CN112522278A - dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof - Google Patents

Abstract

The invention discloses dsRNA designed based on periplaneta americana olfactory receptor gene OR3X, a coding gene, a preparation method and application thereof, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The dsRNA sequence of targeted silent periplaneta americana olfactory receptor gene OR3X is designed and synthesized, and the dsRNA is introduced into the periplaneta americana, so that the expression of the OR3X gene can be obviously inhibited, and the aggregation pheromone released by female and male adults OR the larva of the periplaneta americana is interfered, thereby achieving the purposes of blocking the normal aggregation of the periplaneta americana and finally preventing and controlling the periplaneta americana.

Description

dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof

Technical Field

The invention relates to the field of sanitary pest control, in particular to dsRNA (double-stranded ribonucleic acid) designed based on a periplaneta americana olfactory receptor gene OR3X, a coding gene, a preparation method and application thereof.

Background

Cockroaches are an important worldwide sanitary pest group and pose serious hazards to human health and public health. Cockroaches carry various pathogenic microorganisms, can cause infectious diseases such as cholera, anthrax, tuberculosis and the like, and can also cause allergic reactions such as rash, asthma and the like. Periplaneta americana (Periplaneta americana L.) is one of the most common species of Blattaria, and is also the dominant population in the south China, and has superior environmental adaptability and vitality, and remarkable reproductive and detoxifying abilities. Periplaneta americana has developed into the dominant species of the town cockroach community in China, and the global greenhouse effect is gradually enhanced, the damage and outbreak frequency is increased year by year and the trend of continuous north movement is in existence.

The clustering behavior has very important significance for maintaining the population and survival of single individual, such as large-scale collective migration of animals, searching for new resources, avoiding natural enemies, collective synchronous reproduction and the like. The clustering behavior can improve the success rate of breeding the offspring of the periplaneta americana and the survival capacity of the offspring. For example, the American cockroach reduces the opportunity of aggregation of a spouse and other females by adjusting the synchronism of the reproductive cycle, and simultaneously increases the survival capacity of offspring, so that the American cockroach can aggregate and lay eggs, thereby increasing the ability of the offspring to evade natural enemies and ensuring synchronous hatching; the periplaneta americana can gather and move, so that the progeny can avoid natural enemies and obtain sufficient food, the survival rate of the progeny is improved, and the population reproduction is kept.

The olfactory system of insects is the main sensory system that recognizes odorants, including the central and peripheral nervous systems, where the antennae are extensions of the peripheral nervous system. The recognition of the foreign odor molecules by insects is mainly dependent on the antennae. The surface of the antenna is distributed with different types of nose receptors (commonly called sensory hair), the epidermis of the receptors is provided with a plurality of pores, and external odor molecules can enter the receptors through the pores. Olfactory Receptors (OR) are key proteins that recognize external odorant molecules, and can convert chemical signals into electrical signals, which are finally transmitted into the central nervous system. Olfactory receptors can be divided into two broad categories: one type is highly variable among different insects, has very low homology, and is called a traditional odorant receptor (PR), which includes a general odorant receptor and a pheromone receptor; the other is an atypical odorant receptor which is highly conserved among different insects, also known as odorant receptor co-receptor or complex receptor (Orco), which is well conserved in structure and function, and can form heterodimers with various conventional olfactory receptors to assist the latter in correctly positioning olfactory neurons and functioning as co-receptors. The common olfactory receptor can recognize specific external odorant molecules only by forming specific cation channels together with highly conserved Orco.

At present, the prevention and the treatment of the periplaneta americana mainly depend on the traditional chemical pesticide, but the problems of drug resistance, drug residue, rampant and the like are increased day by day, and the health and the ecological environment of people and livestock are seriously threatened. Therefore, the development of a new biological control method and the exploration of a new American cockroach control strategy are imperative.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. Therefore, the invention provides a periplaneta americana olfactory receptor gene OR3X which can be used for controlling the periplaneta americana.

The invention also provides a method for preparing the dsRNA of the gene.

The invention also provides dsRNA of the gene.

The invention also provides a coding gene of the dsRNA of the gene, and an expression vector, a transgenic cell line or a host bacterium containing the coding gene.

The invention also provides the application of the gene.

The periplaneta americana olfactory receptor gene OR3X according to the first aspect embodiment of the present invention has the nucleotide sequence shown in SEQ ID No. 1.

The method for preparing the above-mentioned gene dsRNA according to the second aspect embodiment of the present invention comprises the steps of: and carrying out PCR amplification by using cDNA of the periplaneta americana olfactory receptor gene OR3X as a template and using an interference primer group as a primer.

