CN117448321A - A kind of double-stranded RNA for biological control of pests and its application - Google Patents

Abstract

The application relates to the field of biopesticides, in particular to double-stranded RNA for biological pest control and application thereof. The application also provides RNA for causing pest AChE gene silencing, which is a cotton bollworm primer pair or a combination of the cotton bollworm primer pair and one or two of a plutella xylostella primer pair and a beet armyworm primer pair. The application also provides engineering bacteria for expressing the RNA and target RNA produced by the engineering bacteria, wherein the target RNA is double-stranded RNA for biological pest control. In addition, the application also provides wettable powder of double-stranded RNA. The prepared wettable powder is subjected to pesticide effect test, and the result shows that the RNA preparation is effective for preventing and controlling various pests and has up to 95% protection on vegetables.

Description

A kind of double-stranded RNA for biological control of pests and its application

Technical field

The invention relates to the field of biological pesticides, and relates to a double-stranded RNA used for biological control of pests and its application.

Background technique

RNA Interference (RNAi) technology is a new technology for pest prevention and control. It uses the pest's own RNA regulatory mechanism to deliver the target gene into the body in the form of double-stranded RNA, causing gene silencing and leading to the death of the pest. . This technology is green, environmentally friendly, simple and convenient, and has become an excellent substitute in today's environment where chemical pesticides cause serious environmental pollution, increased resistance to pesticides, and unresolved residue problems.

As insects' ability to detoxify chemical pesticides gradually increases and their sensitivity to pesticide target sites gradually decreases, the mechanism of RNA interference technology becomes more and more thorough, and its application in transgenic plant cultivation, disease prevention, etc. As time went by, people began to apply RNA interference technology to pest control. Researchers are constantly exploring efficient target genes, better methods of introducing double-stranded RNA, and appropriate frequency of use of double-stranded RNA to improve the silencing effect of RNA interference. RNA interference technology has been successfully implemented under laboratory conditions. Applied to various types of pests such as Diptera, Coleoptera, Lepidoptera, Hymenoptera, Hemiptera and Orthoptera, RNA interference has shown great potential in pest control.

The screening of RNA interference target genes generally starts from the following aspects, including direct lethal genes, genes related to pest laying or mating, such as vitellogenin receptor (VgR), genes related to pest growth and development, such as Juvenile hormone and ecdysone, genes related to pest resistance and immunity can reduce pest resistance to long-term pesticide use, and functional genes such as genes related to smell can interfere with pest recognition of crops.

In Yojana et al. (Yojana R. Chikate, Vishal V. Dawkar, Ranjit S. Barbole, Priyadarshini V. Tilak, Vidya S. Gupta, Ashok P. Giri. RNAi of selected candidate genes interrupts growth and development of Helicoverpa armigera [J]. In this article (PesticideBiochemistry and Physiology, 2016,133), trypsin, chymotrypsin, glutathione S-transferase, cathepsin L, fatty acid binding protein, esterase, catalase, superoxide Dozens of candidate enzymes/proteins, such as material dismutase and chitin deacetylase, were found. The acetylcholinesterase gene was synthesized in vitro to double-stranded RNA and then fed to the cotton bollworm Helicoverpa armigera, which can cause a good RNA interference effect and cause the highest fatality rate. , therefore, the acetylcholinesterase gene was selected for the induced expression double-stranded RNA experiment of engineering bacteria.

As an indispensable esterase in living organisms, acetylcholinesterase (AChE), its most important and basic function is to hydrolyze acetylcholine (ACh) into acetic acid and choline, thereby ensuring nerve Signals can be transmitted normally, preventing excessive accumulation of acetylcholine in the synaptic gap, causing nerve convulsions, spasms and ultimately death. In other words, as long as acetylcholinesterase is inactivated or its activity is inhibited, it can disrupt the insect's nervous system, causing the insect's nervous system to be in a state of excitement for a long time, thus affecting other physiological activities and reproductive survival of the insect. Therefore, the acetylcholinesterase gene is a direct lethal gene.

From the theory of acetylcholine in 1914 to its isolation and identification in 1932, research on acetylcholinesterase has been in-depth. People have discovered that the function of acetylcholinesterase is not limited to basic catalysis, but can also affect cell adhesion. For example, it can interact with bone cell matrix in bone cells; it also has a certain relationship with cell adhesion in nerve cells, promoting axon growth, inducing synapse formation, and participating in the migration activities of nerve cells. In addition, acetylcholinesterase can also promote platelet production to solve the problem of thrombocytopenia after stem cell transplantation, serve as a marker of cell apoptosis to promote cell apoptosis, affect amyloid metabolism and aggregation, and regulate dopamine-cholinergic nerves. Activity, relationship with learning and memory functions of rats, etc. In short, acetylcholinesterase and acetylcholinesterase inhibitors have gradually departed from theory and are widely used in various fields such as medicine, agriculture, and biological research.

In invertebrates, choline can only be hydrolyzed by acetylcholinesterase. Therefore, the role of acetylcholinesterase is more important in invertebrates, and its types are more complex and diverse than in vertebrates. The gene encoding acetylcholinesterase is called Ace gene, and most of them only have two types, namely Ace 1 and Ace 2.

There are many lepidopteran pests that harm crops. Common ones include Helicoverpa armigera, diamondback moth Plutella xylostella, beet armyworm Spodoptera exigua, Spodoptera lituraFabricius, and Spodoptera frugiperda. They are all the most serious pests that harm vegetables. Insects of the order Ptera, of which:

The cotton bollworm mainly harms crops such as cabbage, corn, and tomatoes. The number of eggs they lay varies greatly at different temperatures. It can lay up to more than 900 eggs. The eggs hatch into larvae in 2 to 4 days. The larvae are 4mm long and the adults are 15 ~18mm, wing width 32~35mm, forewings have irregular black spots and light gray wavy lines, and hind wings are white in color. Under suitable temperatures, a complete generation takes 31 to 36 days, with as few as 3 generations and as many as 8 generations occurring in one season. Leaves can be eaten away after 2 years of age, resulting in reduced vegetable production;

Diamondback moth is also known as small caterpillar. The larvae are mostly dark brown, with a body length of 9 to 12 mm, and a yellow-brown head. Patterns can be seen on the front and back of the thorax. Its pupa is yellow-green or gray-brown, with a body length of 7-9 mm, and is covered with silk. Cocoon cover. This insect causes the most serious damage under dry and warm conditions, with as few as 5 and as many as 18 generations occurring in a year. Diamondback moth has strong adaptability and resistance to pesticides, and is one of the 20 most resistant pest species currently reported. 1. It has developed high resistance to commonly used organophosphorus and pyrethroid pesticides, and the range of pesticides to choose from is small;

Beet exigua, also known as corn exigua, belongs to the family Lepidoptera. It is a lepidopteran pest that is difficult to control. It damages a variety of vegetables, such as soybeans, cabbage, adzuki beans, eggplants, potatoes, etc. The egg stage of Spodoptera exigua is 2 to 5 days. The adult body length is 11 to 14 mm, the wing width is 23 to 28 mm, and the forewings have triangular black spots. This type of insect is generally gray-brown in color and feeds heavily when it reaches the 3rd to 4th instar larvae. Crops can eat all the leaves in severe cases, and can have 5 to 8 generations a year under suitable growing conditions;

The bollworm Helicoverpa armigera, the diamondback moth Plutella xylostella and the sugar beet armyworm Spodoptera exigua are all lepidopteran pests, which have a huge impact and damage to the growth of agricultural crops in my country. They have a great impact on the quality and yield of agricultural products, and have a negative impact on the country's economy, environment and The demand for food has produced direct harm. Therefore, we will take these three pests as the main research objects, use RNA interference technology to only identify the corresponding mRNA sequences, and do not cause harm to non-target organisms, and study biopesticides that are harmless to the human body and the environment and can prevent and control pests, so as to Provide some laboratory theoretical basis as a reference for the development of new RNA interference agents.

In recent years, the global extreme climate has occurred frequently, droughts and floods occur frequently, and a series of reasons such as intensified human activities have caused serious damage to the ecological environment. As a result, the number of pest populations has increased significantly, and the frequency of insect disasters has also increased. This has a great impact on the world. The agricultural economy has caused huge losses. For this reason, pest control has become the focus of agricultural development. Common pest control methods currently include agricultural control, physical control, chemical control and biological control.

The phenomenon of RNA interference has been discovered in a variety of organisms since its discovery in 1998, and has been proven to be highly conserved. However, at present, there are relatively few experiments related to the RNA interference reaction of Lepidoptera in the relevant literature, and most of them directly synthesize double-stranded RNA in vitro. However, the double-stranded RNA synthesized in vitro is unstable in the environment (light and temperature are also unstable. It will inactivate the RNA synthesized in vitro), it is easy to be decomposed in the body after being eaten by pests, it is difficult to reach the target of pests, the output is small, and the cost is high. For example, the price of the in vitro synthesis kit is 6556 yuan/20 times. In addition, there may be multiple pest hazards in farmland at the same time. However, an RNAi agent can only kill specific pests specifically and is not broad-spectrum, making it difficult to be accepted by farmers.

Therefore, in order to develop double-stranded RNA preparations and commercialize RNA interference, the inventors mainly explored the possibility of cultivating double-stranded RNA in engineered bacteria, targeting the key enzyme acetylcholinesterase gene in various agricultural pests as the target gene. , trying to construct engineering bacteria corresponding to various double-stranded RNAs. A variety of engineering bacteria that synthesize double-stranded RNA are mixed to prepare a wettable powder for field pest control.

Specifically, this experiment chose to introduce double-stranded RNA through feeding, so that the research results can be used in field experiments out of the laboratory in the future. Improved the way to generate double-stranded RNA, replacing expensive in vitro synthesis kits with engineering bacteria that continuously generate energy sources, that is, using Escherichia coli or Bacillus subtilis to cultivate more stable double-stranded RNA, solving the problem of double-stranded RNA synthesized in vitro It is expensive, difficult to absorb, unstable and has a series of problems. By adding carrier, surfactant and RNase inhibitor to double-stranded RNA, a wettable powder of double-stranded RNA is prepared for field pest control. We also try to replicate this technology in other genes of other lepidopteran insects (such as the diamondback moth Plutella xylostella and the sugar beet armyworm Spodoptera exigua), in order to provide some new experience for RNA interference technology-mediated management methods.

Since double-stranded RNA is easily degraded, the inventor developed a formulation and placed it at room temperature to test changes in RNA content and biological activity within one year, laying the foundation for the subsequent commercial application of double-stranded RNA preparations.

Contents of the invention

In order to provide a method that can enhance the gene silencing effect of pests and improve the insecticidal effect, the present application provides a method for preparing double-stranded RNA that causes pest AChE gene silencing.

