CN102604994A - Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector - Google Patents
Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector Download PDFInfo
- Publication number
- CN102604994A CN102604994A CN2012100556244A CN201210055624A CN102604994A CN 102604994 A CN102604994 A CN 102604994A CN 2012100556244 A CN2012100556244 A CN 2012100556244A CN 201210055624 A CN201210055624 A CN 201210055624A CN 102604994 A CN102604994 A CN 102604994A
- Authority
- CN
- China
- Prior art keywords
- flg
- homo
- gene
- based vector
- lentivirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a recombinant lentivirus-based vector for implementing the RNA (Ribose Nucleic Acid) interference aiming at an FLG (filaggrin) gene and preparation of the recombinant lentivirus-based vector. A lentivirus-based vector of shRNA (shorthairpin RNA) aiming at the FLG gene is constructed through experiments; a synthesized DNA fragment aiming at the ShRNA is mediated by the lentivirus-based vector; 293T cells are subjected to co-transfection together by the lentivirus-based vector and two vectors pHelper1.0 and pHelper2.0 to carry out culture; and after the recombinant lentivirus-based vector is obtained, target cells are subjected to transfection so as to implement the RNA interference aiming at the FLG gene. The adopted self-inactivated third-generation lentivirus-based vector has the advantages of safety, reliability, capability of infecting nondividing cells, long-term expression of integrating a target gene to a target cell gene, small immune response and the like and is an ideal vector. The lentivirus-based vector disclosed by the invention has the interference effect reaching 75 to 95 percent on normal skin cells HACAT of people, and thus, the recombinant lentivirus-based vector disclosed by the invention lays a good experimental foundation for further research related to the FLG gene and can be widely used for the in-vivo gene therapy and the gene functional research.
Description
Technical field
The invention belongs to molecular biology, biological medicine and gene engineering technology field relate generally to silk polymeric protein (filaggrin, FLG) the RNA interference recombinant lentivirus vector (LV-sh-FLG) of gene and preparation thereof.
Background technology
(atopic dermatitis AD), is a kind of relevant with heredity to atopic dermatitis, complicated, itch property, chronic inflammatory diseases dermatoses.The cause of disease of AD and pathogenesis are complicated, lack the specific treatment means, have a strong impact on infant and adult quality of life.Think that at present the characteristic clinical of AD is tumor susceptibility gene, environmental factors, defective skin barrier function, the common results of interaction of crucial immunological abnormality.In recent years, the genetics effect in the pathogeny of AD becoming research focus.Relevant susceptible regional study has obtained progress to a certain degree in recent years.Recently, (filaggrin gene, FLG) sudden change is relevant with the morbidity of AD much to discover a polymeric protein gene.In the gene studies of relevant ordinary type ichthyosis (IV); The karyomit(e) 1q21 of epidermal differentiation mixture (EDC) is identified; And depict the drafting figure of the epidermal differentiation mixture on karyomit(e) 1q21 of several IV familys, having strengthened FLG possibly be this viewpoint of possible morbific candidate gene that potential sudden change is arranged.On this basis, the scholars of European Section in 2006 find the dependency of FLG and AD morbidity, and FLG also is the tumor susceptibility gene of AD.And in research from now on, be able to confirm.
Silk polymeric protein (filaggrin; FLG) be mammalian epidermis cytodifferentiation a kind of cationic protein of end stage generation eventually; At first successfully separated and partial purification it and interaction such as Keratin sulfate, formation eukaryotic cell skeleton in 1993 through people's epidermis by Simon etc.The encoding sox FLG of human silk polymeric protein is positioned at 1q21; Comprise 3 exons; The equal coded protein not of exon1 (15bp) and exon2 (159bp) wherein; Exon3 (12753bp) most Tumor-necrosis factor glycoproteins of coding and N-are terminal, mainly are made up of 10～12 silk polymeric protein Tumor-necrosis factor glycoproteinss that are about 1kb, and the similarity of these Tumor-necrosis factor glycoproteinss is near 100%.The silk polymeric protein is an important constitutive protein of the cuticular cutin coating of epiderm skin (CE), and CE is the basis that forms epidermis mechanicalness defensive barrier, so the disappearance that filagghn expresses is relevant with xerosis cutis with minimizing.It will influence cuticular osmosis, causes the decline of stratum corneum water cut, also influences the ability that stops loss of moist simultaneously, causes the increase of epidermis loss of moist amount, causes xerosis cutis.Filaggrin plays an important role in epidermal barrier function, also is the unusual one of the main reasons of AD skin barrier function.Many researchers has been studied the FLG encoding mutant and has been caused getting in touch between stratum corneum barrier function disappearance and the AD in recent years.The skin barrier function obstacle that the FLG transgenation causes is being played the part of important role in the AD morbidity, yet the FLG transgenation has race and regional difference.R501X, 2282del4, R2447X, S3247X and 3702delG are the main mutational sites of European AD crowd FLG gene; And in Japanese AD crowd, S2554X, 3321delA, S2889X and S3296X are its main susceptibility loci; And the R501X sudden change is only found in the research about Chinese AD crowd FLG in Hong Kong in 4 routine male patients.
