CN113430201B

CN113430201B - Hyphantria cunea Iap gene dsRNA, bacterial expression bacterial liquid thereof and application thereof

Info

Publication number: CN113430201B
Application number: CN202110941944.9A
Authority: CN
Inventors: 张真; 张珣; 张苏芳; 孔祥波; 刘福; 樊智智; 方加兴
Original assignee: Research Institute of Forest Ecology Environment and Protection of Chinese Academy of Forestry
Current assignee: Research Institute of Forest Ecology Environment and Protection of Chinese Academy of Forestry
Priority date: 2021-08-17
Filing date: 2021-08-17
Publication date: 2022-04-01
Anticipated expiration: 2041-08-17
Also published as: CN113430201A

Abstract

The invention discloses a fall webworm Iap gene dsRNA and bacterial expression liquid thereof, wherein the nucleotide sequence of the Iap gene dsRNA fragment is shown as SEQ ID NO. 2. The method for preventing and treating fall webworm by using the bacterial expression liquid has the advantages of strong feasibility, convenient operation, good effectiveness and sensitivity, high insecticidal efficiency, environmental friendliness and the like, and has good application prospect.

Description

Hyphantria cunea Iap gene dsRNA, bacterial expression bacterial liquid thereof and application thereof

Technical Field

The invention relates to the technical field of biology, and particularly relates to a hyphantria cunea Iap gene dsRNA, and a bacterial expression bacterial liquid and application thereof.

Background

The fall webworm (Hyphantia cunea) belongs to the Lepidoptera lampwick family, is extremely dangerous external invasive forest pests in China, has wide host plants, can eat almost all kinds of cultivated trees, flowers and crops, and has large food consumption and strong adaptability because the larvae eat leaves in a colony form. The adult reproduction ability is strong, and the average egg laying of each female insect is 800-900, and the maximum egg laying can reach more than 2000. Meanwhile, the adult diffusion capacity is very strong, and the male insects can fly more than 7 kilometers and at most 23 kilometers in 12 hours. The characteristics lead the fall webworms to be extremely easy to outbreak and cause disasters, the fall webworms have caused huge economic loss and serious ecological threat to the ecological system of agriculture and forestry in China since being discovered for the first time in China in 1979, once the fall webworms invade a new suitable place, the fall webworms are difficult to be thoroughly eliminated, and the ecological safety of China is seriously threatened.

RNA interference (RNAi) is a post-transcriptional gene silencing mechanism triggered by the entry of double-stranded RNA (dsRNA) into cells, which effectively leads to pest death by silencing specific lethal genes. Although the RNAi technology has a wide application prospect as a new means for pest control, numerous studies find that the RNAi efficiency of different insects is obviously different, generally, the RNAi efficiency of insects such as Coleoptera, Orthoptera and the like is high, but the RNAi efficiency of Lepidoptera insects is very low (Wang, et al, "Variation in RNAi efficiency amplifying insects is effective to dsRNA deletion in vivo". Insect Biochemistry and Molecular Biology,77,1-9,2016; Terenius, et al, "RNA interference in Lepidoptera: An overview of social and environmental characteristics and for experimental purposes". Journal of Insect physiology.57(2), 245,2011) and the application of RNAi technology in Lepidoptera pest control seriously affects the application of RNAi technology in Lepidoptera pest control. Among the many factors that affect RNAi efficiency, one of the known factors is the stability of dsRNA, and maintaining the effectiveness of RNAi must avoid degradation of dsRNA, such as double-stranded RNA degrading enzymes (dsRNases), a class of dsRNA specific degrading enzymes, whose Expression has been currently detected in different tissues of lepidopteran insects such as Bombyx mori, Spodoptera litura (Liu, et al), "Bombyx mobile DNA/RNA non-specific genes: Expression of infectious in culture cells, subellicular localization and functional analysis". J. of infection physiology.58 (1168), 1166. 1176, 2012; Penga, et al, "Identification and characterization of bacteria," biological and mutation of bacteria, "emission and mutation of RNA, 95,2020. It was found that the activity of dsRNases in lepidopteran insects is higher than that of other groups of insects (Kun Yan Zhu and Subba Red Palli, "Mechanisms, applications, and changes of infection RNA interference". Annual Review of Entomology,65,293 and 311,2020), and that degradation of dsRNases may be a major factor limiting the RNAi efficiency of lepidopteran insects. Therefore, RNAi is difficult to realize in lepidoptera insects, and efficient RNAi target genes are rarely reported in the control of lepidoptera pests.