According to some embodiments of the invention, the set of interfering primers comprises an upstream primer OR3X Fp and a downstream primer OR3X Rp, wherein the nucleotide sequence of the upstream primer OR3X Fp is shown in SEQ ID No. 5; the nucleotide sequence of the downstream primer OR3X Rp is shown as SEQ ID NO. 6.

According to some embodiments of the invention, the preparation method is in particular: the primer group is used for amplifying a dsRNA targeting sequence DNA fragment of a targeted silent OR3X gene, the amplified DNA fragment is cloned to a pMD18-T vector named pMD18-T-OR3X, then a primer with T7 promoters at two ends is designed by taking pMD18-T-OR3X as a template, and PCR amplification is carried out to obtain the dsRNA targeting sequence.

According to some embodiments of the invention, the nucleotide sequence of the upstream primer OR3X T7-FP of the primer containing the T7 promoter at two ends is shown as SEQ ID No. 7; the nucleotide sequence of the downstream primer OR3X T7-RP is shown as SEQ ID No. 8.

According to some embodiments of the invention, the dsRNA targeting sequence is obtained by transcription synthesis using T7RiboMAX Express RNAi System.

According to some embodiments of the invention, the dsRNA is used in the preparation of a drug for controlling periplaneta americana.

According to some embodiments of the invention, the dsRNA is used in the preparation of a product for interfering with the aggregation of american cockroach into a population.

According to some embodiments of the invention, the dsRNA is used in the preparation of a product for controlling the aggregation and reproduction of periplaneta americana.

According to the dsRNA of the above gene of the third aspect of the present invention, the dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown as SEQ ID No.2 as a sense strand and the nucleotide sequence SEQ ID No.3 reverse-complementary to the nucleotide sequence shown as SEQ ID No.2 as an antisense strand.

According to some embodiments of the invention, the nucleotide sequence of the dsRNA is as shown in SEQ ID No. 9.

The coding gene of dsRNA of the gene according to the fourth aspect of the invention and an expression vector, a transgenic cell line or a host bacterium containing the coding gene.

According to some embodiments of the invention, the method of preparing the gene comprises the steps of: designing a promoter primer pair based on the gene nucleotide sequence, and carrying out PCR amplification to obtain the gene.

According to some embodiments of the invention, the gene further comprises an expression vector, an expression cassette, a transgenic cell line or a host bacterium comprising the gene.

According to some embodiments of the invention, the expression vector is pMD 18-T.

According to some embodiments of the invention, the host bacterium is DH5 a.

The application of the gene is the application in preparing the periplaneta americana control medicament.

A method for controlling American cockroaches comprises the following steps: the dsRNA is introduced into the periplaneta americana.

According to some embodiments of the invention, the introducing is by way of injection; preferably, the injection operation is microinjection.

According to some embodiments of the invention, the introducing is performed into the abdominal cavity of the adult american cockroach.

According to some embodiments of the invention, the introducing may also be by feeding.

According to some embodiments of the invention, the introducing is performed before the operation by subjecting the periplaneta americana to CO₂And (6) anaesthetizing.

According to some embodiments of the invention, the injection is from the 3 rd to the 4 th abdominal segments along the abdomen from the bottom up direction.

According to some embodiments of the invention, the introducing is performed by injection on the third day immediately after eclosion.

The invention has the beneficial effects that: the invention provides a periplaneta americana olfactory receptor gene OR3X, wherein a dsRNA sequence for targeted silencing of the periplaneta americana olfactory receptor gene OR3X is synthesized by design, and the dsRNA is introduced into the periplaneta americana to remarkably inhibit the expression of the OR3X gene so as to interfere aggregation pheromone released by male and female adults OR periplaneta americana larvae, thereby achieving the purposes of blocking the remarkable aggregation of the periplaneta americana and finally preventing and controlling the periplaneta americana.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

FIG. 1 is a graph showing the results of expression levels of OR3X gene in different tissues in example II of the present invention;

FIG. 2 is a graph showing the results of the expression level of OR3X gene at a time after emergence in the second example of the present invention;

FIG. 3 is a graph showing the results of the interference efficiency of OR3X gene in example III of the present invention;

FIG. 4 is a graph showing the odor selection result of the periplaneta americana males on the body feces after the OR3X gene interference in the third example of the present invention.