(RNA interference, RNAi) technology is the conventional means of inhibition of gene expression, is gene silencing again in the RNA interference.RNA interferential principle is that this mRNA degraded takes place and causes the reticent phenomenon of genetic expression when importing with endogenous mRNA coding region homologous double-stranded RNA in the cell.
The RNA interfering process mainly contains two steps: one, double-stranded RNA is cut into the short dsrna of 21-23 base pair by the specific nucleicacidase of cell source double-stranded RNA, promptly siRNA (smallinterference RNA, siRNA); Two, the antisense strand of siRNA and nucleicacidase have formed reticent mixture (RNA-induced silencing complex, RISC), this complex body have had the mRNA that identification combines to have with siRNA homologous sequence, and at specific site this mRNA is cut off.The RNA perturbation technique has obtained using widely at present in gene therapy and research, and those proof effective siRNA/shRNA in the target experiment itself can be developed further into the medicine into RNAi simultaneously.ShRNA (shorthairpin RNA) is that short hairpin RNA comprises two short inverted repeats, and one of them and goal gene are complementary, and middle loop sequence is separated and formed hairpin structure.ShRNA is processed to the siRNA goal gene of effectively degrading and suppresses its expression in vivo.But to this technology be applied to clinical treatment, need to solve the RNA interference fragment and express major issues such as continuing to reach expression efficiency.
Vectors in Gene Therapy mainly contains non-virus carrier and virus vector at present, yet non-virus carrier can't satisfy long expression, and this defective is filled up by virus vector undoubtedly.The RNA perturbation technique of slow virus mediation has in recent years been obtained good start under study for action.(lentivirus-based vector is retroviral a kind of LV) to lentiviral vectors, has retroviral substruction, but different retroviral component characteristics are arranged, and this virus not only can the transfection somatoblast but also can the transfection Unseparated Cell.Viral genome can be integrated among the host, makes the expression that the gene length time is stable, and slow virus has lower immunogenicity, and this makes slow virus become RNA interferential optimum carrier, is widely used in fields such as gene expression regulation, gene therapy at present.The third generation replication defect type lentiviral vectors that we select for use is a suicide venereal disease poison, in vivo can longer expression and safe, can solve the problems such as target property, security, integration efficiency of RNA perturbation technique gene therapy.Therefore RNA interference effect long-term existence in target cell of lentiviral vectors mediation can be better performance interference effect and creates conditions.
Summary of the invention
An object of the present invention is to provide a kind of to FLG gene RNA interferential recombined lentivirus vector; It is the third generation lentiviral vectors of self inactivation; It is characterized in that; Described carrier contains PGLV/H1/GFP-sh FLG recombinant vectors, and described PGLV/H1/GFP-sh FLG recombinant vectors is in the MCS of PGLV/H1/GFP carrier, to have connected double chain DNA fragment; The sequence of described double chain DNA fragment is a kind of (wherein S represents positive-sense strand, and AS represents antisense strand) in the following sequence:
(1)FLG-homo--274：
FLG-homo-274-S：
5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’
FLG-homo-274-AS：
5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’
(2)FLG-homo-769：
FLG-homo-769-S：
5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’
FLG-homo-769-AS：
5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’
(3)FLG-homo-1627：
FLG-homo-1627-S：
5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’
FLG-homo-1627-AS：
5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’
Another object of the present invention provides described preparation method to FLG gene RNA interferential recombined lentivirus vector; It is characterized in that; According to FLG mRNA sequence, double chain DNA fragment has been synthesized in design, and described double chain DNA fragment is a kind of in the following sequence:
(1)FLG-homo--274：
FLG-homo-274-S：
5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’
FLG-homo-274-AS：
5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’
(2)FLG-homo-769：
FLG-homo-769-S：
5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’
FLG-homo-769-AS：
5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’
(3)FLG-homo-1627：
FLG-homo-1627-S：
5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’
FLG-homo-1627-AS：
5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’
Then described dna fragmentation is connected in the MCS of PGLV/H1/GFP carrier and is built into the PGLV/H1/GFP-shFLG recombinant vectors; With PGLV/H1/GFP-sh FLG recombinant vectors, pHelper1.0,2.0 3 kinds of carrier cotransfections of pHelper 293T cell cultures, obtain described recombined lentivirus vector again.