As an important quarantine pest, the control of the fall webworm is mainly chemical control at present, so that the negative influence on the ecological environment is caused, biological control measures such as parasitic natural enemies, sex attractants and the like are also used, but the problems of low efficiency, high cost and the like exist totally, and the report of the RNAi target gene with high efficient insecticidal activity of the fall webworm does not exist at home and abroad at present. Although patent application CN 111944824A discloses application of a tachykinin receptor gene and dsRNA of the fall webworm in the fall webworm control, the dsRNA is ingested by an injection method in the application and cannot be applied on a large scale in the actual forest control, and the tachykinin receptor gene and the dsRNA in the application can only reduce the food intake and hunger-resistant capability of the fall webworm larva, weaken the life of the fall webworm, and achieve no lethal effect, and have general control effect. Yan Xiaoping (Biochemical characterization and functional research of the chitin deacetylase HcCDAs of fall webworms, university of Hebei agriculture (academic paper), 2018) can achieve more than 80% of larval mortality by injecting dsRNA of the chitin deacetylase gene of fall webworms into 5-instar larvae of the fall webworms, but the injection dose is 10ug, and the injection dose is too high to be realized in actual pest control. Wangyue ('RNA interference-based fall webworm gene function research and transcriptome analysis', China forestry science research institute (academic paper), 2018) constructs an HT115 strain expression system of fall webworm chitinase gene dsRNA, but after the recombinant bacteria are fed, the deformed phenotype and the change of pupation rate and death rate are not generated, only the weight of larvae is obviously reduced, and the prevention and treatment effect is not ideal.

Inhibitor of Apoptosis Proteins (IAPs) are important inhibitors of the programmed cell death cascade. The IAP pathway is one of the major regulatory pathways in the regulation of apoptosis in insect cells and is critical to both insect growth and development and essential metabolism. The Iap gene is selected as an RNA interference target gene, and the self-protective mechanism of insect cell apoptosis is destroyed, so that the purpose of pest control can be achieved. At present, no literature is available on interference-related studies of the Iap gene of the fall webworm.

Disclosure of Invention

In order to overcome the defects and the defects of the existing prevention and control technology of the lepidoptera pest fall webworm, the invention provides fall webworm Iap gene dsRNA, and the nucleotide sequence of the fall webworm Iap gene dsRNA is shown as SEQ ID NO. 2.

The invention also provides a bacterial expression solution for expressing the dsRNA, and the preparation method of the bacterial expression solution comprises the following steps:

(1) performing PCR amplification by using a dsHcIap primer by using the hyphal moth cDNA as a template to obtain the dsRNA segment, wherein the sequences of the dsHcIap primer are shown as SEQ ID NO.7 and 8;

(2) connecting the dsRNA segment to a linear plasmid to construct a recombinant vector;

(3) introducing a recombinant expression vector containing the dsRNA segment into a bacterium competent cell for culture;

(4) dsRNA production is induced by IPTG, and bacterial liquid is cultured and collected.

Further, the plasmid is linearized L4440, and the bacterium is Escherichia coli HT 115.

The invention also provides application of the dsRNA or the bacterial expression solution in preventing and treating fall webworm.

Furthermore, the control of the fall webworm can be realized by feeding or spraying a bacterial expression solution for expressing the Iap gene dsRNA.