In the first aspect, the application provides an RNA that causes pest AChE gene silencing, which is a primer pair for Helicoverpa armigera, or one or two combinations of a Bollworm primer pair and a Diamondback moth primer pair or a Beet Spodoptera exigua primer pair, in:

Cotton bollworm A: upstream primer F GTGGAGACTCAACGAAGATC, Seq_1;

Downstream primer R CTCTTAGACCACATAATGAACTC, Seq_2;

Diamondback moth P1: upstream primer F ATTGTTTGGAGAATCGTCCG, Seq_3;

Downstream primer R GGATTCAGTTCTCTGACCGC, Seq_4; or

Diamondback moth P2: upstream primer F GGCAAGAATTACTCACCCGA, Seq_5;

Downstream primer R CGGAAAAGCGAGATTCAAAC, Seq_6;

Spodoptera exigua S1: upstream primer F GGCTGTGTCGGTTTCATTG, Seq_7;

Downstream primer R GATTCAACTCTCTAACTGCCTGC, Seq_8; or

Spodoptera exigua S2: upstream primer F GGGAGAAGAAATGTGGAATCC, Seq_9;

Downstream primer R GCCGACTCACCAAATAATGTTA, Seq_10.

In the second aspect, this application provides an engineering bacterium expressing RNA, whose raw materials are: RNA that causes pest AChE gene silencing, a vector and competent cells.

The carrier is T Easy carrier.

The competent cell is Escherichia coli, preferably Escherichia coli HT115 (DE3).

The preparation method of the engineered bacteria includes the following steps:

1) Preparation of pest total RNA: Extract the intestinal and brain tissues of the corresponding pests using the RNA prep pure animal tissue total RNA extraction kit to obtain total pest RNA;

2) Preparation of template DNA:

Step 1) Prepare the pest total RNA solution, use the M-MuLV first-strand cDNA synthesis kit to synthesize single-stranded cDNA, and amplify it into double-stranded DNA through polymerase chain reaction (PCR) technology. Use primers to locate the template DNA corresponding to the double-stranded RNA of interest;

3) Preparation of plasmid: 1 μL of vector, 2 μL of template DNA prepared in step 2), 1 μL of T4 DNA Ligase, 5 μL of 2× Rapid Ligation Buffer, 1 μL of ddH ₂ O; place at 4°C overnight to obtain plasmid;

4) Plasmid transformation: Prepare E. coli into competent cells and add the plasmid prepared in step 1). Heat shock reaction after ice bath, then recover in LB liquid medium, concentrate, discard the supernatant, and precipitate in ampicillin-containing solution. Culture on a penicillin plate, and then pick a single colony and place it again in an LB liquid medium containing ampicillin, and culture it to obtain an engineering bacterium expressing RNA.

In the above method:

In step 2):

Resistant plates containing ampicillin, the concentration of ampicillin is 50 μg/mL;

LB liquid medium containing ampicillin, the concentration of ampicillin is 50 μg/mL;

LB liquid culture medium consists of: 1.0g sodium chloride, 1.0g tryptone, 0.5g yeast extract, 100mL deionized water. Prepare the culture medium according to the above proportions. After adjusting the pH to 7±0.2 (25℃), high temperature and high pressure Sterilize to obtain sterile culture medium.

The gene fragments of three different types of insects, namely Helicoverpa armigera, Plutella xylostella and Spodoptera exigua, were respectively transferred into E. coli. The maturity of this method in genetic engineering ensures that the engineered bacteria can be successfully prepared. An investigation of the engineering bacteria revealed that the sequence has been successfully connected to the vector. Comparing the known acetylcholinesterase gene sequence, it can be seen that the plasmid already contains the target gene sequence, and a very few genes have mutated, but their mutations will not Affects subsequent induced expression and the effect of double-stranded RNA. Therefore, it can be determined that the plasmid has been successfully transferred into E. coli.

In a third aspect, the present application provides a double-stranded RNA produced by engineering bacteria, which is induced and expressed by the following method: the engineered bacteria generate double-stranded RNA under the induction of IPTG, centrifuge, and freeze-dry.

The inducer is Isopropyl-β-D-Thiogalactoside;

The induced expression method provided by this application includes the following steps: pick a single colony and culture it in an LB liquid culture medium solution containing ampicillin overnight, take the overnight culture bacterial liquid into a resistant 2×YT culture medium solution containing ampicillin, Cultivate on a shaking table until OD600>0.8, add IPTG solution, continue shaking on a shaking table to obtain double-stranded RNA at 4,000 rpm at 4°C, centrifuge, discard the supernatant, obtain bacterial slurry, and dry.

The main components of the LB liquid culture medium are: 1.0g sodium chloride, 1.0g tryptone, 0.5g yeast extract powder, 100mL deionized water; prepare the culture medium according to the above proportion, and adjust the pH to 7±0.2 (25°C ), sterilize under high temperature and high pressure to obtain sterile culture medium.

The main components of the 2×YT culture medium are: 0.5g sodium chloride, 1.6g tryptone, 1.0g yeast extract powder, 100mL deionized water; prepare the culture medium according to the above proportion, and adjust the pH to 7±0.2 (25 ℃), and then sterilized by high temperature and high pressure to obtain the sterile culture medium.

In various media containing ampicillin, the concentration of ampicillin is 50 μg/mL.

IPTG (Isopropyl-β-D-thiogalactoside, IPTG) solution, dissolve 238 mg IPTG in 10 mL of deionized water, and filter with a 0.22 μm filter.

The centrifugation conditions are: centrifuge at 4,000 rpm for 10 minutes at 4°C.

The drying is freeze drying or spray drying, which can be done by conventional methods, or it can be prepared by the following method: pre-freeze at -80°C for 4 to 5 hours, open the vacuum freeze dryer half an hour in advance, and place the pre-frozen Remove the lid from the 50mL centrifuge tube of the post-bacteria slurry, cover the mouth of the tube with a film, and leave a number of ventilation holes on the film (this step avoids impurities falling into the freeze-drying process and ensures the purity of the freeze-dried product), and places the centrifuge tube in a centrifuge tube. Place the rack into a vacuum freeze dryer and vacuum freeze for 18 hours at a cold trap temperature of -50~-53°C and a pressure of 6~6.50Pa to obtain the freeze-dried product.

In the fourth aspect, the present application also provides a wettable powder containing double-stranded RNA, including: double-stranded RNA, a carrier, a surfactant and an RNase inhibitor.

Specifically, the wettable powder includes the following components by mass: 10 parts of double-stranded RNA, 30-150 parts of carrier, 2-9 parts of surfactant, and 2-9 parts of RNase inhibitor.

Preferably, the wettable powder includes the following components by mass: 10 parts of double-stranded RNA, 60-120 parts of carrier, 2-5 parts of surfactant and 2-6 parts of RNase inhibitor.

Further preferably, the wettable powder includes the following components by mass: 10 parts by mass of double-stranded RNA, 60-90 parts by carrier, 3.5-5 parts by surfactant and 3.5-5 parts by RNase inhibitor.

Optimally, the wettable powder includes the following components by mass: 10 parts of double-stranded RNA, 60 parts of carrier, 4.2 parts of surfactant and 4.9 parts of RNase inhibitor.

Among the above wettable powders:

The double-stranded RNA is a freeze-dried powder.

The surfactant is sodium dodecyl sulfate (SDS), open powder (BX), sodium lignosulfonate (SL), calcium lignosulfonate (CL), preferably calcium lignosulfonate; surface The dosage of active agent is 3-7% of the total mass of the carrier and double-stranded RNA, specifically 3%, 5%, or 7%;

The carrier is kaolin, bentonite, diatomite or silica, preferably silica; the mass of the carrier and double-stranded RNA is 3-15:1, specifically 15:1, 12:1, 9:1, 6:1, 3:1.

The RNase inhibitor is urea or sodium dodecyl sulfate (SDS), preferably urea; the RNase inhibitor dosage is 3-7% of the total mass of the carrier and double-stranded RNA, specifically 3%, 5% %, 7%.

This application also provides a method for preparing wettable powder, which involves mixing any double-stranded RNA with a carrier, surfactant and RNase inhibitor, freeze-drying or spray-drying, and preparing a wettable powder.

This application also provides the use of wettable powders in the preparation of pesticides for preventing and controlling lepidopteran pests.

This application also provides a method for using the wettable powder: dilute the wettable powder 200-400 times with water, and then spray it on the leaves of green vegetables.

To sum up, this application has the following beneficial effects:

1. In this application, the pest RNA extracted from the larvae midguts of cotton bollworm, diamondback moth and exigua exigua is the original gene sequence. cDNA is generated through reverse transcription, PCR amplifies and locates the target acetylcholinesterase gene, and the target gene is connected T Easy vector, and then transformed into E. coli competent cells to obtain double-stranded RNA engineering bacteria.

2. The engineered bacteria provided in this application, after generating double-stranded RNA under the induction of IPTG, were fed to fourth-instar larvae, and the targeted genes were found to be silenced; when second-instar larvae of pests were fed, a mortality rate of up to 60% was observed, and the dead insects The body turned black, while other undead worms grew slowly and were significantly smaller than the negative control.

3. When conducting RNA interference experiments in this application, we found that RNA, including double-stranded RNA, is easily degraded by RNase, and the preservation of double-stranded RNA has become a major problem. Therefore, four commonly used RNase inhibitors, urea, sodium dodecyl sulfate, vanadyl ribonucleoside complex and protein inhibitor RNasin, were tried to extend the storage time of double-stranded RNA. The results show that urea and RNasin have a high degree of inhibition of RNase and have the potential to be highly effective inhibitors. However, considering the cost of commercialization, urea's low price makes it stand out.

4. The wettable powder provided by this application can extend the validity period of at least six months at normal temperature.

5. The wettable powder provided in this application was sprayed on the leaves of cotton bollworm, diamondback moth and exigua exigua in indoor pots. On the third day after application, all three insects showed RNA interference effects and the growth of the insects was restricted. , all died to varying degrees within seven days of application, with a mortality rate of 85%. The preparation provided in this application also has up to 95% protection for green vegetables. Compared with untreated green vegetables, the RNA interference preparation has a very good effect in crop protection.

Description of the drawings

Figure 1: Experimental flow chart for the preparation of single-gene engineering bacteria;

Figure 2: PCR electrophoresis pattern of armigera armigera acetylcholinesterase gene;

Figure 3: PCR electrophoresis pattern of the acetylcholinesterase genes of Spodoptera exigua and Diamondback moth. S1 and S2 represent the two target genes of Spodoptera exigua, and P1 and P2 represent the two target genes of Diamondback moth. The three samples are one gene;

Figure 4: Sequencing results of engineered strains of cotton bollworm. The asterisk indicates that the sequencing results are consistent with the original genes.