Detailed Description

In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments. The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

A dsRNA designed based on periplaneta americana olfactory receptor gene OR3X, wherein the sense strand sequence of the nucleotide sequence of the dsRNA is shown as SEQ ID No.2, the antisense strand sequence is a nucleotide sequence (shown as SEQ ID No. 3) which is reversely complementary with the nucleotide sequence shown as SEQ ID No.2, and the preparation process is as follows: molecular cloning is carried out on the sequence (shown as SEQ ID No.1) of the olfactory receptor OR3X gene, and DNA sequencing is carried out to check the authenticity and homology of the sequence, so that the dsRNA product of the periplaneta americana olfactory receptor gene OR3X with qualified quality and reliable effect is obtained by using an in vitro synthesis method.

The periplaneta americana strain is purchased from Tengfei breeding base (Anhui, China), and is fed into a plastic box with good air permeability for a long time in a closed greenhouse with the feeding environment of 28 +/-1 ℃, the relative humidity of 70-80% and reasonable light period (light: dark: 12 h). And periodically, on time and in quantity, sufficient dog food (purchased from aijia biotechnology, tianjin) and drinking water were given to periplaneta americana. And sorting the emerged male and female insects, and aggregating the female and male insects as required to maintain the number and the scale of the population.

Example 1: design and Synthesis of dsRNA

The design and synthesis of dsRNA comprise the following steps:

(1) primer design

From the reported sequences of OR3X genes of other species, homologous alignment is carried out in the periplaneta americana genome to obtain the complete sequence of the periplaneta americana olfactory receptor gene OR3X (shown as SEQ ID No. 1). The dsRNA design website E-RNAi (https:// www.dkfz.de/signalling/E-RNAi 3/), the whole periplaneta americana olfactory receptor gene OR3X open reading frame sequence is copied and pasted to the website, and the dsRNA target sequence I (shown as SEQ ID No. 2) is obtained by screening design parameters. Designing a primer according to the nucleotide sequence shown in the sequence SEQ ID No.2, wherein a forward primer OR 3X-Fp: ATTGCACGGAATTTGTT (SEQ ID No.5) and a reverse primer OR 3X-Rp: AGTCTGAGTAGTGGACTG (SEQ ID No. 6).

The sequence of the olfactory receptor gene OR3X of periplaneta americana (SEQ ID No.1) is as follows:

ATGAAACATCGCCTTTGTCAGAACGACGTCGGACTCCACGCCACTACCCTCTGTCT AGCAGCAATCATAAAAATACCCCCGTCAGCTCAGGGCCAGGGCTGCATAGGGGGTTGCT GCCACCCCACGCCAGTTCTGAATCTAGCTCTGCTGAAGACGAAGCAAGTTTTTCAAGTT ATCGGCTGCAGCCGCCATCCGGGTTCTCTGATAGCCGTGAACTGAGTGAGGCGGAATGT GACAGGGACAACACACTACATCTTGACAAGCTACTTGCAAGGTTCCAACAGGAGAAGG AGCAAGAACGCCTCCAGTTCACCATACATGTGTGATAAGTGAGATGAAAAGTGTGAATG ATTGCATGCCTTATCCATGTGGATCCGAACATTTGGGGCTTCTTCCCCATACAGTCGGGG AATCTCTTCATGAAAAATTGAGTCCATGGCATTCTCTTAGAAGTAGGCTGAATTTATCTTT ACAATTTGGCAACTCTGTGAATCTTGAGTTGCCCCTGAGCGCAATAACCTGCAACTACCA TGAACCCCTTGGAAAACTTTTCTTTTTTTTTCCCCAGATGAAGTTGGAGTTTCCTTTCGA CCCATTGGATTGTAGTAAATTGCACGGAATTTGTTTATATCATCTAGATAAATCCATGCATC ATCCAGAGAAACCACCCATTGCCACTTTTCACCTGCCAGGTGGTGTTTGTACAGTTGTTT AGCGTTCTCTGAGGTGCTGCTCTTTCAACAAGTGTCTGCTTGCTTTATGCCACTGCTCTA GACCCAAATTTTCATGAATTATGCGATAAACTGTGCCTTTAGATGTGCGGTTGGCGATGC TTCCTTGTGTTTGTGGATTTTCTTGTGTCGCTGCTGCCCTCACCTTGGCCACTATTGCTGT TCTTTGTGTGAGTTGCGTCCTTTGTCTCGTTAATTTTTTCCCGCATTGCACACCGAATGAA TCCCGGTGCAGTGACAGTCCACTACTCAGACTACAATAATTTGCACATAATAGTTCATTG TGTGACACCATTTTCACAGCCTGAATGACAGTTGCATGGTATGTGTGACGTTAATACACA TTCAGAATTCATACTGTAACTCTCTGCAATCGTTTAATTTATTTCTATGTGAAATTCGAACC GAGTATTCTAAAAACTTATCTATGTTAGTTCAAGATAAGCACCGAACATAAAAATTAAATT AATTGTAAATGAAATTCTTTTCAGAAGGGTCCACAGAAATAAAATATATTAATTAA。

the dsRNA targeting sequence I (shown as SEQ ID No. 2) of the targeted silent periplaneta americana olfactory receptor gene OR3X is as follows:

ATTGCACGGAATTTGTTTATATCATCTAGATAAATCCATGCATCATCCAGAGAAACCA CCCATTGCCACTTTTCACCTGCCAGGTGGTGTTTGTACAGTTGTTTAGCGTTCTCTGAGG TGCTGCTCTTTCAACAAGTGTCTGCTTGCTTTATGCCACTGCTCTAGACCCAAATTTTCAT GAATTATGCGATAAACTGTGCCTTTAGATGTGCGGTTGGCGATGCTTCCTTGTGTTTGTG GATTTTCTTGTGTCGCTGCTGCCCTCACCTTGGCCACTATTGCTGTTCTTTGTGTGAGTTG CGTCCTTTGTCTCGTTAATTTTTTCCCGCATTGCACACCGAATGAATCCCGGTGCAGTGA CAGTCCACTACTCAGACT。

the dsRNA targeting sequence (shown as SEQ ID No. 3) of the targeted silent periplaneta americana olfactory receptor gene OR3X is as follows:

AGTCTGAGTAGTGGACTGTCACTGCACCGGGATTCATTCGGTGTGCAATGCGGGAA AAAATTAACGAGACAAAGGACGCAACTCACACAAAGAACAGCAATAGTGGCCAAGGT GAGGGCAGCAGCGACACAAGAAAATCCACAAACACAAGGAAGCATCGCCAACCGCAC ATCTAAAGGCACAGTTTATCGCATAATTCATGAAAATTTGGGTCTAGAGCAGTGGCATAA AGCAAGCAGACACTTGTTGAAAGAGCAGCACCTCAGAGAACGCTAAACAACTGTACAA ACACCACCTGGCAGGTGAAAAGTGGCAATGGGTGGTTTCTCTGGATGATGCATGGATTT ATCTAGATGATATAAACAAATTCCGTGCAAT。

(2) cloning of target fragment and construction of vector

Samples of the tentacles (male and female), mouthparts, forepaws, brains, wings, spermary and ovaries of the periplaneta americana adults were ground with liquid nitrogen and placed into TRIzol reagent (Life technologies, Carlsbad, CA, USA), and total RNA of the samples was extracted according to a standard procedure. The concentration of sample RNA was determined using a NanoDrop 2000 micro-spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA) and detected electrophoretically. After treating the genomic DNA remaining in the sample with TURBO DNase (Life technologies, Carlsbad, Calif., USA), RNA having an initial concentration of 2. mu.g was unified as a template for cDNA synthesis. The cDNA synthesis system used PrimeScript II reverse transcriptase (Takara Bio, Shiga, Japan) and oligo (dT) primers (Promega, Madison, Wis., USA) and synthesized cDNA templates according to the instructions. Amplifying by taking cDNA as a template to obtain a DNA fragment with a nucleotide sequence shown as SEQ ID No.4, cloning the DNA fragment into a pMD18-T vector (Aidlab, China), verifying whether the sequence has base mutation by sequencing, selecting a clone without any mutation for subsequent experiments, and naming the vector as pMD18-T-OR 3X.

(3) Transformation of recombinant vectors

The constructed vector was ligated to a transformed competent bacterium (DH 5. alpha.) to prepare a recombinant strain. Screening out positive clone, and extracting recombinant plasmid after amplification culture.

(4) Synthesis of OR3X dsRNA

Designing a primer containing a T7 promoter at two ends, wherein OR3X T7-Fp: TAATACGACTCACTATAGGATTGCACGGAATTTGTT (shown as SEQ ID No. 7) and OR3X T7-Rp: TAATACGACTCACTATAGGAGTCTGAGTAGTGGACTG (shown in SEQ ID No. 8). Amplifying by taking a pMD18-T-OR3X vector as a template to obtain a PCR product with two ends containing a T7 promoter, synthesizing forward and reverse RNAs by utilizing a T7RiboMAX Express RNAi System (Promega, Madison, Wisconsin, USA), mixing the two forward and reverse RNAs after sequentially treating T7 RNA polymerase and DNaseI, treating at 70 ℃ for 10min, and gradually cooling to room temperature to anneal the RNAs into dsRNA I, wherein the sequence is double-stranded RNA consisting of a nucleotide sequence shown by SEQ ID No.2 and a nucleotide sequence shown by SEQ ID No.3 which is reversely complementary with the nucleotide sequence shown by SEQ ID No. 2. The sequence of the mRNA fragment targeted by dsOR3X is shown in SEQ ID No. 9.