The control of the fall webworms is realized by feeding artificial feed mixed with bacterial expression liquid for expressing Iap gene dsRNA, and the control method specifically comprises the following steps: cutting the prepared artificial feed into blocks of 0.5x0.5x0.5cm size per 30g, and spraying the dsRNA expressing Iap gene with the concentration of 10⁷5mL of CFU/mL HT115 bacterial liquid is dried for 1h at normal temperature and fed.

Or directly spraying a bacterial expression solution for expressing the Iap gene dsRNA on the plant to realize the control of the fall webworm, wherein the bacterial expression solution is HT115 bacterial solution.

The beneficial effects of the invention include:

the invention obtains a fall webworm RNAi high-efficiency lethal target gene Iap gene by screening, and develops a technology capable of efficiently preventing and controlling the fall webworm based on the Iap gene, the invention adopts recombinant plasmids to express a large amount of needed exogenous target dsRNA in escherichia coli HT115, after continuously feeding escherichia coli HT115 bacterial liquid of IPTG induced expression target dsRNA, the method has high lethal capability to the fall webworm, and has obvious inhibition effect on the growth and development of the fall webworm, and the method for preventing and controlling the fall webworm by adopting the bacterial expression liquid has the advantages of strong practicability, convenient operation, good effectiveness and sensitivity, high insecticidal efficiency, environmental friendliness and the like, and has good application prospect. Compared with the in vitro transcription and chemical synthesis method of the kit adopted in the prior art, the invention can greatly reduce the experiment cost.

Drawings

FIG. 1 is an electrophoretogram of Iap gene of fall webworm;

FIG. 2 shows the mortality and pupation rates of larvae from 12d to 18d after feeding E.coli inoculum expressing the hyphae of fall webworm dsHcIap, control group larvae (control) and treatment group (dsHcIap) with the dsHcIap inoculum.

Detailed Description

The present invention will be further illustrated and described with reference to the following examples, but the examples described are only a part of the examples of the present invention, and not all of the examples. All other inventions and embodiments based on the present invention and obtained by a person of ordinary skill in the art without any creative effort belong to the protection scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 full-Length cloning of the Iap Gene of the American white moth

(1) The hyphantria cunea larvae are taken, and the total RNA of the hyphantria cunea is extracted by a TRIzol method (Trizol Plus reagent, Ambion, Austin, TX, USA).

(2) First strand cDNA was synthesized using the Reverse Transcription kit GoScript Reverse Transcription System kit (Promega, Madison, Wis., USA) with the Reverse Transcription System: mu.g of total RNA is 1. mu.g,Oligo(dT)₁₅Primer(500μg/ml)0.5μL，GoScriptTM 5X Reaction Buffer 4μL，MgCl₂(25mM)1μL，Random Primers(500μg/ml)0.5μL，PCR Nucleotide Mix 1μL，Recombinant

ribonucleae Inhibitor 0.4. mu.L, GoScriptTM Reverse Transcriptase 1. mu.L, Nuclear-Free Water make-up 20. mu.L. The reaction conditions are 42 deg.C, 15min, 70 deg.C, 15 min.

(3) Primers were designed on both sides of the gene coding region sequence according to the fall webworm larva transcriptome sequence. Primers were designed using Primer5 software to give forward and reverse primers.

A forward primer: ATGAATTTATTTTTTGTTACAG (SEQ ID NO.3 in the sequence Listing)

Reverse primer: TCAAGAGAAATACAATCTGAT (SEQ ID NO.4 in the sequence Listing)

And (3) taking the first strand of the cDNA obtained by reverse transcription as a template, and amplifying by PCR to obtain a target product fragment. The PCR reaction system is as follows: cDNA 2. mu.L, Buffer (Mg)²⁺Plus)5μL，dNTP Mixture 8μL，Forward Primer 2μL，Reverse Primer2μL，

Max DNA Polymerase 0.5. mu.L, plus ddH₂O to 100. mu.L. The reaction conditions are 94 ℃ for 1 min; 30s at 94 ℃, 30s at 55 ℃, 1min at 72 ℃ and 35 cycles; 10min at 72 ℃.