Figure 5: Sequencing results of Diamondback moth Ace 1 engineered bacteria. The asterisk indicates that the sequencing results are consistent with the original gene;

Figure 6: Sequencing results of Diamondback moth Ace 2 engineered bacteria. The asterisk indicates that the sequencing results are consistent with the original gene;

Figure 7: Sequencing results of Spodoptera exigua Ace 1 engineered bacteria. The asterisk indicates that the sequencing results are consistent with the original gene;

Figure 8: Sequencing results of Spodoptera exigua Ace 2 engineered bacteria. The asterisk indicates that the sequencing results are consistent with the original gene;

Figure 9: Electrophoresis diagram of double-stranded RNA induction in Armigera armigera. The four samples are the results after induction at 37°C for 4, 5, and 6 hours and after induction at 32°C for 6 hours;

Figure 10: Double-stranded RNA induction electrophoresis diagram of Diamondback moth and Spodoptera exigua. Various induction times (4h, 5h and 6h) and induction temperatures (37°C and 32°C) were used to conduct experiments, and the double strands with brighter bands were selected. RNA was used for subsequent gastric poisoning experiments. S1 and S2 represent the double-stranded RNA corresponding to the two target genes of Spodoptera exigua, and P1 and P2 represent the double-stranded RNA corresponding to the two target genes of Diamondback moth;

Figure 11: Gene silencing levels in Helicoverpa armigera. The data in the figure refer to the mean ± standard deviation (SEM). Asterisks indicate significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 12: Gene silencing levels in Diamondback moth. The data in the figure refer to the mean ± SEM. Asterisks indicate significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 13: Gene silencing levels in Spodoptera exigua. The data in the figure refer to the mean ± SEM. Asterisks indicate significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 14: Four vector electrophoresis verification. From left to right: kaolin, bentonite, diatomite, and white carbon black;

Figure 15: Comparison of RNA concentration of four carriers corresponding to mother powder. The data in the figure refer to the mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 16: Electropherograms of different mass ratios of silica and original drug;

Figure 17: RNA concentration of different mass ratios of silica. The data in the figure refer to the mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 18: Electropherograms of different RNase inhibitors;

Figure 19: Electropherograms of different amounts of urea added;

Figure 20: RNA concentration at different amounts of different inhibitors. The data in the figure refer to the mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 21: Electrophoresis patterns of different surfactants at the same mass ratio;

Figure 22: RNA content of different surfactants at different amounts. The data in the figure refer to the mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

Figure 23: Objective bands under different storage times;

Figure 24: Survival rate of green vegetable leaves.

Detailed ways

The following examples are used to illustrate the invention but are not intended to limit the scope of the invention.

1. Experimental equipment (equipment name, model and manufacturer respectively):

Sterile ultra-clean bench (model SW-CJ-IFD), constant temperature incubator (model DHG-9070A), Shanghai Yiheng Technology Instrument Co., Ltd.;

High-pressure steam sterilizer, LDZX-50KBS, Shanghai Shen'an Medical Equipment Factory;

Constant temperature shaker, COS-200B, Shanghai Bilang Instrument Manufacturing Co., Ltd.;

Vortex mixer, XW-80A, Shanghai Jingke Industrial Co., Ltd.;

Nucleic acid electrophoresis tank (model HE-200), gel imager (model Tanon 2500), Shanghai Tianneng Technology Co., Ltd.;

Constant temperature heater, GL-150B, Qilin Bell Instrument Manufacturing Co., Ltd.;

UV spectrophotometer, UV1902PC, purchased from Phoenix Optical Group Co., Ltd.;

Light incubator, Blue Pard, purchased from Shanghai Yiheng Technology Instrument Co., Ltd.;

Reverse transcription-fluorescence quantitative PCR instrument, Light Cycle 96, was purchased from Shanghai Roche Pharmaceutical Co., Ltd.

2. RNA store Reagent reagent, RNA prep pure animal tissue total RNA extraction kit, Agarose agarose in electrophoresis experiments, 6×DNA loading buffer, DNA marker II (molecular weight standard) and DNA marker IV (molecular weight standard), spin column type A large number of agarose gel DNA recovery kits, 10× PCR buffer, ddH ₂ O, etc. were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. in:

RNA prep pure animal tissue total RNA extraction kit contains: lysis buffer RL 30ml, deproteinization buffer RW 140ml, rinse buffer RW 12ml, RNase Free ddH ₂ O 15ml, RNase Free adsorption column CR3 (including 2ml collection tube) 50 sets (hereinafter referred to as (Adsorption column), 50 sets of RNase Free filter column CS (including 2ml collection tube), 4ml RDD buffer, 1 tube of RNase-Free DNase I, DNase I dry powder, and Proteinase K.

3. DEPC water (diethypyrocarbonate, diethyl pyrocarbonate), M-MuLV first-strand cDNA synthesis kit, Taq plus DNA polymerase for PCR, primers and dNTP Mixture (with Mg ²⁺ , 25mM), 50 for electrophoresis ×TAE buffer and 4S red plus nucleic acid stain (10,000× aqueous solution), sterile CaCl ₂ solution (1M), T4 DNALigase1, 2× Rapid Ligation Buffer, ddH ₂ O, etc., all from Sangon Bioengineering (Shanghai) Co., Ltd. Ltd. in:

M-MuLV first-strand cDNA synthesis kit contains: 5×Reaction Buffer, 10Mm dNTP Mix, Oligo-dT Primer (0.5μg/μl), Random Primer p(dN) ₆ (0.2μg/μl), RNase Inhibitor ( 20U/μl), M-MuLV Reverse Transcriptase (200U/μl), RNase-free ddH ₂ O. 4. Preparation of culture medium

LB liquid culture medium, its main ingredients: 1.0g sodium chloride, 1.0g tryptone, 0.5g yeast extract powder, 100mL deionized water;

2×YT medium, its main ingredients: 0.5g sodium chloride, 1.6g tryptone, 1.0g yeast extract powder, 100mL deionized water.

The preparation method of each culture medium is as follows: prepare the culture liquid according to the above proportions, adjust the pH to 7±0.2 (25°C), and then sterilize it under high temperature and high pressure to obtain a sterile culture medium.

5. IPTG (Isopropyl-β-D-thiogalactoside, IPTG) and Trizol reagent were purchased from Sangon Bioengineering (Shanghai) Co., Ltd.

6. Isopropyl alcohol and ethanol were purchased from Shanghai Titan Technology Co., Ltd.;

7. Trans Script one step gDNA removal and cDNA synthesis super mix and Perfect start green qPCR super mix were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

8. 1×TAE solution, purchased from Shanghai Biyuntian Biotechnology Co., Ltd.

Example 1: Design of primer pairs

According to the acetylcholinesterase gene corresponding to the double-stranded RNA that causes RNA interference reaction in the literature of Yojana et al. [Document 1], Gaddelapati et al. [Document 2] and Zhao Jing et al. [Document 3], the primers for the PCR reaction were synthesized. The sequence is shown in Table 1.

Table 1 Primer sequences of cotton bollworm, diamondback moth and exigua exigua

F represents the upstream primer, R represents the downstream primer, bp represents the primer length, and Accession No. is the sequence number found on NCBI.

in:

Document 1, Yojana R.Chikate, Vishal V.Dawkar, Ranjit S.Barbole, PriyadarshiniV.Tilak, Vidya S.Gupta, Ashok P.Giri.RNAi of selected candidate genesinterrupts growth and development of Helicoverpa armigera[J].PesticideBiochemistry and Physiology ,2016,133;

Document 2, Gaddelapati Sharath Chandra, Ramaswamy Asokan, Maligeppagol Manamohan, Nallur Krishna Kumar.Enhancing RNAi by using concatemerized double-stranded RNA[J].Pest Management Science, 2019, 75(2);

Document 3, Zhao Jing, Hao Dejun, Xiao Liubin, Tan Yongan, Jiang Yiping, BaiLixin, Wang Kai. Molecular and functional properties of two Spodoptera exiguaacetylcholinesterase genes [J]. Archives of Insect Biochemistry and Physiology, 2019, 101(3);

Example 2: Extraction of total RNA from pests

1. Experimental materials:

1.1 The test insects Helicoverpa armigera, diamondback moth Plutella xylostella and beet armyworm Spod-optera exigua and their food were purchased from Henan Keyun Biopesticide Co., Ltd.

The experimental subjects were 2-instar larvae. The culture conditions in the light incubator were: 16 hours of light, a temperature of 26 to 28°C, and a humidity of about 40%.

1.2 Configuration of each liquid:

The RNA prep pure animal tissue total RNA extraction kit was used to extract total RNA. Before use, add:

Preparation method of 1% β-mercaptoethanol lysis solution RL: Add β-mercaptoethanol to the lysis solution RL to a final concentration of 1%, for example, add 10 μl of β-mercaptoethanol to 1 ml of lysis solution RL.

Preparation of DNase I mixed solution: Dissolve DNase I dry powder (1500U) into 550μl RNase FreeddH ₂ O, mix gently, aliquot and store at -30~-15℃ (can be stored for 9 months) to obtain DNase I storage solution .

2. Extraction of total RNA (see Figure 1 for the flow chart)

Total RNA was extracted from intestinal and brain tissues using the RNA prep pure animal tissue total RNA extraction kit. The extraction was the same for cotton bollworm, diamondback moth and beet exigua. The following uses cotton bollworm as an example:

1) Homogenize:

Dissect the bollworm Helicoverpa armigera, remove its intestine and brain, soak them in RNA storeReagent reagent, and set aside.

Weigh 20 mg of cotton bollworm midgut or brain tissue, add 300 μL of lysis solution RL with a concentration of 1% β-mercaptoethanol, and grind the tissue thoroughly with a grinding pestle. (Note: Since its brain is difficult to grind, it can be crushed first and then added to the lysis solution)

2) After homogenization, add 590 μL RNase Free ddH ₂ O and 10 μL Proteinase K, mix well, use a 56°C water bath for 20 minutes, and then centrifuge at 12,000 rpm for 5 minutes. Take the supernatant and place it in another clean collection tube for later use.

3) Add 0.5 times the volume of the supernatant liquid to the collection tube containing the supernatant in step 2), mix evenly and transfer it to the adsorption column, then centrifuge at 12,000 rpm for 1 minute, discard the waste liquid, and remove the adsorbed liquid. Place the column into the collection tube.

4) Add 350 μL of protein-removing solution RW1 to the collection tube in step 3), centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube.

5) Prepare a mixed solution of 70 μL RDD buffer and 10 μL DNase I, add it to the collection tube in step 4), leave it at room temperature for 15 minutes, then add 350 μL protein-removing solution RW1, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid , place the adsorption column into the collection tube.

Preparation of DNase I mixed solution: Add 10 μl of DNase I storage solution into a new RNase Free centrifuge tube, add 70 μl of RDD buffer, and mix gently to get it.

6) Add 500 μL of rinse solution RW to the collection tube in step 5) (add ethanol before use), place it at room temperature for 2 minutes, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid, and place the adsorption column into the collection tube.

7) Add 500 μL of rinse solution RW to the collection tube in step 6) again, place it at room temperature for 2 minutes, centrifuge at 12,000 rpm for 3 minutes, discard the waste liquid, and place the adsorption column into the collection tube.

8) Let it dry for a few minutes at room temperature to completely remove the remaining rinse liquid. Finally, put the adsorption column into a new centrifuge tube, drop 50 μL RNase Free ddH ₂ O into the middle of the adsorption membrane, let it stand for 2 minutes, and centrifuge at 12,000 rpm for 2 minutes to collect the RNA solution, which is the total pest RNA solution.

Example 3: Preparation of template DNA

The total RNA solution of pests was synthesized with M-MuLV first-strand cDNA synthesis kit to synthesize single-stranded cDNA, and then amplified it into double-stranded DNA through polymerase chain reaction (Polymerase chain reaction, PCR) technology. The preparation methods for cotton bollworm, diamondback moth and beet armyworm are the same. The following still takes cotton bollworm as an example:

1. Reverse transcription of RNA

The pest total RNA solution prepared in Example 2 was used to synthesize single-stranded cDNA using the M-MuLV first-strand cDNA synthesis kit. The entire experiment needed to be performed on ice.

1) Add the total RNA reverse transcription system 1 solution to the ice-bathed test tube, shake well and centrifuge for 3 seconds to remove the supernatant.