Similarly, dsGFP primers were designed based on GFP gene sequence: GFP Fp: CACAAGTTCAGCGTGTCCG (shown in SEQ ID No. 10) and GFP Rp: GTTCACCTTGATGCCGTTC (shown in SEQ ID No. 11). A DNA fragment II containing a target sequence is obtained by amplification by using a plasmid pEGFP-N1(Takara, Kusatsu, Shiga Prefecture, Japan) as a template, and a vector is obtained after cloning, sequencing and sequence verification of the DNA fragment II and is named as pMD 18-T-GFP. Designing a primer containing a T7 promoter at two ends, GFP T7 Fp: TAATACGACTCACTATAGGCACAAGTTCAGCGTGTCCG (SEQ ID No.12) and GFP T7 Rp: TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC (SEQ ID No. 13). The PCR product with both ends containing T7 promoter was obtained by amplification using pMD18-T-GFP vector as template, and then dsRNA II was synthesized using T7RiboMAX Express RNAi System (Promega, Madison, Wis., USA), the sequence being double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID No. 14.

The DNA sequence (shown as SEQ ID No. 4) of the olfactory receptor gene OR3X of the periplaneta americana in a targeted manner is as follows:

ATTGCACGGAATTTGTTTATATCATCTAGATAAATCCATGCATCATCCAGAGAAACCA CCCATTGCCACTTTTCACCTGCCAGGTGGTGTTTGTACAGTTGTTTAGCGTTCTCTGAGG TGCTGCTCTTTCAACAAGTGTCTGCTTGCTTTATGCCACTGCTCTAGACCCAAATTTTCAT GAATTATGCGATAAACTGTGCCTTTAGATGTGCGGTTGGCGATGCTTCCTTGTGTTTGTG GATTTTCTTGTGTCGCTGCTGCCCTCACCTTGGCCACTATTGCTGTTCTTTGTGTGAGTTG CGTCCTTTGTCTCGTTAATTTTTTCCCGCATTGCACACCGAATGAATCCCGGTGCAGTGA CAGTCCACTACTCAGACT。

the dsRNA sequence (shown as SEQ ID No. 9) of the olfactory receptor gene OR3X of the periplaneta americana in a targeted way is as follows:

AUUGCACGGAAUUUGUUUAUAUCAUCUAGAUAAAUCCAUGCAUCAUCCAGAGA AACCACCCAUUGCCACUUUUCACCUGCCAGGUGGUGUUUGUACAGUUGUUUAGCGU UCUCUGAGGUGCUGCUCUUUCAACAAGUGUCUGCUUGCUUUAUGCCACUGCUCUAG ACCCAAAUUUUCAUGAAUUAUGCGAUAAACUGUGCCUUUAGAUGUGCGGUUGGCGA UGCUUCCUUGUGUUUGUGGAUUUUCUUGUGUCGCUGCUGCCCUCACCUUGGCCACU AUUGCUGUUCUUUGUGUGAGUUGCGUCCUUUGUCUCGUUAAUUUUUUCCCGCAUUG CACACCGAAUGAAUCCCGGUGCAGUGACAGUCCACUACUCAGACU。

the dsRNA sequence (shown as SEQ ID No. 14) of the targeted silent periplaneta Americana GFP gene specifically comprises the following steps:

CACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUG ACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUG ACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAG CACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUC UUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACAC CCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCC UGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGAC AAGCAGAAGAACGGCAUCAAGGUGAAC。

example 2 expression levels of OR3X in different tissues and different development times of Periplaneta americana

Primer premier5 primer design software was used to design qPCR primers. Fluorescent quantitative PCR assay the primers used were as shown in table 1, gene expression was quantitatively determined using SYBR Green qPCR mix (yisheng, China), and the expression levels of OR3X gene in antennal (male and female), oral apparatus, forefoot, brain, wing, testis and ovary were determined by the quantitative PCR method (as shown in fig. 1), and further the expression levels of OR3X gene in antenatal and postnatal drone antenatal (as shown in fig. 2).