As preferably, at terminal BamH I and the EcoR I restriction enzyme site introduced of described double chain DNA fragment.
As preferably, with BamH I and EcoRI enzyme PGLV/H1/GFP carrier enzyme is cut, reclaim after the big fragment it is connected back transformed competence colibacillus bacterium, picking recombinant clone with said double chain DNA fragment.
This carrier is transfectional cell or tissue back specificity reduction FLG expression of gene effectively, thereby possibly be applied to gene therapy or gene functional research.PGLV/H1/GFP-sh FLG most important characteristics provided by the invention is to provide target property FLG gene inhibition effect, and with recombined lentivirus vector as carrier, make interference effect obtain the persistence effect.Whole process of preparation is all used plasmid, avoids the traditional method adenovirus to pollute.The present invention is through the most effective FLG interference sequence of screening, and synthetic its double-stranded DNA is connected in the slow virus skeleton plasmid carrier, with helper plasmid cotransfection instrument cell 293T cell, prepares the FLG interference recombinant lentivirus vector: PGLV/H1/GFP-sh FLG.
Usefulness of the present invention is:
1, the PGLV/H1/GFP carrier that adopts of the present invention can be in host cell continuous expression the little RNA of interference effect is arranged.This plasmid can be expressed the GFP GFP by the CMV promoters driven simultaneously, transfection efficiency when convenient virus is packed, and the detection of the efficiency of infection of host cells infected.The gag gene that contains HIV virus in pHelper 1.0 plasmids, the structural protein that coding virus is main; The pol gene, the enzyme of coding virus-specific; The rev gene, the regulatory factor of coding and regulating gag and pol genetic expression.The VSVg gene that contains the hsv source in pHelper 2.0 plasmids provides the virus packing needed capsid protein.Above three kinds of carrier corotation are gone into the third generation lentiviral vectors that the 293T cell can efficiently be assembled self inactivation; Increased by two security features: one of which has made up the lentiviral vectors of self inactivation; Promptly deleted the 3 ' LTR in U3 district; Make carrier lose HIV-1 enhanser and promoter sequence, even exist all viral proteins can not transcribe out RNA.Second characteristic is to have removed the tat gene to replace the allogeneic promoter sequence, primary HIV gene like this, and 9 genes in the group have only kept 3 (gag, pol and rev) in the HIV lentiviral vectors that makes up.Therefore third generation HIV slow virus carrier system is safer.
2, the present invention is directed to the FLG target gene and design four effective interference sequences, through the slow virus interference carrier system constructing packing acquisition PGLV/H1/GFP-sh FLG of reorganization, through detecting FLG mrna expression in the target cell according to online principle; Filter out the most effectively interference fragment; Not only overcome the low transfection efficiency of non-virus carrier, the immunogenicity of also having avoided recombinant adenovirus to produce, expression time is than shortcomings such as weak points; The lentiviral vectors of this reorganization is " suicide property " virus; Safety relatively can be incorporated in host's the genome and stably express, can not cause inserting inactivation; Make interference effect more lasting; Have and to infect Unseparated Cell, goal gene and be integrated into advantages such as target cell gene group leader time-histories is expressed, immunoreation is little,, and can be widely used in vivo gene treatment and gene functional research for good experiment basis is established in the further research of relevant FLG gene.
Description of drawings
Fig. 1 is a slow virus skeleton plasmid PGLV/H1/GFP carrier structure synoptic diagram.
Fig. 2 infects 293T cell 72h (96 orifice plate) picture (fluorescence) for slow virus.
Fig. 2 A is that C721 infects picture (200 *) behind the 293T 72h;
Fig. 2 B is that C722 infects picture (200 *) behind the 293T 72h;
Fig. 2 C is that C723 infects picture (200 *) behind the 293T 72h;
Fig. 2 D is that NC infects picture (200 *) behind the 293T 72h.
Fig. 3 infects HACAT cell 72h (6 orifice plate) picture (fluorescence, visible light) for slow virus.
Fig. 3 A is that C721 infects picture (200 *) behind the HACAT cell 72h;
Fig. 3 B is that C722 infects picture (200 *) behind the HACAT cell;
Fig. 3 C is that C723 infects picture (200 *) behind the HACAT cell;
Fig. 3 D is that NC infects picture (200 *) behind the HACAT cell.