The system solution of total RNA reverse transcription system 1 is: 5 μL of pest total RNA solution, 1 μL of each of the upstream and downstream primers in the corresponding primer pair in Table 1, and 6 μL of RNase-free ddH ₂ O.

2) Place the test tube in a 65°C water bath for 5 minutes, then transfer it to an ice bath for 30 seconds, centrifuge for 3 seconds, and remove the supernatant;

3) Place the test tube back on the ice bath, add the total RNA reverse transcription system 2 solution, mix gently and centrifuge for 3 seconds to remove the supernatant.

System solution of total RNA reverse transcription system 2: 12 μL of pest total RNA solution, 4 μL of 5×Reaction Buffer, 1 μL of RNase Inhibitor, 2 μL of dNTP Mix, and 1 μL of M-MuLV Reverse Transcriptase.

If the total RNA concentration is low, the amount of total RNA can be increased appropriately and the amount of enzyme-free water can be reduced.

4) Carry out reverse transcription reaction on a PCR machine. Reaction conditions: pre-reaction at 25°C for 10 minutes; cDNA synthesis at 45°C for 60 minutes; terminate the reaction at 70°C for 10 minutes to obtain a template cDNA solution.

2. Amplification of cDNA

The single-stranded cDNA prepared above is extremely unstable and is amplified into double-stranded DNA through polymerase chain reaction (PCR) technology.

The PCR system is: Taq plus DNA polymerase 1 μL, template cDNA solution 2 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, dNTP Mixture (with Mg ²⁺ ) (25mM) 1 μL, 10× PCR buffer 5 μL, ddH _2O 37μL. (The primers are the upstream primers and downstream primers of Helicoverpa armigera in Table 1).

Shake the above system, centrifuge, and perform PCR reaction on a PCR machine. The reaction conditions are: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 45 seconds; annealing at 51-58°C for 15 seconds; extension at 72°C for 45 seconds, including denaturation, annealing, and extension for 30 seconds. cycle, and then a final extension of 10 min at 72°C to obtain template DNA.

(explain:

1. The reason for setting the reaction conditions: Using the stepped annealing temperature can screen for a more suitable temperature. Finally, just select the DNA with the deepest band for recovery, and you can obtain high-quality DNA.

2. Template DNA products, the final products are divided into 5 types, 1 type for cotton bollworm, 2 types respectively for diamondback moth and beet armyworm)

Experimental Example 1: Verification of DNA - agarose gel electrophoresis

In order to verify that the template DNA prepared in Example 3 is the target DNA, agarose gel electrophoresis was performed for verification.

1. The detection method is:

Take 0.4g agarose and 40mL 1×TAE solution to prepare a 1% agarose solution, and heat the agarose solution to completely dissolve it. After cooling to about 40°C, add 4 μL of 4S red plus nucleic acid stain at a ratio of 1:10,000. Shake thoroughly, pour it into a glass plate, insert a comb, and wait for it to cool down and solidify.

After complete solidification, remove the comb, take out the glass plate and put it into the electrophoresis tank, mix 5 μL template DNA solution and 1 μL 6×DNA loading buffer and add the sample. The electrophoresis condition is 120V. Run for about 30 minutes until the sample reaches two-thirds of the gel. Take out the electrophoresis gel and observe the electrophoresis results in the imaging recorder.

The template DNA solutions are respectively the template DNA of cotton bollworm, diamondback moth, and beet exigua prepared according to the method of Example 3.

2. Testing standards:

The target gene of Helicoverpa armigera is 308bp. If compared with the marker, there is a clear band at about 300bp, the verification is considered successful;

Similarly, if the other four fragments have bands at 500bp, it is considered that the PCR experiment was successfully amplified. After successful verification, perform a gel recovery experiment to re-obtain DNA. This method can remove non-specifically bound impurity DNA and select only the desired DNA band to ensure the purity of plasmid ligation and reduce the possibility of false positive plasmids.

3. Test results: see Figures 2 and 3

The length of the target cDNA of Helicoverpa armigera is 308 bp. There is an obvious band at 300 bp in Figure 2, which proves that the obtained cDNA is the target gene.

The cDNA lengths of the diamondback moth Plutella xylostella and the beet armyworm Spodoptera exigua are between 400 and 500 bp. As shown in Figure 3, there are obvious bands at less than 500 bp, indicating that the next step of ligation and transformation experiments can be carried out. In the figure, from left to right, there are Spodoptera exigua fragment 1 (S1), Spodoptera exigua fragment 2 (S2), Diamondback moth fragment 1 (P1) and Diamondback moth fragment 2 (P2). The gene lengths are 476bp respectively. , 417bp, 498bp and 487bp. S1 and S2 represent two target genes of Spodoptera exigua, and P1 and P2 represent two target genes of Diamondback moth. 3 samples are one gene.

Example 4: Preparation of an engineering bacterium expressing RNA

1. Experimental materials

Escherichia coli HT115 (DE3) strain was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

T Easy vector was purchased from Promega (Beijing) Biotechnology Co., Ltd.

Glycerin, ampicillin, sodium chloride, tryptone, yeast extract powder and agar used to prepare the culture medium were purchased from Shanghai Titan Technology Co., Ltd.

The final concentration of ampicillin culture medium is generally 50 μg/mL. The commonly used storage concentration of ampicillin is 100 mg/mL. That is, dissolve 1 g of ampicillin in 10 mL of deionized water. After dissolution, filter and sterilize with a 0.22 μm filter membrane, and freeze at -20°C. When needed, after dissolving at room temperature, add 25 μL ampicillin to every 50 mL of culture medium.

2. Connection of carrier

2.1 Preparation of plasmid:

The reaction system is: 1 μL of T Easy vector, 2 μL of template DNA (prepared in Example 3, choose one) or control DNA (without adding any DNA), 1 μL of T4 DNA Ligase, 5 μL of 2× Rapid Ligation Buffer, and 1 μL of ddH ₂ O.

Leave it at 4°C overnight to obtain the plasmid.

2.2 Transformation of plasmid

1) First make the E. coli HT115(DE3) strain into competent cells before transformation:

In the first step, take a small amount of the HT115 (DE3) bacterial liquid in a glycerol tube and streak it on a non-resistant plate, and culture it at 37°C overnight.

In the second step, single colonies were picked into LB liquid medium solution and cultured at 37°C for 14 hours to the late logarithmic growth phase.

Next, inoculate the bacterial solution into LB liquid culture medium at a ratio of 1:50, and shake at 37°C until OD ₆₀₀ ≈0.5 (Note: OD ₆₀₀ is the absorbance value of the solution at a wavelength of 600 nm). Transfer the above bacterial solution into two new centrifuge tubes and place them on crushed ice for 10 minutes. After the bacterial solution has cooled, centrifuge at 4,000 rpm and 4°C for 10 minutes and discard the supernatant. Add 10 mL of pre-cooled 0.1 mol/L sterile CaCl ₂ solution to suspend the cells, incubate in crushed ice for 30 min, centrifuge at 4,000 rpm for 10 min at 4°C, and discard the supernatant. Add 4 mL of pre-cooled 0.1 mol/L sterile CaCl ₂ solution containing 15% glycerol, mix thoroughly and place in crushed ice for 10 min to obtain competent cells. Dispense 100μL/tube and store at -80℃.

Competent cells are easily inactivated, and the thawing time should not be too long. The early stage of transformation experiments must be performed on ice.

2) Take 50 μL of competent cells, add 5 μL of plasmid prepared in step 1), and place in crushed ice for 30 minutes. After heat shock at 42°C for 60 seconds and ice bath for 2 minutes, add 900 μL LB liquid medium and perform recovery in a shaker at 37°C for 1 hour. Centrifuge at 4°C and 4,000 rpm for 5 minutes to concentrate the bacterial solution. After discarding 800 μL of the supernatant, apply 100 μL on a plate containing ampicillin (50 μg/mL) resistance, and culture at 37°C overnight until a single colony grows. Pick a single colony and place it in ampicillin (50 μg/mL)-resistant LB liquid medium, and culture it at 37°C overnight to obtain the engineered bacteria expressing RNA.

(Explanation: The final product is divided into 5 species, 1 species of cotton bollworm, 2 species of diamondback moth and beet exigua)

Experimental Example 2: Verification of Engineering Bacteria-Agarose Gel Electrophoresis

Preliminarily judge whether the transformation is successful by whether the band size is consistent with the size of the target gene. The main experimental operation principle is to amplify the DNA in the bacterial solution again with the same primers, and then conduct agarose gel electrophoresis. If there is an obvious band at 300 bp, it means that the bacteria contains the target gene, that is, the transformation is successful.

1. Whether the plasmid was successfully introduced into E. coli cells:

The inspection process is divided into two steps:

1) Do bacterial liquid PCR

The PCR system is: 1 μL of Taq plus DNA polymerase, 2 μL of bacterial liquid DNA (prepared in Example 3), 2 μL of the upstream primer of the corresponding pest (10 μM), 2 μL of the downstream primer of the corresponding pest (10 μM), dNTP Mixure (with Mg ²⁺ ) (25mM) 1μL, 10×PCR buffer 5μL, ddH ₂ O17μL.

Reaction conditions: pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 45 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 45 seconds, 30 cycles of denaturation, annealing, and extension, and then final extension at 72°C for 10 minutes.

2) The PCR reaction solution is subjected to electrophoresis verification. The electrophoresis verification steps are the same as those described in Experimental Example 1.

2. Through sequencing experiments, it was observed that the sequence has been successfully connected to the vector. Comparing the known acetylcholinesterase gene sequence, it can be seen that the plasmid already contains the target gene sequence, and a few genes have mutated, but their mutations are not It will affect the subsequent induced expression and the effect of double-stranded RNA. Therefore, it can be confirmed that the plasmid has been successfully transferred into E. coli HT115(DE3). (See Figure 4-8 for details)

Example 5: Double-stranded RNA produced by engineering bacteria

The engineered bacteria produce double-stranded RNA under the induction of IPTG (Isopropyl-β-D-Thiogalactoside).

1. Pick a single colony of the engineering bacteria prepared in Example 4 and culture it in 50 ml of LB liquid culture medium containing 50ug/mL ampicillin at 37°C and 200rpm overnight;

2. Add 1 mL of the overnight bacterial culture solution to 50 ml of 2×YT culture medium containing 50 ug/mL ampicillin, and culture and shake at 37°C and 200 rpm until OD600>0.8;

3. Add IPTG inducer to the solution so that the final concentration of the inducer is 0.4mM. Continue shaking the culture at 37°C and 200rpm for several hours, and then obtain double-stranded RNA;

The inducer is Isopropyl-β-D-thiogalactoside (IPTG), and the storage concentration is 0.1M. Weigh 238 mg of IPTG inducer on a weighing balance into a 10 mL quantitative bottle, and adjust the volume to the mark with deionized water. After it is completely dissolved, take a 0.22 μm filter membrane, filter and sterilize, and put it into a 1.5 mL sterile EP tube, and place it at -20°C. stored under conditions;

4. Dispense 1 ml/tube, centrifuge at 4,000 rpm for 10 minutes at 4°C, discard the supernatant, and freeze-dry the remaining bacterial slurry to obtain the double-stranded RNA expressed by the engineering bacteria;

The freeze-drying method is: pre-freeze at -80°C for 4 to 5 hours, turn on the vacuum freeze dryer and pre-freeze half an hour in advance, remove the cap from the 50mL centrifuge tube containing the pre-frozen bacterial slurry, and cover the mouth of the tube with a film. Leave a number of breathable holes on the membrane (this step prevents impurities from falling into the freeze-drying process and ensures the purity of the freeze-dried product). Place the centrifuge tube on the centrifuge tube rack and place it in a vacuum freeze dryer at a cold trap temperature of -50~ The freeze-dried product can be obtained by vacuum freezing for 18 hours at -53℃ and pressure of 6~6.50Pa.