As can be seen from FIG. 1, the expression level of OR3X gene in antennal is higher, and the expression level of male antennal is not obviously different from that of female antennal, indicating that there is no sex expression difference of OR3X, which is consistent with the characteristic that the aggregation pheromone is only related to the aggregation signal of the population and is not related to the sex difference. As can be seen from fig. 2, the expression level of the OR3X gene is greatly different before and after eclosion, especially the expression level is high from day 4 to day 7 after eclosion, which may be related to the tendency of large-scale aggregation of periplaneta americana.

TABLE 1 primer sequences for OR3X Gene quantitative PCR

Example 3 dsRNA interference Effect on OR3X Gene

(1) dsRNA (double-stranded ribonucleic acid) for specifically inhibiting periplaneta americana olfactory receptor gene OR3X by injecting into periplaneta americana living body

The male and female periplaneta americana insects which are just finished eclosion and are healthy are selected and singly raised and divided into an experimental group and a control group (dsGFP which can not target any gene of the periplaneta americana is injected), the male and female insects are treated in a carbon dioxide damage-free anesthesia mode on the third day after eclosion and then are placed on a dissecting table, and 2 mu g of dsRNA which targets the OR3X gene is slowly injected into the abdominal cavity of the male and female and male insects along the 3 rd to 4 th abdominal nodes (from the bottom to the top) of the abdominal cavity by using a microinjection method. The same dose of GFP gene interference fragment was injected at the same time as a negative control. The periplaneta americana males which have finished injecting the dsRNA are still placed in the Y-selection glass tube alone; and adding the purified fecal extract. The start time of aggregation and the duration of the aggregation process of males and females were continuously observed and photographed. To ensure an effective statistical number of repeats, 20 Periplaneta americana males were injected with dsRNA of OR3X gene and GFP gene.

(2) Verification of interference effect of dsRNA on OR3X gene

After 48 hours of dsRNA (including OR3X gene and GFP gene) injection, the male periplaneta americana is anesthetized by carbon dioxide, tentacles are cut off and taken down, the tentacles are ground by liquid nitrogen and then put into a TRIzol reagent, total RNA of the tentacles is extracted according to a standard process, the concentration of the total RNA is measured by using a ultramicro spectrophotometer Nanodrop 2000(Thermo Fisher Scientific, Waltham, Massachusetts, USA), and then 2 mu gRNA is taken for reverse transcription to obtain cDNA. Quantitative PCR was used to detect the effect of interference with the target gene (the specific quantitative primer sequences are shown in Table 1).

The interference ratio of OR3X gene was calculated as (dsGFP expression level-dsOR 3X expression level)/dsGFP expression level X100%.

The results of the interference efficiency of OR3X gene are shown in FIG. 3, from which it can be seen that the expression level of OR3X gene in the antennal was reduced by 51.8%. As the abundantly expressed gene is easier to be subjected to RNAi induced silencing, the result not only shows the main expression site of the antenna OR3X gene, but also shows that the RNAi induced silencing system has high efficiency in the periplaneta americana.

(3) Y-shaped tube experiment after OR3X gene interference

The odor selection results of the periplaneta americana males on feces after the OR3X gene interference are shown in fig. 4, and it can be seen from the figure that the periplaneta americana males injected with the OR3X gene dsRNA have significantly reduced preference for odor selection as compared with the control group, which is indicated by the failure to correctly identify feces containing an aggregated odor. The aggregation time of the periplaneta americana in the OR3X gene interference group is delayed and few of the periplaneta americana in the injection control group have no aggregation phenomenon, and a Y-shaped tube selection experiment proves that the tropism of the periplaneta americana drone to the aggregation smell disappears, so that the obvious delaying effect and weakening effect of the interference OR3X gene on the aggregation behavior of the periplaneta americana can be demonstrated.

The invention carries out intensive research on the gathering behavior of the periplaneta americana by an olfactory receptor OR3X, determines the expression levels of an antennal (male and female), a mouth organ, a forefoot, a brain, a wing, a testis and an ovary, and further determines the expression level of an OR3X gene of the antennal and postero-androgens. The response degree of the drone antennal to the aggregation pheromone is detected on the basis of the determination of the efficiency of the interference OR3X, in particular of the antennal OR3X, which is closely related to the sense of smell. The results show that a reduction in the transcription level of OR3X significantly reduced the recognition of aggregated odors by the american cockroach androsterone and further examined the differences in selection preferences.