Fig. 4 is the Real-timePCR amplification curve.
Fig. 4 A is that NC infects GAPDH and FLG gene amplification curve behind the HACAT 72h;
Fig. 4 B is not for carrying out GAPDH and FLG gene amplification curve behind the HACAT 72h of virus infection;
Fig. 4 C is that C721 infects GAPDH and FLG gene amplification curve behind the HACAT 72h;
Fig. 4 D is that C722 infects GAPDH and FLG gene amplification curve behind the HACAT 72h;
Fig. 4 E is that C723 infects GAPDH and FLG gene amplification curve behind the HACAT 72h;
Fig. 5 is a Real-timePCR amplified production electrophorogram.
Wherein the 1-11 swimming lane is respectively: molecular weight marker, GAPDH-B, GAPDH-NC, GAPDH-C721, GAPDH-C722, GAPDH-C723, FLG-B, FLG-NC, FLG-C721, FLG-C722, FLG-C723.
Fig. 6 is that PGLV/H1/GFP-sh FLG is to FLG genetic expression interference effect picture in the HACAT cell.
NC adds the groups of cells 72h sample of negative control virus infection;
B does not infect the groups of cells 72h sample of any virus;
C721 adds the groups of cells 72h sample of FLG-homo-274 virus infection;
C722 adds the groups of cells 72h sample of FLG-homo-769 virus infection;
C723 adds the groups of cells 72h sample of FLG-homo-1627 virus infection.
Embodiment
The present invention combines accompanying drawing and embodiment to be further described.
Embodiment 1: the lentiviral vectors to gene FLG makes up
1, the design of oligonucleotide and synthetic
Utilize the online RNAi Series Design software BLOCK-iT RNAi Designer of Invitrogen company; Design is to 3 interference target sequences (seeing table) of FLG gene mRNA sequence (NM-002016.1), and synthetic corresponding double-stranded DNA (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Loop structure in the LV3-shRNA template has selected for use TTCAAGAGA to avoid forming termination signal.5 ' end of positive-sense strand template has added GATCC, cuts the cohesive end complementation that the back forms with the BamHI enzyme; 5 ' end of antisense strand template has added AATTC, cuts the cohesive end complementation that the back forms with the EcoRI enzyme.
| Sequence code | The sequence title | Target sequence |
| C721 | FLG-homo-274 | GTTGGCTCAAGCATATTATTT |
| C722 | FLG-homo-769 | CACCACTGATAGTCTATTATT |
| C723 | FLG-homo-1627 | CCACGAGCAATCGGTAAATTT |
Double-stranded DNA answer print segment information separately is following:
(1)FLG-homo-274：
FLG-homo-274-S：
5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’
FLG-homo-274-AS：
5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’
(2)FLG-homo-769：
FLG-homo-769-S：
5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’
FLG-homo-769-AS：
5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’
(3)FLG-homo-1627：
FLG-homo-1627-S：
5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’
FLG-homo-1627-AS：
5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’
ShDNA with above-mentioned sequence can produce following transcripton respectively in vivo after transcribing; Self match and form double-stranded RNA with loop structure; Enzyme Dicer through the specific recognition double-stranded RNA; The mode that relies on ATP progressively be cut into 21～23nt the small molecules interference RNA fragment (small interfering RNAs, siRNA).
(1) FLG-homo-274 transcripton:
GTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTT
(2) FLG-homo-769 transcripton:
GCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTT
(3) FLG-homo-1627 transcripton:
GCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTT
In the effective stage, siRNA is double-stranded combine with the ribozyme mixture formation RNA induce reticent mixture (RNA-induced silencing complex, RISC).RISC activates with ATP dependency mode, siRNA sex change among the RISC, and two strands is untied; Unload positive-sense strand, antisense strand still is combined on the mixture, and guiding RISC combines with homologous target RNA; Under the effect of endonuclease, said target mrna is cut off, thereby reach the effect that blocking gene is expressed.
2, the annealing of LV3-shDNA template
The synthetic double chain DNA fragment is used TE (pH8.0) dissolving respectively, and concentration is 100uM.Get corresponding positive-sense strand and antisense strand oligomer solution, according to following proportioning configuration annealing reaction system.
| Component | Volume (ul) |
| 10 * shDNA annealing buffer (1M NaCl, 0.5M Hepes, pH7.4) | 5 |
| Positive-sense strand (100uM) | 5 |
| Antisense strand (100uM) | 5 |
| Distilled water | 35 |
| Total amount | 50 |
On the PCR appearance, carry out anneal according to following program: 95 ℃ 5 minutes; 85 ℃ 5 minutes; 75 ℃ 5 minutes; 70 ℃ 5 minutes; 4 ℃ of preservations.Obtaining concentration after the anneal is the shDNA template of 10 μ M.With 50 times of gained template solution dilutions, final concentration is 200nM, is used for ligation.