Experimental example 3: Feeding experiment

The gene silencing effect of double-stranded RNA expressed by engineered bacteria in different lepidopteran insects was tested by feeding, to explore the tolerance of different lepidopteran insects to RNA interference, to test the degree of lethality caused by RNA interference, and to determine whether it can cause Good RNA interference effect.

1. Experimental materials

1) Insects: Helicoverpa armigera, diamondback moth Plutella xylostella and beet armyworm Spodoptera exigua larvae and feed were purchased from Henan Keyun Biopesticide Co., Ltd. The gastric poisoning experiment was carried out in a light incubator, with 16 hours of white light and 8 hours of darkness every day, a temperature of 26 to 28°C, and a relative humidity of 40%.

2) Primers: see Table 2

In the experiment of measuring the gene silencing efficiency of RNA interference by reverse transcription-fluorescence quantitative PCR, the gene primers were synthesized according to the literature of Yojana et al. [Document 1], Gaddelapati et al. [Document 2] and Jing et al. [Document 3] and internal reference gene primers, as shown in Table 2.

Table 2: Primer sequences for reverse transcription-fluorescence quantitative PCR

F represents the upstream primer and R represents the downstream primer.

2. Experimental methods

The double-stranded RNA (5 types) expressed by the engineering bacteria prepared in Example 5 was extracted with Trizol reagent. The specific extraction method is:

Add 500 μL Trizol reagent to the centrifuged bacteria, mix thoroughly and place at room temperature for 10 minutes. Add 200 μL of chloroform, shake vigorously for 30 seconds, place at room temperature for 3 minutes, visible stratification, centrifuge at 12,000 rpm for 10 minutes at 4°C. At this time, the sample is divided into three layers. Take the upper water phase into a new EP tube, add an equal volume of isopropyl alcohol, mix thoroughly and place it at room temperature for 20 minutes. Centrifuge at 12,000 rpm for 10 min at 4°C and discard the supernatant.

Add 1 mL of 75% ethanol prepared with DEPC-treated water, centrifuge at 12,000 rpm for 3 min at 4°C, and discard the supernatant. Allow to dry at room temperature for several minutes to completely remove ethanol and residual organic solvents. Add 50 μL RNase Free ddH ₂ O to dissolve the RNA to obtain the extracted double-stranded RNA bacterial solution.

3. Detection indicators:

3.1 Electrophoresis verification:

The extracted double-stranded RNA was verified by agarose gel electrophoresis. Please see Experimental Example 1 for electrophoresis verification steps.

3.2 Stomach poison experiment-fourth instar larvae

3.2.1 Experimental method: Feed the corresponding three kinds of larvae respectively with the double-stranded RNA bacterial liquid (prepared in the previous 2) extracted from three pests such as armigera armigera, beet armyworm and diamondback moth. One is feeding;

In addition, three kinds of larvae were fed with bacterial liquid containing only HT115 (DE3) competent cells as a control group.

Fourth-instar larvae were selected for feeding, and 10 μL of bacterial liquid was added to the feed every day, and dissection was performed after 3 days of feeding.

3.2.2 Detection location and indicators: Take out the brain and extract the total RNA in the cells. The specific operation is the same as in Example 2.

3.2.3 Reverse transcription-fluorescence quantitative PCR

Reverse transcription-fluorescence quantitative PCR, that is, reverse transcription quantitative polymerase chain reaction (RT-qPCR), refers to reverse transcribing RNA into cDNA and then performing PCR and combining it with fluorescence quantitative detection. In combination, Syber Green I is used as a fluorescent dye, and the signal of the fluorescent group is used to monitor the entire PCR process in real time, and finally obtain the Ct value.

1) Preparation of template cDNA

Reverse transcription system preparation: template RNA (prepared in Example 5) 7 μL, Random Primer 1 μL, 2×TSReaction Mix 10 μL, Trans Script RT/RI Enzyme Mix 1 μL, gDNA remover 1 μL.

The reverse transcription reaction conditions are as follows: pre-reaction, cDNA synthesis, and heat inactivation. The pre-reaction is 25°C for 10 min, the cDNA synthesis is 42°C for 15 min, and the heat inactivation is 85°C for 5 sec. (The purpose is to remove TransScript RT/RI enzyme and gDNA remover)

2) PCR reaction:

Prepare a real-time quantitative PCR system solution. The preparation system is: 3 μL of template cDNA, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 10 μL of 2×Perfect Start Green qPCR Super Mix, and 6.2 μL of ddH ₂ O.

The prepared sample was added to the eight-tube strip and put on the machine. The reaction conditions were as follows: 94°C for 30 seconds, 94°C for 5 seconds, 53°C for 15 seconds, 72°C for 10 seconds, and 45 cycles of the latter three.

(Note: The upstream primers and downstream primers corresponding to the template cDNA of Helicoverpa armigera A are the upstream and downstream primers in Table 2; the upstream primers and downstream primers corresponding to the template cDNA of Diamondback moth P1 are the upstream and downstream primers of Diamondback moth P1 in Table 2. and so on)

3.2.4 Inspection indicators-Inspection of the degree of silence:

1) Investigation method: Use a three-step method to perform qPCR on a computer. The three-step method can improve amplification efficiency. Finally, the data is viewed on the computer and processed.

2) By detecting the expression level of acetylcholinesterase gene in pests, we can determine whether the genes in pests are silenced after feeding double-stranded RNA, what is the degree of silencing, and whether the introduced double-stranded RNA is actually working. .

During the measurement, the concept of an internal reference gene will be introduced to correct the sample error in the experiment. It refers to a gene with relatively constant expression in the organism. It is used as a reference and subtracted from the number of samples measured, that is, the Determine the expression level of genes in organisms. Through internal reference genes, more realistic data can be obtained. The internal reference gene generally selects β-actin gene.

After obtaining the Ct value of each sample, plot 2^(-△△Ct) as the ordinate and each double-stranded RNA gene as the abscissa. in,

△△Ct=△Ct (positive sample)-△Ct (negative sample) (Formula 1)

△Ct (positive sample) = Ct (positive sample, use target gene primers) - Ct (positive sample, use internal reference gene primers)

(Formula 2)

△Ct (negative sample) = Ct (negative sample, use target gene primers) - Ct (negative sample, use internal reference gene primers)

(Formula 3)

In the above formula:

Ct value, C represents Cycle, t represents threshold, which is the number of PCR cycles that each reaction takes to reach the set threshold. Therefore, the more template copies, the faster it reaches the threshold cycle number. , the smaller the Ct value.

The internal reference gene generally selects the β-actin gene;

3.3 Stomach poison experiment-second instar larvae

Divide the second-instar larvae into multiple groups, such as drug-added group and negative control group, with 10 larvae in each group, and add 10 μL of drug to the feed every day.

The dosing group added the prepared target RNA (prepared in Example 5), added equal concentration of enzyme-free water to the centrifuged double-stranded RNA, and fed the insects. The negative control is E. coli bacterial liquid without adding plasmid, that is, pure HT115 (DE3) competent cells are cultured in 50mL LB liquid medium under the same conditions overnight. Centrifuge at 4,000rpm for 10 minutes at ℃, discard the supernatant, and store the precipitate at -80℃. When in use, add equal concentration of enzyme-free water before feeding.

4. Experimental results

4.1 Verification of double-stranded RNA: see Figures 9 and 10

In order to determine the optimal induction temperature and time, the length of the target gene of Helicoverpa armigera is 308bp:

As can be seen from Figure 9, when the induction time is the same, there is an obvious band corresponding to 300bp at 37°C, but no band appears at 32°C; when the induction temperature is the same, a band appears at 5h but not at 4h. Therefore, It can be seen that the production of double-stranded RNA cannot be guaranteed when the temperature is too low or the induction time is short. Therefore, 5 hours of induction at 37°C was selected as the optimal induction condition for subsequent gastric poisoning experiments. In addition, the bright bar at 100 bp in the figure The bands are other RNA in the bacterial solution, such as 5S RNA, 16S RNA, 23SRNA and other impurities.

When conducting induction experiments on the diamondback moth Plutella xylostella and the sugar beet armyworm Spodoptera exigua, various induction times (4h, 5h and 6h) and induction temperatures (37°C and 32°C) were also used. As can be seen from Figure 10, most of them were in If there is an obvious band at 500bp, select the most obvious samples, record the best time, and conduct subsequent gastric poisoning experiments. The optimal induction temperature was 37°C, the optimal induction time for Plutella xylostella P1 and Spodoptera exigua S1 was 6 hours, and the optimal induction time for Plutella xylostella P2 and Spodoptera exigua S2 was 5 hours.

4.2 Reverse transcription-fluorescence quantitative PCR: see Figures 11, 12, and 13

Using reverse transcription-fluorescence quantitative PCR, the expression level of the acetylcholinesterase gene in the pests was obtained. Compared with the pests fed only E. coli, it can be seen that the expression level of the gene in the pests is reduced, that is, the degree of gene silencing. Efficiency and effects of RNA interference. After measuring the expression level of each gene, through calculation, the inhibition degree of each sample RNA can be obtained, that is, the value of 2^(-△△Ct), which can be used as the ordinate to draw Figure 11-13.

As can be seen from Figure 11, Figure 12 and Figure 13, P2, which is the second segment of the target gene of the diamondback moth Plutella xylostella, has the best gene silencing effect, while S1, which is the first segment of the beet armyworm Spodoptera exigua, has the lowest gene silencing effect. . The silencing effect of the Helicoverpa armigera gene is also very good, second only to P2.

Overall, the silencing effects were within 20% except for P1. The next step will be to conduct a gastric poisoning experiment to observe the lethality of these samples to smaller larvae.

4.3RNA interference

Synthetic double-stranded RNA was fed to the second-instar larvae of Helicoverpa armigera, Plutellaxylostella and Spodoptera exigua, and varying degrees of death were observed.

For Helicoverpa armigera, in order to determine the RNA interference effect of the acetylcholinesterase gene at different induction times, double-stranded RNA after induction for 5h and 6h was fed respectively, and compared with the negative control group, that is, the bacterial solution containing only HT115 (DE3). For comparison, there are 10 items in each group. The larvae died after feeding, with mortality rates of 40% and 60% respectively. The worms turned black, while other undead worms grew slowly and were significantly smaller than the negative control. They were also affected during the development process. hinder.

2) The RNA interference gastric poisoning experiment of the diamondback moth Plutella xylostella and the beet armyworm Spodoptera exigua also has three groups, namely gene 1, gene 2 and negative control group, each group has 10 animals. The genes P1 and P2 of the diamondback moth Plutellaxylostella caused 40% and 50% mortality respectively; while the two groups S1 and S2 of the beet armyworm Spodopteraexigua had mortality rates of 30% and 50% respectively. Similarly, the undead insects showed obvious symptoms of dysplasia, with significantly smaller body size and longer cocooning time. The final pupation rate of Plutella xylostella was 50% in P1 and 40% in P2; the final pupation rate of Spodoptera exigua was Termination pupae rates were 30% and 10%. It can be seen from the figure that Ace 2 is smaller than Ace 1, which also shows that the second gene has a greater impact on the growth and development of larvae.

