamber counting, by 10 * 10 ⁵the concentration of cells/well is inoculated 6 orifice plates, mixes rear 37 ℃ of 5%CO ₂cultivate 24 hours.

5) by slow virus stoste 200ul, with five times of dilutions of DMEM training liquid of 10%FBS.

6) suck the nutrient solution in 6 orifice plates, every hole adds the virus liquid of above-mentioned 1ml dilution, utilizes Lentivirus-NC virus liquid (Shanghai JiMa pharmacy Technology Co., Ltd, 1 * 10 simultaneously ⁸tU/ml) set up blank group, in 37 ℃ of 5%CO ₂cultivate 24h.

7) inhale and abandon the virus dilution liquid in 6 orifice plates, every hole adds the DMEM training liquid of 1.5ml 10%FBS, and (according to cell state, can separate 1/3-1/5 if necessary) is in 37 ℃ of 5%CO ₂continue to cultivate, under fluorescent microscope, by observing GFP, express judgement transfection efficiency (efficiency is approximately more than 70%, referring to Fig. 3), receive sample after 72h, gained cell detects for Real-timePCR.

2, FLG genetic expression inhibition is analyzed

1) extraction of total RNA

Carry out according to the following steps the extraction of total RNA:

(1) inhale and abandon the nutrient solution in 6 orifice plates, every hole adds 1ml Trizol (Invitrogen).

(2) the rifle head piping and druming of processing with DEPC makes the complete cracking of cell.

(3) lysate is transferred in the 1.5ml EP pipe of DEPC processing, room temperature is placed 10 minutes.

(4) add 200 μ l trichloromethanes (analytical pure), concuss mixes, and room temperature is placed 10 minutes.

(5) 4 ℃ of 12000g centrifugal 10 minutes, draw supernatant liquid to new centrifuge tube, add isopyknic Virahol (analytical pure), precipitation at room temperature 10 minutes.

(6) 4 ℃ of 12000g centrifugal 15 minutes, abandon supernatant.

(7) precipitation by 500 μ l 75% washing with alcohol once.Centrifugal 5 minutes of 4 ℃ of 12000g, reclaim precipitation, abandon supernatant.

(8) normal temperature is inverted and is dried 10 minutes.

(9) with 20 μ l DEPC-H ₂o dissolution precipitation, measures OD ₂₆₀, OD ₂₈₀, calculate RNA concentration.

(10) agarose electrophoresis checks the integrity of RNA.

2) RNA reverse transcription obtains cDNA

Utilize promega test kit (article No. M1701), carry out cDNA synthesize according to operation instruction, general steps is as follows:

(1) in aseptic EP pipe, be formulated as follows system:

Total RNA:2ul

Specificity reverse transcription primer (each 1uM of GAPDH and FLG): 1.2ul

DEPC-H ₂O：11.5ul

(2) 70 ℃ of incubation mixtures 5 minutes, quenching on ice.

(3) add again following composition:

5 * reverse transcription damping fluid: 4ul

10mM dNTPs (every kind of 10mM): 0.8ul

ThermoScript II (MMLV Reverse Transcriptase RNaseH-, 200U/ul, Promega): 100U (0.5ul)

(4) 42 ℃ of incubations 45 minutes.

10 minutes termination reactions of (5) 85 ℃ of heating, quenching on ice, reaction solution is as pcr template.

3, Real-time PCR detects

1) adopt software design Real-time PCR to detect primer, primer sequence information is as follows, by Shanghai JiMa pharmacy Technology Co., Ltd, is synthesized.

2) according to the form below preparation reaction system

Component	Final concentration	Volume
				2 * Real-time PCR Master Mix (the lucky agate in Shanghai)	1×	10μl
F Primer(20uM)	0.1μM	0.1μl
			R Primer(20uM)	0.1μM	0.1μl
CDNA template	-	2μl
			RTaq archaeal dna polymerase (5U/ μ l) (TAKARA)	2.5U/μl	0.4μl
Distilled water		To 20 μ l

3) utilize Mx3000Real-time PCR instrument (Stratagen) to react, reaction conditions: 95 ℃, sex change in 3 minutes; 95 ℃, 30 seconds, 62 ℃, 40 seconds, totally 40 circulations, amplification situation normal (referring to Fig. 4 gene hGAPDH and hFLG amplified production melting curve, and Fig. 5 pcr amplification product electrophorogram).

Using GAPDH gene as internal reference, FLG mRNA content results after each virus infection is processed, and calculate the ratio of FLG mRNA in itself and negative control.Result shows (seeing Fig. 6), the recombinant slow virus FLG-homo-274 disturbing for FLG gene RNA, FLG-homo-769, FLG-homo-1627 all can effectively suppress the expression of FLG gene, the about 75-95% of inhibition, can be used for the research of FLG gene follow-up function.

Claims

1. the recombined lentivirus vector disturbing for FLG gene RNA, it is the third generation lentiviral vectors of self inactivation, it is characterized in that, described carrier is containing PGLV/H1/GFP-Sh FLG recombinant vectors, and described PGLV/H1/GFP-Sh FLG recombinant vectors is to have connected double chain DNA fragment in the multiple clone site of PGLV/H1/GFP carrier; The sequence of described double chain DNA fragment is a kind of in following sequence:

(1)FLG-homo-274：

FLG-homo-274-S：

5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’

FLG-homo-274-AS：

5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’

(2)FLG-homo-769：

FLG-homo-769-S：

5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’

FLG-homo-769-AS：

5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’

(3)FLG-homo-1627：

FLG-homo-1627-S：

5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’

FLG-homo-1627-AS：

5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’。

2. the preparation method of the recombined lentivirus vector disturbing for FLG gene RNA claimed in claim 1, is characterized in that, according to FLG mRNA sequence, double chain DNA fragment has been synthesized in design, and described double chain DNA fragment is a kind of in following sequence:

(1)FLG-homo-274：

FLG-homo-274-S：

5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’

FLG-homo-274-AS：

5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’

(2)FLG-homo-769：

FLG-homo-769-S：

5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’

FLG-homo-769-AS：

5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’

(3)FLG-homo-1627：

FLG-homo-1627-S：

5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’

FLG-homo-1627-AS：

5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’

Then described DNA fragmentation is connected in the multiple clone site of PGLV/H1/GFP carrier and is built into PGLV/H1/GFP-Sh FLG recombinant vectors; By PGLV/H1/GFP-Sh FLG recombinant vectors, pHelper1.0,2.0 3 kinds of carrier cotransfection 293T cell cultures of pHelper, obtain described recombined lentivirus vector again.

3. the preparation method of the recombined lentivirus vector disturbing for FLG gene RNA according to claim 2, is characterized in that, at described double chain DNA fragment end, introduces BamH I and EcoR I restriction enzyme site.

4. the preparation method of the recombined lentivirus vector disturbing for FLG gene RNA according to claim 2, it is characterized in that, with BamHI and EcoRI enzyme, PGLV/H1/GFP carrier enzyme is cut, after reclaiming large fragment, it is connected to rear transformed competence colibacillus bacterium with described double chain DNA fragment, picking recombinant clone.