3, the linearizing of LV3 carrier
Get 5ug LV3 carrier; Utilize BamHI and EcoRI restriction enzyme and the conventional double digestion system of NEB company to cut 1 hour in 37 ℃ of enzymes; Agarose electrophoresis; Use agarose gel DNA purification kit (TaKaRa company) to reclaim the linearizing carrier segments, the electrophoresis detection estimated concentration, weaker concn is to 50ng/ul.
4, the structure of LV3-shRNA carrier
1) carry out the ligation of carrier according to following system:
| Component | Volume (ul) |
| 10 * T4 connects damping |
2 |
| LV3 carrier (BamHI+EcoRI double digestion) | 1 |
| ShDNA template (100nM) | 1 |
| T4DNA ligase enzyme (5weissU/ul) | 1 |
| Distilled water | 15 |
| Total amount | 20 |
22 ℃ connect 1hr, are converted into JM 109 competent cells.
2) 5 bacterium colonies of each ligation picking; Being inoculated into the LB that contains the 50ug/ml penbritin cultivates concentrated; The bacterium liquid that shakes out is chosen 2 at random and is sent to order-checking; The bacterial strain that checks order correct adopts amount extraction agent box (Shanghai JiMa pharmacy Technology Co., Ltd) extracting in the high purity plasmid, and the gained plasmid can be used for conventional molecular biology experiment and cytologic experiment.If cytotoxicity is bigger when being used for cell transfecting, can be converted into again in the bacillus coli DH 5 alpha, prepare more high purity plasmid with test kit or CsCl ultracentrifugation then.
Encapsulating of embodiment 2:FLG gene RNA interference recombinant lentivirus
Draw high purity and do not have the recombinant virus plasmid PGLV/H1/GFP-sh FLG (20 μ g) that the intracellular toxin extracting prepares; Helper plasmid pHelper1.0 (15 μ g) and pHelper 2.0 (10 μ g) carry out cotransfection 293T cell by Invitrogen company Lipofectamine 2000 operation instructions.
8h is replaced by perfect medium after the transfection, in 37 ℃, 5%CO
2After continuing in the incubator to cultivate 48h, collect and be rich in slow virus particulate cell conditioned medium liquid.4 ℃, 4000g removed behind the cell debris in centrifugal 10 minutes and to obtain slow virus with 0.45 μ M filter filtering supernatant subsequent use, can satisfy general test cell line.If will obtain the slow virus liquid concentrator that the slow virus of higher concentration obtains high titre after can be to it further concentrated and purified, packing virus liquid concentrator-80 ℃ prolonged preservation is got wherein one and is carried out the viral biology titer determination according to the following steps.
1.293T when cell was cultured to the 80-90% fusion in the 6cm petridish, the nutrient solution that inclines was used twice in 3ml D-Hank ' s solution washing cell.
2. (0.05%, Gibco), behind the mixing, the careful suction removed pancreatin solution, places 3-5 minute for 37 ℃ to add 1ml Trypsin-EDTA solution.
3. add 2ml again and contain the DMEM nutrient solution of 10%FBS, piping and druming makes cell form single cell suspension.
4. blood counting chamber is counted, with cell dilution to 3 * 10
5Cell/ml.
5. by 3 * 10
4The concentration of cells/well is inoculated 96 orifice plates, behind the mixing in 37 ℃ of 5%CO
2Cultivate 24h.
6. with DMEM training liquid ten times dilution 3-5 the gradient (according to cell state, if necessary can add Polybrene that final concentration be 5ug/ml) of slow virus stoste (10-20ul) with 15%FBS.
7. inhale and go the nutrient solution in 96 orifice plates, every hole to add the viral liquid of 100 μ l dilution, utilize Lentivirus-NC virus liquid (Shanghai JiMa pharmacy Technology Co., Ltd, 1 * 10 simultaneously
8TU/ml) set up the blank group, in 37 ℃ of 5%CO
2Cultivate 24h.
8. inhale and abandon the virus dilution liquid in 96 orifice plates, every hole adds the DMEM training liquid of 150 μ l 15%FBS, and (according to cell state, can tell 1/3-1/5 if necessary) is in 37 ℃ of 5%CO
2Continue cultivation 48,72h.