(4) The PCR products were subjected to agarose gel electrophoresis, and the results are shown in FIG. 1. And (4) purifying and recovering the target product by using a DNA purification kit (Tiangen). After recovery, the product was ligated to pEASY-Blunt vector (TransGen, Beijing, China), transferred to DH5 alpha competent cells (TransGen, Beijing, China), spread on Amp-resistant selection medium, positive single colonies were picked up in Amp-resistant liquid LB medium and sent to the company (Sangon Biotech, Co., Ltd., Beijing, China) for sequencing.

(5) And comparing the sequencing result with an NCBI database to obtain a sequence fragment of the Iap gene of the fall webworm, wherein the specific nucleotide sequence is shown as SEQ ID NO.1 in the sequence table. The sequencing result verifies that the correct plasmid is the plasmid with the sequence of SEQ ID NO. 1.

Example 2 Synthesis of Iap Gene dsRNA of hyphae cunea

(1) The plasmid (plasmid having the sequence of SEQ ID NO. 1) whose sequencing result confirmed the correctness was continuously subjected to PCR amplification using dsRNA primer having the sequence of T7 promoter, and the amplification method and system were referred to the above step (3) of example 1. The amplification product is recovered and purified according to the method of recovering and purifying the amplification product described in step (4) of example 1.

The PCR amplification primers are as follows:

taatacgactcactataggGTTTTTATTGTGACGGTGGC (SEQ ID NO.5 in the sequence Listing)

taatacgactcactataggGTGTTTCTTCGTTAGGGGTT (SEQ ID NO.6 in the sequence Listing)

(2) And (2) purifying and recovering the PCR amplification product obtained in the step (1) to obtain a dsRNA in-vitro transcription template.

In vitro synthesis of dsRNA T7 RiboMAXTM Express RNAi systems kit (Promega, Madison, WI, USA) was used in the reaction System: RiboMAXTM Express T72X Buffer 10. mu.L, linear DNA template about 1. mu.g, enzyme mix, T7 Express 2. mu.L, make up nuclease free water to 20. mu.L. Gently mixed and incubated at 37 ℃ for 3 h.

(3) Annealing of double-stranded RNA was achieved by mixing equal volumes of complementary RNA reaction solutions, incubating at 70 ℃ for 10 minutes, and slowly cooling to room temperature (about 20 min). mu.L of RNase was added to 199. mu.L of nuclease-free water to dilute the attached RNase solution (1: 200). mu.L of freshly diluted RNase solution and 1. mu.L of RQ1 RNase-Free DNase were added, respectively, and incubated at 37 ℃ for 30 minutes to remove all remaining single-stranded RNA and DNA template, leaving only double-stranded RNA.

(4) 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol were added, mixed well and placed on ice for 5 minutes. 12000rpm, 4 ℃ centrifugal 10 minutes, the centrifugal tube bottom visible white precipitation. The supernatant was discarded, the pellet was washed with 0.5mL of 70% cold ethanol, air-dried at room temperature, and then dissolved in 4 volumes of nuclease-free water to obtain purified dsRNA, which was stored at-80 ℃ for further use.

(5) 1 microliter of synthesized dsRNA is taken to carry out a 1% agarose gel electrophoresis experiment, the voltage condition of electrophoresis is 120 volts, the time is 15 minutes, the used buffer solution needs DEPC processing water to be configured, the sample application needs to use an RNAase-free gun head, a single clear band (the specific nucleotide sequence of the band is shown as SEQ ID NO.2 in a sequence table) is arranged on the dsRNA segment dsHcIap at about 252bp, and the band can be used for the subsequent experiment.

Example 3 preparation of bacterial expression bacterial solution expressing Iap Gene of hypha cunea

(1) Two sites were selected on the L4440 plasmid (Addgene, Inc.), Bgl II (AGATCT) and PstI (CTGCAG), and PCR amplification was performed using the hypha HcIap primer with the corresponding cleavage site and the protected base using the hypha Bombycis cDNA as a template, and the amplification method and system were as described in the above step (3) of example 1. The amplification product is recovered and purified according to the method of recovering and purifying the amplification product described in step (4) of example 1.