In conclusion, the olfactory receptor OR3X gene provided by the invention deeply researches the gathering behavior of the periplaneta americana, and as the olfactory sense is indispensable in the process of identifying the gathering pheromone of the periplaneta americana, the olfactory receptor of the periplaneta americana is identified at the early stage, and the receptor gene OR3X is found to have a key role in the gathering and reproduction process of the periplaneta americana. The result of the invention shows that the interference of the expression of the olfactory receptor gene OR3X can obviously weaken the aggregation of the periplaneta americana, and a new strategy is provided for the prevention and control of the periplaneta americana.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.

Sequence listing

<110> university of south China

Guangmeiyuan R & D center, Key Laboratory of insect developmental biology and applied technology, Huashi, Meizhou City

<120> dsRNA designed based on periplaneta americana olfactory receptor gene OR3X, coding gene, preparation method and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1254

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaacatc gcctttgtca gaacgacgtc ggactccacg ccactaccct ctgtctagca 60

gcaatcataa aaataccccc gtcagctcag ggccagggct gcataggggg ttgctgccac 120

cccacgccag ttctgaatct agctctgctg aagacgaagc aagtttttca agttatcggc 180

tgcagccgcc atccgggttc tctgatagcc gtgaactgag tgaggcggaa tgtgacaggg 240

acaacacact acatcttgac aagctacttg caaggttcca acaggagaag gagcaagaac 300

gcctccagtt caccatacat gtgtgataag tgagatgaaa agtgtgaatg attgcatgcc 360

ttatccatgt ggatccgaac atttggggct tcttccccat acagtcgggg aatctcttca 420

tgaaaaattg agtccatggc attctcttag aagtaggctg aatttatctt tacaatttgg 480

caactctgtg aatcttgagt tgcccctgag cgcaataacc tgcaactacc atgaacccct 540

tggaaaactt ttcttttttt ttccccagat gaagttggag tttcctttcg acccattgga 600

ttgtagtaaa ttgcacggaa tttgtttata tcatctagat aaatccatgc atcatccaga 660

gaaaccaccc attgccactt ttcacctgcc aggtggtgtt tgtacagttg tttagcgttc 720

tctgaggtgc tgctctttca acaagtgtct gcttgcttta tgccactgct ctagacccaa 780

attttcatga attatgcgat aaactgtgcc tttagatgtg cggttggcga tgcttccttg 840

tgtttgtgga ttttcttgtg tcgctgctgc cctcaccttg gccactattg ctgttctttg 900

tgtgagttgc gtcctttgtc tcgttaattt tttcccgcat tgcacaccga atgaatcccg 960

gtgcagtgac agtccactac tcagactaca ataatttgca cataatagtt cattgtgtga 1020

caccattttc acagcctgaa tgacagttgc atggtatgtg tgacgttaat acacattcag 1080

aattcatact gtaactctct gcaatcgttt aatttatttc tatgtgaaat tcgaaccgag 1140

tattctaaaa acttatctat gttagttcaa gataagcacc gaacataaaa attaaattaa 1200

ttgtaaatga aattcttttc agaagggtcc acagaaataa aatatattaa ttaa 1254

<210> 2

<211> 378

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

attgcacgga atttgtttat atcatctaga taaatccatg catcatccag agaaaccacc 60

cattgccact tttcacctgc caggtggtgt ttgtacagtt gtttagcgtt ctctgaggtg 120

ctgctctttc aacaagtgtc tgcttgcttt atgccactgc tctagaccca aattttcatg 180

aattatgcga taaactgtgc ctttagatgt gcggttggcg atgcttcctt gtgtttgtgg 240

attttcttgt gtcgctgctg ccctcacctt ggccactatt gctgttcttt gtgtgagttg 300

cgtcctttgt ctcgttaatt ttttcccgca ttgcacaccg aatgaatccc ggtgcagtga 360

cagtccacta ctcagact 378

<210> 3

<211> 378

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agtctgagta gtggactgtc actgcaccgg gattcattcg gtgtgcaatg cgggaaaaaa 60