9. through fluorescent microscope or FACS counting fluorocyte, under fluorescent microscope, judge transfection efficiency (efficient is about more than 80%, referring to Fig. 2), calculate virus titer in conjunction with extension rate through observing the GFP expression.
Through the different detection method, titre has a variety of causes difference to some extent, in process of the test, must note the Biosafety requirement.
Embodiment 3: target cell infects test and genetic expression suppresses effect analysis
1, target cell is infected test
According to the following steps people's normal skin cells HACAT is carried out the virus infection experiment:
When 1) the HACAT cell was cultured to the 80-90% fusion in the 10cm petridish, the nutrient solution that inclines was used twice in 3ml D-Hank ' s solution washing cell.
2) (0.05%, Gibco), behind the mixing, the careful suction removed pancreatin solution, places 3-5 minute for 37 ℃ to add 1ml Trypsin-EDTA solution.
3) add 2ml DMEM nutrient solution again, piping and druming makes cell form single cell suspension.
4) blood counting chamber counting is by 10 * 10
5The concentration of cells/well is inoculated 6 orifice plates, 37 ℃ of 5%CO behind the mixing
2Cultivated 24 hours.
5) with slow virus stoste 200ul, with five times of dilutions of DMEM training liquid of 10%FBS.
6) suction goes the nutrient solution in 6 orifice plates, every hole to add the viral liquid of above-mentioned 1ml dilution, utilizes Lentivirus-NC virus liquid (Shanghai JiMa pharmacy Technology Co., Ltd, 1 * 10 simultaneously
8TU/ml) set up the blank group, in 37 ℃ of 5%CO
2Cultivate 24h.
7) the virus dilution liquid in 6 orifice plates is abandoned in suction, and every hole adds the DMEM training liquid of 1.5ml 10%FBS, and (according to cell state, can tell 1/3-1/5 if necessary) is in 37 ℃ of 5%CO
2Continue to cultivate, under fluorescent microscope, judge transfection efficiency (efficient is about more than 70%, referring to Fig. 3) through observing the GFP expression, receive appearance behind the 72h, the gained cell is used for Real-timePCR and detects.
2, FLG genetic expression suppresses effect analysis
1) extraction of total RNA
Carry out the extraction of total RNA according to the following steps:
(1) nutrient solution in 6 orifice plates is abandoned in suction, and every hole adds 1ml Trizol (Invitrogen).
(2) the rifle head piping and druming of handling with DEPC makes the complete cracking of cell.
(3) lysate is transferred in the 1.5ml EP pipe of DEPC processing, room temperature was placed 10 minutes.
(4) add 200 μ l trichloromethanes (analytical pure), the concuss mixing, room temperature was placed 10 minutes.
(5) 4 ℃ of 12000g centrifugal 10 minutes, draw supernatant liquid to new centrifuge tube, add isopyknic Virahol (analytical pure), precipitation at room temperature 10 minutes.
(6) 4 ℃ of 12000g centrifugal 15 minutes, abandon supernatant.
(7) deposition with 500 μ l, 75% washing with alcohol once.Centrifugal 5 minutes of 4 ℃ of 12000g reclaim deposition, abandon supernatant.
(8) normal temperature is inverted and was dried 10 minutes.
(9) with 20 μ l DEPC-H
2The O dissolution precipitation is measured OD
260, OD
280, calculate RNA concentration.
(10) integrity of agarose electrophoresis inspection RNA.
2) the RNA rt obtains cDNA
Utilize promega test kit (article No. M1701), carry out cDNA according to operation instruction and synthesize, general steps is following:
(1) the following system of preparation in aseptic EP pipe:
Total RNA:2ul
Specificity reverse transcription primer (each 1uM of GAPDH and FLG): 1.2ul
DEPC-H
2O：11.5ul
(2) 70 ℃ of incubation mixtures 5 minutes, quenching on ice.
(3) add following composition again:
5 * reverse transcription damping fluid: 4ul
10mM dNTPs (every kind of 10mM): 0.8ul
ThermoScript II (MMLV Reverse Transcriptase RNaseH-, 200U/ul, Promega): 100U (0.5ul)
(4) 42 ℃ of incubations 45 minutes.
10 minutes termination reactions of (5) 85 ℃ of heating, quenching on ice, reaction solution is as pcr template.
3, Real-time PCR detects
1) adopt software design Real-time PCR to detect primer, primer sequence information is following, and is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd.