The dsHcIap primers are:

GAAGATCTTCGTTTTTATTGTGACGGTGGC (SEQ ID NO.7 in the sequence Listing)

Sequence R: AACTGCAGAACCAATGCATTGGTGTTTCTTCGTTAGGGGTT (SEQ ID NO.8 in the list)

(2) The L4440 vector is linearized by BglII and PstI (Takara) according to the sequence of the two enzyme cutting sites, the reaction system of enzyme cutting is described in the specification, and after the enzyme cutting reaction is finished, the linearized L4440 vector is recovered by using a DNA purification recovery kit (Tiangen). Recombinant vectors were constructed by ligating purified dsHcIap fragments with linearized L4440 vector using T4 DNA ligase (TransGenBiotech) overnight at 4 ℃. Then, the recombinant expression vector containing dsHcIap is introduced into HT115 competent cells, placed on ice for 30min, then heat shocked at 42 ℃ for 1min, kept on ice for 2min, then 500 mu L of LB liquid culture medium without ampicillin is added, and cultured for 1h at 37 ℃ and 200rpm, and then an LB plate containing ampicillin and tetracycline is used for overnight culture to verify positive cloning, so as to obtain bacterial expression bacteria liquid successfully expressing the hypha of the fall webworm Iap gene. HT 115-expressing strain expressing the recombinant vector was shake-cultured overnight and inoculated with 1:100 medium containing ampicillin (100. mu.g/mL) and tetracycline (C: (M) ()10 ug/mL) in LB liquid medium, shaking at 37 ℃ for 3.5h to OD₆₀₀Reaching 0.4-0.5), adding IPTG (final concentration of 1mM) to induce dsRNA to generate, and continuously culturing for 5h under the same condition to collect bacterial liquid for later use. RNA was extracted by the TRIzol method (Trizol Plus reagent, USA), and 1% agarose gel electrophoresis was used to verify whether dsRNA was successfully induced.

Example 4 control of hyphae moth by feeding dsHcIap expressing bacterial suspension

(1) Cutting the prepared artificial feeding feed into blocks with the size of about 0.5x0.5x0.5cm per 30g, and spraying 5mL (the concentration is about 10) of HT115 bacterial liquid for successfully expressing dsHcIap⁷CFU/mL), the bacterial liquid preparation method is the same as that of example 3, and the larvae are fed after being air-dried for 1 hour at room temperature.

(2) Selecting 3-instar larvae of fall webworm with normal growth, consistent growth and same size, adding the above feed for normal feeding, and using HT115 bacterial liquid transferred into L4440 empty vector with same concentration as control. Each 90 larvae (30 were one biological replicate, 3 biological replicates) were treated and fed until larvae pupate. Larval mortality and pupation rates were investigated 12d after treatment.

(3) The experimental result is shown in fig. 2, after the HT115 bacterial liquid for expressing dsHcIap is continuously fed for 13d, the mortality rate of the fall webworm larvae is 82% which is 2 times that of the control group, and the pupation rate of the 18d larvae is 18% which is 0.3 times that of the control group, which indicates that the HT115 bacterial liquid for expressing dsHcIap can effectively inhibit the growth and development of the fall webworm larvae.