ttaacgagac aaaggacgca actcacacaa agaacagcaa tagtggccaa ggtgagggca 120

gcagcgacac aagaaaatcc acaaacacaa ggaagcatcg ccaaccgcac atctaaaggc 180

acagtttatc gcataattca tgaaaatttg ggtctagagc agtggcataa agcaagcaga 240

cacttgttga aagagcagca cctcagagaa cgctaaacaa ctgtacaaac accacctggc 300

aggtgaaaag tggcaatggg tggtttctct ggatgatgca tggatttatc tagatgatat 360

aaacaaattc cgtgcaat 378

<210> 4

<211> 378

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

attgcacgga atttgtttat atcatctaga taaatccatg catcatccag agaaaccacc 60

cattgccact tttcacctgc caggtggtgt ttgtacagtt gtttagcgtt ctctgaggtg 120

ctgctctttc aacaagtgtc tgcttgcttt atgccactgc tctagaccca aattttcatg 180

aattatgcga taaactgtgc ctttagatgt gcggttggcg atgcttcctt gtgtttgtgg 240

attttcttgt gtcgctgctg ccctcacctt ggccactatt gctgttcttt gtgtgagttg 300

cgtcctttgt ctcgttaatt ttttcccgca ttgcacaccg aatgaatccc ggtgcagtga 360

cagtccacta ctcagact 378

<210> 5

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

attgcacgga atttgtt 17

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agtctgagta gtggactg 18

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taatacgact cactatagga ttgcacggaa tttgtt 36

<210> 8

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

taatacgact cactatagga gtctgagtag tggactg 37

<210> 9

<211> 378

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

auugcacgga auuuguuuau aucaucuaga uaaauccaug caucauccag agaaaccacc 60

cauugccacu uuucaccugc cagguggugu uuguacaguu guuuagcguu cucugaggug 120

cugcucuuuc aacaaguguc ugcuugcuuu augccacugc ucuagaccca aauuuucaug 180

aauuaugcga uaaacugugc cuuuagaugu gcgguuggcg augcuuccuu guguuugugg 240

auuuucuugu gucgcugcug cccucaccuu ggccacuauu gcuguucuuu gugugaguug 300

cguccuuugu cucguuaauu uuuucccgca uugcacaccg aaugaauccc ggugcaguga 360

caguccacua cucagacu 378

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cacaagttca gcgtgtccg 19

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gttcaccttg atgccgttc 19

<210> 12

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

taatacgact cactataggc acaagttcag cgtgtccg 38

<210> 13

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

taatacgact cactataggg ttcaccttga tgccgttc 38

<210> 14

<211> 420

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cacaaguuca gcguguccgg cgagggcgag ggcgaugcca ccuacggcaa gcugacccug 60

aaguucaucu gcaccaccgg caagcugccc gugcccuggc ccacccucgu gaccacccug 120

accuacggcg ugcagugcuu cagccgcuac cccgaccaca ugaagcagca cgacuucuuc 180

aaguccgcca ugcccgaagg cuacguccag gagcgcacca ucuucuucaa ggacgacggc 240

aacuacaaga cccgcgccga ggugaaguuc gagggcgaca cccuggugaa ccgcaucgag 300

cugaagggca ucgacuucaa ggaggacggc aacauccugg ggcacaagcu ggaguacaac 360

uacaacagcc acaacgucua uaucauggcc gacaagcaga agaacggcau caaggugaac 420

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctacatcttg acaagctact t 21

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tccacatgga taaggcatgc 20

Claims (10)

1. The periplaneta americana olfactory receptor gene OR3X is characterized in that: the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. A method of making an interfering sequence dsRNA for the gene OR3X of claim 1, wherein: the method comprises the following steps: and carrying out PCR amplification by using cDNA of the periplaneta americana olfactory receptor gene OR3X as a template and using an interference primer group as a primer.

3. The method of claim 2, wherein: the interference primer group comprises an upstream primer OR3X Fp and a downstream primer OR3X Rp, wherein the nucleotide sequence of the upstream primer OR3X Fp is shown as SEQ ID NO. 5; the nucleotide sequence of the downstream primer OR3X Rp is shown as SEQ ID NO. 6.

4. An interfering sequence dsRNA for the gene OR3X of claim 1, wherein: the dsRNA is double-stranded RNA which is composed of a nucleotide sequence shown as SEQ ID No.2 as a sense strand and a nucleotide sequence SEQ ID No.3 which is reversely complementary with the nucleotide sequence shown as SEQ ID No.2 as an antisense strand.

5. The dsRNA of claim 4, which is characterized in that: the nucleotide sequence of the dsRNA is shown as SEQ ID No. 9.

6. The use of the dsRNA of claim 4 in the preparation of a medicament for the control of periplaneta americana.

7. Use of the dsRNA of claim 4 for the preparation of a product for interfering with the aggregation of periplaneta americana into a population.

8. Use of the dsRNA of claim 4 for the preparation of a product for controlling the reproduction of Periplaneta americana.

9. The application of the gene OR3X in preparing the control drug for Periplaneta americana according to claim 1.

10. A method for controlling American cockroaches comprises the following steps: introducing the dsRNA of claim 4 into Periplaneta americana.

Images