5. Analysis and summary

First of all, in terms of the preparation of engineering bacteria, the double-stranded RNA of the three pests was successfully expressed in the recombinant engineering bacteria. This not only enhanced the stability of the double-stranded RNA fragments in the environment and in the insect body, but also improved the stability of the double-stranded RNA fragments directly synthesized in vitro. The double-stranded RNA has an extra layer of protection from E. coli, and it also shows that the method of using E. coli to produce double-stranded RNA is universally applicable, and this result can be applied to other different insects or different genes in the future.

In addition, by taking advantage of the fact that bacteria can be continuously cultured, this method effectively greatly increases the yield of double-stranded RNA, especially compared with in vitro synthesis kits, which greatly reduces its production cost. These factors make double-stranded RNA It becomes possible to apply it in pesticide production, not just in the laboratory.

In terms of RNA interference technology, we chose to introduce it into the pests through feeding. All three acetylcholinesterase genes showed a certain gene silencing phenomenon, indicating that RNA interference is conservative.

The inventor tried to prepare double-stranded RNA of different pests into wettable powder, and screened the double-stranded RNA of each pest with different auxiliary materials. The results were similar. Examples 6-9 are used as examples below to illustrate the specificity of target RNA of cotton bollworm. Excipient screening process:

Example 6: Screening of wettable powder-carrier

1. Carrier type and dosage

The carrier is kaolin, bentonite, diatomaceous earth or white carbon black.

2. Dosage

2.1 Drug loading 10%

Take different carriers and add the original drug (lyophilized powder prepared in Example 5) at a ratio of 90%. The mass ratio of raw materials and carriers is 90:10. After thorough mixing, freeze-dry to prepare a mother powder.

The freeze-drying method is freeze-drying, which is the same as the freeze-drying method in step 4 of Example 5.

2.2 Drug loading 4.8%:

Mix the raw materials (lyophilized powder prepared in Example 5) and different carriers at a mass ratio of 20:1 (100 parts of raw materials, 5 parts) evenly, and freeze-dry to prepare a master powder.

2.3 Different ratios:

Based on the above screening results, determine the carrier, and then mix the carrier with the original drug at different mass ratios. The weight ratio of the carrier to the raw material is 15:1, 12:1, 9:1, 6:1, 3:1, and grind Mix thoroughly with an instrument and freeze-dry to prepare master powder.

3. Detection indicators:

The prepared master powder was stored at room temperature for 3 days before conducting experiments:

3.1 Determination of wettability; adopt the national standard GB/T5451-2001 to measure. The specific method of measuring wetting time is as follows:

(l) Take 100 mL ± 1 mL of hard water and place it in a 250 mL beaker. Under a constant temperature water bath of 25°C, keep the liquid level inside the beaker flush with the two external liquid levels;

(2) When the temperature of the hard water in the beaker reaches 25±1°C, weigh 5g of the sample powder on the weighing paper, pour all the samples evenly into the hard water along the position flush with the mouth of the beaker, and time the time immediately while adding the sample , until the sample is completely wetted, stop timing and record the wetting time;

(3) The sample wetting process is repeated 5 times, and the wetting time is accurate to seconds and the average value is taken to obtain the wetting time.

3.2 Sample suspension rate: measured according to the national standard GB/T14825-2006. The specific method for measuring the suspension rate is as follows:

(l) Weigh an appropriate amount of sample on a weighing balance, record the mass as W1g (accurate to 0.0001g), add it to a 200mL beaker containing 50mL of hard water, shake for 2 minutes to form a suspension, and place the suspension in a 30±1°C water bath 13min, wash all the suspension with 30±1℃ hard water into a 250mL graduated cylinder and set the volume;

(2) Take the bottom of the measuring cylinder as the axis, cover the measuring cylinder, turn the measuring cylinder over 30 times within 1 minute, then open the measuring cylinder stopper, put it vertically into a constant temperature water bath, and let it stand for 30 minutes;

(3) Use a pipette to remove 9/10 (i.e. 225mL) of the suspension within 10 to 15 seconds (be careful to avoid sucking the sediment into the measuring cylinder), and move the remaining 1/l0 to a drying oven for drying, and measure its dry weight. Denote it as W2g.

(4) Calculate the weight suspension rate of the sample:

Sample weight suspension rate (%) = 10/9×(sample mass W1-dry matter mass W2)/sample mass W1×100%

3.3 Investigation on the vitality of freeze-dried bacteria

Electrophoresis verification: Add 0.1g of the master powder prepared in 2.1, 2.2, and 2.3 into a 5mL centrifuge tube, add enzyme-free water to the same concentration to reconstitute, and centrifuge. Pour off the supernatant, and use the Trizol method to extract double-stranded RNA from the precipitate in the centrifuge tube. Conduct an electrophoresis experiment on the obtained RNA solution to verify the presence of the double-stranded RNA target band (the method is the same as Experimental Example 1);

Comparison of RNA concentration: Take part of the obtained RNA solution and use it with the Nanodrop nucleic acid concentration detector to determine the RNA concentration of the master powder prepared with the same mass ratio and different carriers to determine the RNA content of different samples. Open the Nanodrop sampling arm, add 2 μL of sample into the sampling arm each time, read the data and record it. Wipe off the remaining sample liquid in the sampling arm between changing samples to prevent cross-interference between samples (i.e. Nanodrop Nucleic Acid Concentration Detector reading).

4. Experimental results

4.1 Physical and chemical properties of drug loading capacity of 10%: see Table 3

Table 3: Effects of different carriers on the physical and chemical properties of preparations

Original drug content (%) carrier Wetting time(s) Suspension rate (%) 10 kaolin 39 43 10 Bentonite 38 62 10 diatomite 35 71 10 white carbon black 29 69

It can be seen from Table 3:

From a wetting perspective, silica preparations have the shortest wetting time, taking 29 seconds, followed by diatomaceous earth preparations, which take 35 seconds. There is little difference in wetting time between kaolin and bentonite preparations;

From the perspective of suspension rate, the suspension rate of the preparations corresponding to silica black and diatomite is relatively high, close to the national standard value of ≥70%.

Generally speaking, silica has the best wetting effect and diatomite has the highest suspension rate. However, the suspension rate of silica is close to that of diatomite and its performance is also good. Therefore, it is advantageous to initially select silica as the carrier. .

4.2 Drug loading 5%

1) The electrophoresis diagram is shown in Figure 14:

In the figure, in the samples corresponding to the four carriers of kaolin, bentonite, diatomite and silica, double-stranded RNA bands appear at 500 bp (the length of the Plutella xylostella gene fragment is between 400 and 500 bp, slightly less than 500bp), among which, the sample band corresponding to kaolin clay is relatively shallow. As a carrier, kaolin clay’s adsorption performance for the original drug is not as good as the other three carriers. The double-stranded RNA content in the samples corresponding to the other three carriers is higher. Higher.

2) RNA concentration comparison: see Figure 15

As can be seen from Figure 19, the control group (control group, no carrier is added) has the lowest RNA concentration at only 21ng/μL due to lack of carrier protection. In addition, among the samples corresponding to the four carriers, kaolin corresponds to The concentration of the RNA solution of the sample is the lowest, less than 50ng/μL. The concentration of the RNA solution of the samples corresponding to bentonite and diatomite is not much different, while the concentration of the RNA solution corresponding to the silica black is the highest, reaching 370ng/μL, which is higher than the RNA concentration of the control group. , indicating that white carbon black can effectively protect sample components as a carrier.

Based on the previous carrier suspension rate, wetting time, electrophoresis band and RNA concentration analysis, silica was selected as the best carrier. The following is a discussion of the results of the optimal addition mass ratio of silica.

4.3 Different drug loading amounts

1) Electrophoresis verification results: as shown in Figure 16

In the figure, it can be seen that the RNA solutions extracted under different mass ratios all have a band at 500bP (the length of the Plutella xylostella gene fragment is between 400 and 500bp, slightly less than 500bp), and the depth of the band is slightly different. Among them, When the mass ratio of silica to original drug is 6:1, the band is the most obvious and the double-stranded RNA content is the highest. When the mass ratio of the two is 3:1, the band here becomes lighter than the former, and the double-stranded RNA content is the highest. The content of stranded RNA decreases, and when the mass ratio of the two is 15:1, the band is the shallowest.

2) RNA concentration comparison: see Figure 17

In the figure, when the mass ratio of silica to original drug is 15:1 and 12:1, the RNA concentration is lower than that of other groups. Under the mass ratio of 12:1, the RNA concentration is about 200ng/μL. At this time, the RNA The concentration is the lowest, and when the mass ratio is 9:1, the RNA concentration is significantly higher than before. When the mass ratio is 6:1, the RNA concentration reaches the highest, which is 630ng/μL. When the mass ratio is 3:1, the RNA concentration begins to decrease.

After comprehensive consideration of the electrophoresis bands and RNA concentration diagram, the mass ratio of carrier and original drug of 6:1 was finally selected as the optimal silica addition ratio.

Example 7: Screening of wettable powder-RNase inhibitors

Considering that double-stranded RNA is very easy to degrade in the environment, in order to prolong the storage of wettable powder, adding RNase inhibitors to wettable powder can alleviate RNA degradation. In this experiment, commonly used nuclease inhibitors such as urea and dodecane were used. Sodium sulfate (SDS) was added as a preparation auxiliary to the master powder prepared in Example 6 (mass ratio of silica and original drug 6:1, fully mixed with a grinder to prepare the master powder, and stored at room temperature for 3 days before conducting the experiment), Select the best inhibitor and the best mass ratio of inhibitors.

1. RNase inhibitor:

RNase inhibitors are urea and sodium lauryl sulfate.

2. Dosage:

2.1 Mix the RNase inhibitor and mother powder evenly at a mass ratio of 5:1 to prepare a sample.

2.2 Mix urea, sodium lauryl sulfate and the master powder prepared in Example 6 (mass ratio of silica to original drug 6:1) at a mass ratio of 3%, 5% and 7% respectively to prepare a preparation sample. .

3. Detection method:

After the sample is stored at room temperature for 3 days, add enzyme-free water to an equal concentration and redissolve, centrifuge, discard the supernatant, use the Trizol method to extract double-stranded RNA from the precipitate in the centrifuge tube, and then follow the "Viability of Lyophilized Bacterial Cells" inspection method in Example 6 Conduct testing, and the inspection indicators include: electrophoresis verification and Nanodrop nucleic acid concentration detector detection.

4. Experimental results

4.1 Electrophoresis:

1) Mix the test inhibitor and master powder at a mass ratio of 5:1 and extract double-stranded RNA. The electrophoresis results are shown in Figure 18. In the figure, there is no band at 500bp for the SDS corresponding sample. Since SDS is a cell lysate, bacteria Somatic cells have been destroyed by SDS and are not selected. Urea has an obvious band at 500bp.

2) Use urea as an RNase inhibitor, mix it with the master powder at different amounts of 3%, 5%, and 7%, and then verify the mixed double-stranded RNA bands. The results are shown in Figure 19. When 5% and 3% urea were added, the corresponding band at 500 bp was relatively obvious, but no band was seen in 7% urea. It was judged that the amount added at this time could not inhibit RNase well.