2) according to the form below preparation reaction system
| Component | | Volume | |
| 2 * Real-time PCR Master Mix (the lucky agate in Shanghai) | 1× | 10μl | |
| ?F?Primer(20uM) | 0.1μM | 0.1μl | |
| ?R?Primer(20uM) | 0.1μM | 0.1μl | |
| The cDNA template | - | 2μl | |
| RTaq archaeal dna polymerase (5U/ μ l) (TAKARA) | 2.5U/μl | 0.4μl | |
| Distilled water | To 20 μ l |
3) utilize Mx3000Real-time PCR appearance (Stratagen) to react reaction conditions: 95 ℃, sex change in 3 minutes; 95 ℃, 30 seconds, 62 ℃, 40 seconds, totally 40 circulations, amplification situation normal (referring to Fig. 4 gene hGAPDH and hFLG amplified production melting curve, and Fig. 5 pcr amplification product electrophorogram).
, as confidential reference items FLG mRNA content results behind each virus infection is handled with the GAPDH gene, and calculated the ratio of FLG mRNA in itself and the negative control.The result shows (see figure 6), and to FLG gene RNA interferential recombinant slow virus FLG-homo-274, FLG-homo-769, FLG-homo-1627 all can effectively suppress the FLG expression of gene, suppresses the about 75-95% of effect, can be used for the follow-up functional study of FLG gene.
Claims (4)
1. one kind is directed against FLG gene RNA interferential recombined lentivirus vector; It is the third generation lentiviral vectors of self inactivation; It is characterized in that; It is characterized in that described carrier contains PGLV/H1/GFP-Sh FLG recombinant vectors, described PGLV/H1/GFP-Sh FLG recombinant vectors is in the MCS of PGLV/H1/GFP carrier, to have connected double chain DNA fragment; The sequence of described double chain DNA fragment is a kind of in the following sequence:
(1)FLG-homo-274：
FLG-homo-274-S：
5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’
FLG-homo-274-AS：
5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’
(2)FLG-homo-769：
FLG-homo-769-S：
5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’
FLG-homo-769-AS：
5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’
(3)FLG-homo-1627：
FLG-homo-1627-S：
5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’
FLG-homo-1627-AS：
5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’
2. the described preparation method to FLG gene RNA interferential recombined lentivirus vector of claim 1 is characterized in that, according to FLG mRNA sequence, double chain DNA fragment has been synthesized in design, and described double chain DNA fragment is a kind of in the following sequence:
(1)FLG-homo-274：
FLG-homo-274-S：
5’-GATCCGTTGGCTCAAGCATATTATTTCAAGAGAATAATATGCTTGAGCCAACTTTTTTG-3’
FLG-homo-274-AS：
5’-AATTCAAAAAAGTTGGCTCAAGCATATTATTCTCTTGAAATAATATGCTTGAGCCAACG-3’
(2)FLG-homo-769：
FLG-homo-769-S：
5’-GATCCGCACCACTGATAGTCTATTATTTCAAGAGAATAATAGACTATCAGTGGTGCTTTTTTG-3’
FLG-homo-769-AS：
5’-AATTCAAAAAAGCACCACTGATAGTCTATTATTCTCTTGAAATAATAGACTATCAGTGGTGCG-3’
(3)FLG-homo-1627：
FLG-homo-1627-S：
5’-GATCCGCCACGAGCAATCGGTAAATTTCAAGAGAATTTACCGATTGCTCGTGGCTTTTTTG-3’
FLG-homo-1627-AS：
5’-AATTCAAAAAAGCCACGAGCAATCGGTAAATTCTCTTGAAATTTACCGATTGCTCGTGGCG-3’
Then described dna fragmentation is connected in the MCS of PGLV/H1/GFP carrier and is built into PGLV/H1/GFP-Sh FLG recombinant vectors; With PGLV/H1/GFP-Sh FLG recombinant vectors, pHelper1.0,2.0 3 kinds of carrier cotransfections of pHelper 293T cell cultures, obtain described recombined lentivirus vector again.
3. the preparation method to FLG gene RNA interferential recombined lentivirus vector according to claim 2 is characterized in that, at terminal BamH I and the EcoR I restriction enzyme site introduced of described double chain DNA fragment.