Sequence listing

<110> institute for forest ecological environment and protection of China forestry science research institute

<120> hypha cunea drury moth Iap gene dsRNA, bacterial expression bacterial liquid and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1035

<212> DNA

<213> Hyphantria cunea (Hypphantia cunea)

<400> 1

atgaatttat tttttgttac agtggctcca aatgtctctg catcattata caaaaacaga 60

ccgtttccgc tgtctatctt accatcttca gcgtcgccgt cttcttccac gccttcaact 120

ccttctttat gttctatcga caaaacggac aaccgcgaga cctttggctt tagtgacaca 180

gtcgacatgc gccgcgaaga ggagaggatg aagacattca acaaatggcc cgtcagtttt 240

ctctctgctg aacaactcgc tcgcaatggc ttctactacc tcggacgcgg cgacgaagtg 300

cgttgcgcat tctgtaaggt ggaaattatg agatgggtcg aaggagacga tcccgccaga 360

gatcatcagc gctgggcacc gcaatgccct tttgtacgcc agctcacaaa ccctgactct 420

gcagggcgcg acgaatgcgg ttcacgtgta cccgtgactg cggccacatg catgcctggc 480

cctgctcatc cacgttatgc ctctgaaacc gctcgtctac gtagctttca agactggccg 540

cggtgtatgc gccaaaaacc cgaggacttg gctgaagctg gctttttcta tactgggcat 600

ggtgacaaaa cgaagtgttt ttattgtgac ggtggcctta aggactggga aaacgatgat 660

gtaccatggg agcagcatgc ccgttggttt gaccgctgcg cttatgtaca gttagttaaa 720

ggtcgggatt atgttcaaaa agtgatgaca caggcttgtt cggtcccagc gaccaatgaa 780

gtaaaggaag aagtaccgga aaaatcttca gtcaagacta atacgccaac ggaaactccc 840

gtccaagaaa cccctaacga agaaacaccc atcgaagata gtaaattatg taaaatttgt 900

tacgcagagg agcgcaacgt gtgcttcgtg ccatgcggac atgttgtggc ttgtgctaag 960

tgcgcgttgg cagcagacaa gtgtcccatg tgccgcagaa cgtttcagag tgcaatcaga 1020

ttgtatttct cttga 1035

<210> 2

<211> 252

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtttttattg tgacggtggc cttaaggact gggaaaacga tgatgtacca tgggagcagc 60

atgcccgttg gtttgaccgc tgcgcttatg tacagttagt taaaggtcgg gattatgttc 120

aaaaagtgat gacacaggct tgttcggtcc cagcgaccaa tgaagtaaag gaagaagtac 180

cggaaaaatc ttcagtcaag actaatacgc caacggaaac tcccgtccaa gaaaccccta 240

acgaagaaac ac 252

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaatttat tttttgttac ag 22

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaagagaaa tacaatctga t 21

<210> 5

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taatacgact cactataggg tttttattgt gacggtggc 39

<210> 6

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg tgtttcttcg ttaggggtt 39

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaagatcttc gtttttattg tgacggtggc 30

<210> 8

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aactgcagaa ccaatgcatt ggtgtttctt cgttaggggt t 41

Claims

1. The fall webworm Iap gene dsRNA is characterized in that the nucleotide sequence of the dsRNA segment is shown as SEQ ID NO. 2.

2. A bacterial expression fluid expressing the dsRNA of claim 1, prepared by a method comprising:

3. The bacterial expression fluid of claim 2, wherein the plasmid is linearized L4440 and/or the bacterium is e.

4. Use of the dsRNA of claim 1 or the bacterial expression fluid of claim 2 for controlling fall webworm.

5. The use as claimed in claim 4, wherein the control of fall webworm is achieved by feeding or spraying a bacterial expression solution expressing Iap gene dsRNA.

6. The use of claim 5, wherein the control of fall webworm is achieved by feeding artificial feed mixed with bacterial expression solution expressing Iap gene dsRNA.

7. The use according to claim 6, wherein the prepared artificial feed is cut into 0.5X0.5X0.5 cm-sized pieces per 30g, and the dsRNA expressing Iap gene is sprayed at a concentration of 10⁷5mL of CFU/mL HT115 bacterial liquid is dried for 1h at normal temperature and fed.

8. The application of claim 5, wherein the control of the fall webworm is realized by directly spraying a bacterial expression solution for expressing the Iap gene dsRNA on a plant.

9. The use of claim 8, wherein the bacterial expression fluid is Escherichia coli HT115 bacterial fluid.