4.2 RNA concentration: SDS and urea were added to the corresponding samples at 3%, 5%, and 7% respectively to measure the RNA concentration. The results are shown in Figure 20. When the addition amount was 3%, the RNA concentration of the corresponding samples of SDS and urea was not much different. , but when the addition amount is 5%, the RNA concentration of the sample corresponding to urea shows the highest value, which is 1040ng/μL, while the RNA concentration of the sample corresponding to SDS does not change much. When the addition amount is 7%, the RNA concentration of the sample corresponding to urea is almost the same. A decrease from before.

Finally, based on the analysis results of electropherogram and histogram data, it was selected that the best RNase inhibitor is urea. The optimal addition amount of urea is 5%. After conversion, the mass of urea, silica and raw materials is 5:60:10.

Example 8: Screening of wettable powder-surfactants

Surfactant is one of the important components in the preparation of wettable powder. Its addition directly affects whether the wettable powder can evenly cover the crops and control objects. The addition of surfactant can increase the adhesion to the crops and control objects. , so it is necessary to select a suitable surfactant. The selection principle is: conduct a preliminary screening based on factors such as wettability, dispersion, price, etc., and then conduct a preliminary screening based on the surfactants on the preparation samples prepared in Example 7 (urea, silica and raw material quality: 5:60:10), further select suitable surfactants.

1. Surfactant:

Sodium dodecyl sulfate (SDS), open powder (BX), sodium lignosulfonate (SL), calcium lignosulfonate (CL).

2. Preparation and inspection of wettable powder samples:

2.1 Mix the four surfactants with the preparation sample prepared in Example 7 (the mass ratio of urea, silica and raw materials is 5:60:10) according to the mass ratio of 3%, 5% and 7% to obtain wettability. Powder sample.

After storing the wettable powder sample for 3 days, compare the RNA concentration according to the "wettability measurement", "sample suspension rate" and "viability investigation of freeze-dried bacterial cells" methods in Example 6, and measure the wetting time, The suspension rate and RNA concentration were repeated multiple times to determine the effects of different surfactants on the physical and chemical properties of the preparation.

2.2 After examining the physical and chemical properties of the four surfactants in 2.1 (wettability measurement, sample suspension rate), add the preparation sample prepared in Example 7 (the mass ratio of urea, silica and raw materials is 5: 5%): 60:10) Prepare a wettable powder sample, and after storing it for 3 days, perform electrophoresis verification and RNA concentration comparison according to the "Viability Investigation of Lyophilized Bacterial Cells" method in Example 6.

3.3 Optimization of the optimal ratio of surfactants and RNase inhibitors

Select surfactants and RNase inhibitors with good performance from the above for compounding, measure the suspension rate and wetting time of the compounded preparation, and select the best proportion.

4. Experimental results

4.1 Physical and chemical properties (wetting time and suspension rate): see Table 4

Table 4: Effect of surfactants on physical and chemical properties of preparations

Surfactant Adding amount(%) Wetting time(s) Suspension rate (%) Sodium dodecyl sulfate (SDS) 3 103 89 Open powder (BX) 3 67 51 Sodium lignosulfonate (SL) 3 85 47 Calcium lignosulfonate (CL) 3 72 69

It can be seen from Table 4 that the wetting time of the pull-apart powder formulation is the shortest, requiring 67 s, followed by the calcium lignosulfonate CL formulation, and the sodium dodecyl sulfate SDS formulation has the longest wetting time, requiring 103 s. However, the four tested The wetting times of the samples are all within the national standard range of ≤120s; from the perspective of suspension rate, sodium dodecyl sulfate (SDS) has the highest suspension rate, reaching 89%, followed by calcium lignosulfonate, which performs better, close to National standard ≥70%.

4.2 Vitality inspection

1) Electrophoresis verification: The results of the inspection of different surfactants with the same mass ratio are shown in Figure 21. The corresponding samples of sodium lignosulfonate SL and calcium lignosulfonate CL have brighter bands at 500bp, which perform better, and the corresponding samples of SDS No band was visible, and the sample corresponding to the pull-apart powder had no visible band at 500bp.

2) RNA concentration investigation: The investigation of different mass ratios of different surfactants is shown in Figure 22. The RNA concentration of the preparation samples corresponding to the three addition amounts of SDS is not too high. It can be seen that SDS has a weak ability to inhibit RNase; 5% pulls away The RNA content of the corresponding samples of powder and 5% sodium lignosulfonate SL is relatively high within its range, but far less than that of 5% calcium lignosulfonate; both sodium lignosulfonate SL and calcium lignosulfonate CL were measured When the corresponding target band is found, the RNA concentration corresponding to calcium lignosulfonate CL is significantly higher than that of sodium lignosulfonate SL, and 5% calcium lignosulfonate corresponds to the highest RNA concentration, which is 1700ng/μL.

In summary, based on the experimental results, calcium lignosulfonate CL was selected as the best surfactant, and the optimal addition amount was 5%.

Example 9: Wettable powder-surfactant and RNase inhibitor ratio optimization results

It can be seen from Figure 20 in Example 7 that when the added amount of urea is 5% and 7%, the RNA content of the corresponding preparation samples is relatively high. It can be seen from Figure 22 in Example 8 that the added amount of calcium lignosulfonate is 5 % and 7%, the RNA content of the corresponding preparation samples was higher, so urea and calcium lignosulfonate were selected to formulate the preparations at the addition amounts of 5%, 6%, and 7% respectively, and the wetting time and suspension rate of the preparation samples were measured. (The method is the same as in Example 5), and the best formula is screened. The results are shown in Table 5 below:

Table 5: Effects of different additive ratios on the physical and chemical properties of preparations

(Note: The data in the table are means ± standard errors. Different letters in the same column indicate significant differences at the 0.05 level)

The data results in Table 5 show:

When the added amount of urea is 7% and the added amount of calcium lignosulfonate is 5%, the suspension rate of this sample is the highest, which is 81.8%;

When the added amount of urea is 5% and the added amount of calcium lignosulfonate is 7%, the wetting time of this sample is the shortest, 76.4 s.

In general, there is no significant difference in the wetting time of each sample, and the difference is not big.

Comprehensive consideration, the urea addition amount is selected to be 6% and the calcium lignosulfonate addition amount is 7%. At this time, the corresponding suspension rate is 76.8%, slightly lower than the highest suspension rate, and the corresponding wetting time is 77.6s, second only to the shortest. Wetting time 76.4s.

Example 10: Optimal Wettable Powder Formula

According to the experiments of Examples 6-9, it was determined that the optimal wettable powder formula is: based on the mass ratio of silica black and original drug of 6:1, add 6% urea and 7% calcium lignosulfonate in sequence.

1. Composition: 100 mg of silica, 10 mg of original drug, 4.2 mg of urea, and 4.9 mg of calcium lignosulfonate.

2. Preparation method: mix well and get it.

Experimental Example 5: Pest Control Experiment with Wettable Powder

1. Experimental materials

The cotton bollworms, diamondback moths and beet armyworms and their food were purchased from Henan Keyun Biological Pesticide Co., Ltd.;

Vegetable seeds were purchased from Xingyun Vegetable Seed Company;

DuPont Kangkuan (20% chlorantraniliprole) was purchased from Suzhou Fumeishi Plant Protection Co., Ltd., and Bacillus thuringiensis was purchased from Hubei Kangxin Agricultural Pharmaceutical Co., Ltd.

2. Test samples

Application group: The wettable powder provided in Example 10 is diluted 300 times with water and set aside.

3. Quality indicators of wettable powder

3.1 The main quality indicators of wettable powder include suspension rate, wetting time, pH value, moisture content, fineness, etc. The wetting time and suspension rate were tested according to the "wettability measurement" and "sample suspension rate" of Example 6, the pH value was measured according to GB/T1601-1993, and the moisture content was measured according to the oven drying weight loss method. The fineness passes 325-objective sieve ≥95%.

3.2 Validity period of wettable powder: Under normal temperature storage conditions, take samples every other month, electrophoresis determine the double-stranded RNA corresponding to the target band, Nanodrop determines the remaining RNA concentration, repeat 3 times.

4. Preparation spraying experiment

Prepare preparations corresponding to three types of insects, as well as mixed preparations that jointly control two or three insects. Spray multiple times to observe the corresponding control effects of each insect and the joint control effect of the mixed preparations on the three insects.

(Explanation: 1) Diamondback moth and beet armyworm can choose one of the RNAs as a representative. After experimental investigation, it has been confirmed that any diamondback moth RNA is effective for diamondback moth. Select one of the diamondback moths to be effective against sugar beets. Spodoptera exigua is also effective; 2) Two or three insect mixed preparations can be compounded according to the insect species, and the ratio between the preparations is 1:1:1)

4.1 Spraying test method:

(1) Diamondback moth spraying experiment:

Select green vegetables as the food source for the diamondback moth and cultivate them in the soil in the laboratory. After the green vegetables grow for 2-3 weeks, place the second-instar diamondback moth larvae on the vegetable leaves. Place 3 to 4 larvae on each leaf. Set up The application group and the control group were sprayed on the leaves every day. The application group was sprayed with the prepared wettable powder solution, and the control group was sprayed with clean water. The spraying time was one week.

(2) Cotton bollworm spraying experiment:

Choose green vegetables as the food source for cotton bollworms. Green vegetables are grown in soil indoors. After sprouting and growing for several weeks, second-instar cotton bollworm larvae are placed on the leaves of the green vegetables. 2 to 3 larvae are placed on each leaf, and pesticides are applied. group and control group, the spraying group sprayed the prepared wettable powder solution, and the control group only sprayed water for about 7 days.

(3) Beet leaf moth spraying experiment:

Select green vegetables as the food source for Spodoptera exigua and cultivate them in soil indoors. After the vegetables grow for a period of time, place second-instar Spodoptera exigua larvae on the leaves. Put 2 to 3 larvae on each leaf and set up a pesticide application group. And the control group, the pesticide application group sprayed the prepared wettable powder solution, and the control group only sprayed water for about 7 days.

(4) Mixed spraying experiment of three kinds of insects:

Choose green vegetables as the food source for the three insects. Plant the vegetables indoors in soil. When each vegetable seedling grows to 10-15 cm, place the second-instar larvae of the three insects on the leaves of the rapeseed. Place one larvae of each type on each leaf. Only. Set up the application group, blank control, negative control and positive control, among which:

Application group: wettable powder prepared in Example 10 diluted 300 times.

Blank control: only spray water.

Negative control: spray common E. coli bacteria liquid.

Positive control (chemical pesticide): Spray DuPont Kanguan (20% chlorantraniliprole) diluted 3000 times.

Positive control (biopesticides): Spray Bacillus thuringiensis diluted 300 times.

Group according to the above and spray the leaves. The experiment lasts for about a week.

4.2 Investigation indicators: Observe the growth of different groups of pests after pesticide application, and analyze and calculate the cannibalization rate of green vegetable leaves.