4. the preparation method to FLG gene RNA interferential recombined lentivirus vector according to claim 2; It is characterized in that; With BamHI and EcoRI enzyme PGLV/H1/GFP carrier enzyme is cut; After reclaiming big fragment it is connected back transformed competence colibacillus bacterium, picking recombinant clone with said double chain DNA fragment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210055624.4A CN102604994B (en) | 2012-03-06 | 2012-03-06 | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210055624.4A CN102604994B (en) | 2012-03-06 | 2012-03-06 | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102604994A true CN102604994A (en) | 2012-07-25 |
| CN102604994B CN102604994B (en) | 2014-03-26 |
Family
ID=46522762
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210055624.4A Expired - Fee Related CN102604994B (en) | 2012-03-06 | 2012-03-06 | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102604994B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834691A (en) * | 2014-01-21 | 2014-06-04 | 宁波大学 | Construction method of target RNA-interfered recombinant lentivirus vector for IL-33 gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011038210A2 (en) * | 2009-09-25 | 2011-03-31 | Curna, Inc. | Treatment of filaggrin (flg) related diseases by modulation of flg expression and activity |
-
2012
- 2012-03-06 CN CN201210055624.4A patent/CN102604994B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011038210A2 (en) * | 2009-09-25 | 2011-03-31 | Curna, Inc. | Treatment of filaggrin (flg) related diseases by modulation of flg expression and activity |
Non-Patent Citations (2)
| Title |
|---|
| KYUNG HO LEE等: "Filaggrin knockdown and Toll-like receptor 3 (TLR3) stimulation enhanced the production of thymic stromal lymphopoietin (TSLP) from epidermal layers", <EXPERIMENTAL DERMATOLOGY>, vol. 20, 31 December 2011 (2011-12-31), pages 145 - 158 * |
| SKIN MODEL等: "Knockdown of Filaggrin Impairs Diffusion Barrier Function and Increases UV Sensitivity in a Human Skin Model", <JOURNAL OF INVESTIGATIVE DERMATOLOGY>, vol. 130, 6 May 2010 (2010-05-06), pages 2286 - 2294 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834691A (en) * | 2014-01-21 | 2014-06-04 | 宁波大学 | Construction method of target RNA-interfered recombinant lentivirus vector for IL-33 gene |
| CN103834691B (en) * | 2014-01-21 | 2016-06-29 | 宁波大学 | The construction method of targeting IL-33 gene RNA interference recombinant lentivirus vector |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102604994B (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210207169A1 (en) | Viral delivery of rna utilizing self-cleaving ribozymes and crispr-based applications thereof | |
| US20130245096A1 (en) | COMPOSITIONS AND METHODS FOR ACTIVATING EXPRESSION BY A SPECIFIC ENDOGENOUS miRNA | |
| CN109415728A (en) | The excision of retroviral nucleic acid sequence | |
| JP2020535805A (en) | Non-integrated DNA vector for gene modification of cells | |
| EP2307575B1 (en) | Unprocessed rolling circle amplification product | |
| US20210316013A1 (en) | Haematopoietic stem cell-gene therapy for wiskott-aldrich syndrome | |
| US20220154186A1 (en) | Novel nucleic acid molecules and their use in therapy | |
| US20110243904A1 (en) | Rna interference target for treating aids | |
| US20090136544A1 (en) | Interfering RNAs Targeting the Morbillivirus Nucleoprotein Gene | |
| CN102604994B (en) | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN103305477B (en) | GFP (Green Fluorescent Protein) tracing system of vaccinia virus and application of GFP tracing system | |
| US20230310555A1 (en) | Compositions for genome editing and methods of use thereof | |
| WO2022232191A1 (en) | Lentiviral vectors useful for the treatment of disease | |
| CN102643859A (en) | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN102812131A (en) | Identifying Viral Cell Tropism | |
| CN113105537B (en) | Host protein for promoting replication of influenza A virus and application thereof | |
| CN109022437A (en) | A kind of target site sequence and its application inhibiting the duplication of goat haemadsorption virus 1 | |
| WO2023125823A1 (en) | Sirna and shrna targeting hiv, and corresponding combination, expression cassette, cell, and application thereof | |
| CN108441496A (en) | It is a kind of inhibit chicken SOX5 gene expressions shRNA sequences and its application | |
| CN102533742B (en) | Double-stranded nucleotide sequence, recombinant plasmid containing the same and construction method thereof | |
| Rocheleau et al. | Consistent and high-frequency identification of an intra-sample genetic variant of SARS-CoV2 with elevated fusogeneic properties | |
| CN105695465B (en) | Small-interfering RNA, short hairpin RNA and carrier for mammal R-Spondin1 gene target as well as application thereof | |
| CN109722448A (en) | Target the construction method of wls gene RNA interference recombinant lentivirus vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140326 Termination date: 20150306 |
|
| EXPY | Termination of patent right or utility model |