Leaf cannibalization rate of green vegetables = leaf area eaten/initial leaf area

5. Detection indicators

5.1 Wettable powder quality inspection results: see Table 6

Table 6: Quality indicators of wettable powder

National standard value Measurements Wetting time ≤120s 77.6s Suspension rate ≥70% 76.8% pH 5～8 7.4 Moisture content ≤2.5% 0.09% Fineness ≥95% 98%

5.2 Validity period detection:

Use the double-stranded engineering bacteria corresponding to the genes of Helicoverpa armigera as the original drug, add the carrier and the original drug in a mass ratio of 6:1, then add 6% urea as an RNase inhibitor, and finally add 7% open powder BX and lignin respectively. Sodium sulfonate SL, calcium lignosulfonate CL, and sodium dodecyl sulfate SDS were used as surfactants to prepare four wettable powders, and the freeze-dried original drug was used as the control group, with a total of five samples to be tested. Their electrophoresis bands were measured respectively after being placed at room temperature for one month and six months. The results are shown in Figure 23:

It can be seen from the figure that the calcium lignosulfonate CL that has been stored for about one month corresponds to the brightest band at 300 bp, and no obvious bands are seen in other samples; after six months of storage, the calcium lignosulfonate CL sample corresponds to the target band Still exists, the brightness is not significantly reduced, and the preparation is still effective.

Based on the physical and chemical index data of the RNA interference preparation developed in this experiment, taking into account the later application in actual production, the following are the production quality control indicators of the preparation:

Bacterial fermentation OD600 value range: 0.8 ~ 1.2;

RNA purity: A260/A280 between 1.7 and 2.0;

Preparation CFU value: 3.34×10 ³³ CFU/g

6. Preparation spraying experiment

(1) Diamondback moth spraying results:

Comparing the growth of the two groups of diamondback moths a few days after the pesticide was applied, it can be seen that the growth of the diamondback moth in the drug group was inhibited to a certain extent, and the insect body was generally smaller than the diamondback moth in the control group. The diamondback moth in the picture on the lower right was killed by RNA interference four days after the drug was added.

(2) Results of cotton bollworm spraying:

Place cotton bollworms on green vegetables. After a period of time, cotton bollworms begin to eat the green vegetables, and obvious insect damage appears on the leaves.

Comparing the growth of cotton bollworms after seven days of application with the control group, it can be seen that starting from the third day, the growth of cotton bollworms in the treatment group began to be affected by the drug, and the body size of the insects was slightly smaller than that of the control group. After seven days, the bollworms in the drug-added group stopped growing. Compared with the bollworms in the control group that grew normally, the length of the worms was only one-half, indicating that the bollworms in the drug-added group were greatly affected by RNA interference, and the performance of the preparation Produce better insecticidal effect.

(3) Beet exigua spraying results:

The Spodoptera exigua moths that ate medicated vegetables were restricted in their growth and development in about four to five days and began to gradually stop growing. However, the Spodoptera exigua moths in the control group that ate vegetables sprayed with water ate normally, and their bodies were not affected in any way. They developed normally, and the insects The body length was significantly longer than that of Spodoptera exigua in the drug-treated group.

(4) Spraying results of mixed preparation: see Figure 24

Comparison of the growth of five groups of green vegetables before and after insecticide spraying. The green vegetables grew normally and the leaves were intact before the insecticide was released. A few days after the insecticide was sprayed, the green vegetables in the blank control group and the negative control group were eaten by insects in large numbers, almost Only the meridians and a few residual leaves are left; the insects on the leaves of the experimental preparation group were reduced by RNA interference or stopped eating, and the number of insects was reduced, leaving the green vegetable leaves relatively intact. The chemical pesticide control group's green vegetable leaves were not damaged; spraying After applying chemical pesticides, the insects on the leaves quickly died and fell. The insects in the control group of biological pesticides were also affected by the pesticides on the leaves. After eating, the efficacy of the pesticide evaporated and the insects died quickly.

Comparison of the degree of growth inhibition of three types of insects. Among them, the negative control group sprayed with ordinary E. coli solution and the blank control group sprayed with only clear water had normal growth and development, while the insects in the drug group sprayed with the mixed preparation developed slowly. After seven days, the three insects All showed obvious RNA interference phenomena, and the various insect-repellent effects of the mixed preparations were verified.

Figure 24 shows that from the perspective of leaf cannibalism, as the number of days increases, the green vegetable leaves of the blank control group and the negative control group are more seriously eaten by insects. The leaf surface survival rate of both groups of green vegetables on the third day is 70 %. By the fourth day, the leaf insects entered the third-instar gluttony period and increased their food intake. The remaining rate of green vegetable leaves in the blank group was only 40%, and only 30% of the green vegetables in the negative control group were left. After a week, almost only the remaining green vegetables in the two groups were left. Leaf meridians. In contrast, the growth of the other three groups of vegetables did not change much. After the application of the pesticide in the Dupont Kangkuan group, the effect of the drug was very fast, and the insects died quickly in less than half a day. The leaf larvae in the Bacillus thuringiensis group also died quickly after the application. Leaves fall off. After seven days, the leaf surface survival rates of the two groups were 100% and 98% respectively. The insects in the RNA interference preparation group had a small amount of food on the green vegetables. After 2 to 3 days of eating, the insects were affected by RNA interference, reduced or stopped eating, and then died. Seven days The survival rate of the rear leaf surface is about 90%.

7. Experiment summary:

All physical and chemical indicators of the wettable powder provided by this application comply with national standards, and can maintain a validity period of at least six months at room temperature.

Subsequently, the control effect after the scale-up production of wettable powder was verified. Indoor potted foliage spraying experiments were conducted on cotton bollworm, diamondback moth and beet exigua. On the third day after application, all three insects showed RNA interference effects. , the growth of the insects was restricted, and they all died to varying degrees within seven days of application, with a mortality rate of 85%.

After the separate spraying experiment is successful, consider mixing the preparations that specifically control three insects into a mixed preparation that can control three insects at the same time, and conduct experimental spraying. During this period, other control groups were set up to compare the control effects of RNA interference preparations. The results showed that the chemical control effect of spraying 20% chlorantraniliprole was the best, and its protective effect on green vegetables was as high as 100%. Spraying of thrushin Bacillus, the green vegetables are protected by about 98%, and the preparation provided in this application also protects the green vegetables by up to 95%. Compared with the green vegetables that have not been sprayed with pesticides, the RNA interference preparation has a very good effect in crop protection.

Although the present invention has been described in detail above with general descriptions, specific embodiments and tests, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. . Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims (10)

1. An RNA that causes gene silencing of a pest AChE, which is a cotton bollworm primer pair, or a combination of a cotton bollworm primer pair with one or both of a plutella xylostella primer pair, a asparagus caterpillar primer pair, wherein:

Cotton bollworm a: an upstream primer F GTGGAGACTCAACGAAGATC, seq_1;

a downstream primer R CTCTTAGACCACATAATGAACTC, seq_2;

plutella xylostella P1: an upstream primer F ATTGTTTGGAGAATCGTCCG, seq_3;

a downstream primer R GGATTCAGTTCTCTGACCGC, seq_4; or (b)

Plutella xylostella P2: an upstream primer F GGCAAGAATTACTCACCCGA, seq_5;

a downstream primer R CGGAAAAGCGAGATTCAAAC, seq_6;

beet armyworm S1: an upstream primer F GGCTGTGTCGGTTTCATTG, seq_7;

a downstream primer R GATTCAACTCTCTAACTGCCTGC, seq_8; or (b)

Beet armyworm S2: an upstream primer F GGGAGAAGAAATGTGGAATCC, seq_9;

downstream primer R GCCGACTCACCAAATAATGTTA, seq_10.

2. The engineering bacterium for expressing RNA is characterized in that the raw materials are as follows: the RNA, vector, and competent cell of claim 1.

3. The engineered bacterium of claim 2, wherein the carrier isT Easy vector; the competent cells were E.coli.

4. A method for preparing the engineering bacterium according to claim 2 or 3, comprising the steps of:

1) Preparation of total RNA of pests: extracting intestinal and brain tissues of corresponding pests by using an RNA prepure animal tissue total RNA extraction kit to obtain total RNA of the pests;

2) Preparation of template DNA:

step 1) preparing a total RNA solution of the pests, synthesizing single-stranded cDNA by using an M-MuLV first-strand cDNA synthesis kit, amplifying the single-stranded cDNA solution into double strands with a primer pair of the corresponding pests according to claim 1 by using a polymerase chain reaction (Polymerase chain reaction, PCR) technology, and simultaneously positioning template DNA corresponding to target double-stranded RNA by using the primer;

3) Preparation of plasmids: 1. Mu.L of vector, 2. Mu.L of template DNA prepared in step 2), 1. Mu.L of T4 DNA Ligase, 2X Rapid Ligation Buffer. Mu.L, ddH ₂ O1. Mu.L; standing overnight at 4deg.C to obtain plasmid;

4) Transformation of plasmids: preparing escherichia coli into competent cells, adding the competent cells into the plasmid prepared in the step 3), carrying out heat shock reaction after ice bath, resuscitating in an LB liquid medium, concentrating, discarding supernatant, culturing the precipitate on a ampicillin-containing flat plate overnight, picking single bacterial colony, placing the single bacterial colony in the LB liquid medium containing ampicillin, and culturing to obtain the engineering bacteria expressing RNA.

5. A double-stranded RNA produced by an engineering bacterium, characterized by induced expression by: the engineered bacterium of claim 2 or 3, which produces double-stranded RNA under IPTG induction.

6. The double-stranded RNA according to claim 5, wherein the method of inducing expression comprises the steps of: and (3) picking single bacterial colony, placing the single bacterial colony into ampicillin-containing LB liquid culture medium solution for culturing overnight, taking overnight culture bacterial liquid into ampicillin-containing 2 XYT culture medium solution, carrying out shake culture until the OD600 is more than 0.8, adding IPTG solution, continuing shake culture to obtain double-stranded RNA, centrifuging the double-stranded RNA, removing supernatant, and drying bacterial sludge.

7. A wettable powder comprising double stranded RNA comprising: the double-stranded RNA, vector, surfactant and RNase inhibitor of claim 5.

8. The wettable powder of claim 7, wherein the wettable powder comprises the following components in parts by mass: 10 parts of double-stranded RNA, 30-150 parts of a carrier, 2-9 parts of a surfactant and 2-9 parts of an RNase inhibitor;

preferably, the wettable powder comprises the following components in parts by mass: 10 parts of double-stranded RNA, 60-120 parts of a carrier, 2-5 parts of a surfactant and 2-6 parts of an RNase inhibitor;

further preferably, the wettable powder comprises the following components in parts by mass: 10 parts of double-stranded RNA, 60-90 parts of a carrier, 3.5-5 parts of a surfactant and 3.5-5 parts of an RNase inhibitor;

optimally, the wettable powder comprises the following components in parts by mass: 10 parts of double-stranded RNA, 60 parts of a carrier, 4.2 parts of a surfactant and 4.9 parts of an RNase inhibitor.

9. The wettable powder of claim 7, wherein the surfactant is sodium dodecyl sulfate, nekal, sodium lignin sulfonate or calcium lignin sulfonate, preferably calcium lignin sulfonate;

the carrier is kaolin, bentonite, diatomite or white carbon black, preferably white carbon black;

The rnase inhibitor is urea or sodium dodecyl sulfate, preferably urea.

10. Use of a wettable powder according to any one of claims 7 to 9 in the manufacture of a pesticide for the prevention and control of lepidopteran pests.