CN111606989B

CN111606989B - Application of reproductive development related gene UCP and dsRNA thereof in prevention and control of bactrocera dorsalis

Info

Publication number: CN111606989B
Application number: CN202010533560.9A
Authority: CN
Inventors: 郑薇薇; 张芮; 张宏宇; 李晓杨
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-06-15
Filing date: 2020-06-15
Publication date: 2022-04-08
Anticipated expiration: 2040-06-15
Also published as: CN111606989A

Abstract

The invention discloses a gene related to reproductive developmentUCPApplication of dsRNA (double-stranded ribonucleic acid) thereof in controlling bactrocera dorsalis and novel geneUCPParticipating in regulating the ovarian development and the fertility of female citrus fruit fly and designing a target geneUCPDsRNA silencing ofUCPThen, the female bactrocera dorsalis shows an extremely obvious phenomenon of ovarian development retardation, the egg laying amount is extremely lower than that of a control group, and therefore, the geneUCPCan be used as a new target for preventing and controlling bactrocera dorsalis.

Description

Application of reproductive development related gene UCP and dsRNA thereof in prevention and control of bactrocera dorsalis

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to application of a gene UCP related to reproductive development of bactrocera dorsalis and dsRNA thereof in prevention and control of bactrocera dorsalis.

Background

Bactrocera dorsalis (Hendel), also known as Oriental fruit fly (Oriental fruit fly), commonly known as fruit maggot, belongs to Diptera of Diptera, Tephritidae, Bactrocera, is a devastating fruit and vegetable pest in China, and seriously harms more than 250 fruits and vegetables such as oranges, mangoes and the like. The insect mainly uses larva to eat and harm fruits, and does not cause fruit turning harm; the latent living hazard of the larvae makes the larvae difficult to perceive from the appearance of fruits and often spread along with damaged fruits, packages, transportation tools and the like in a long distance; after the pest is introduced into an non-epidemic area, the pest can quickly spread harm when meeting suitable environmental conditions, and the pest poses serious threat to the development of local fruit and vegetable industry, so the pest is classified as a worldwide quarantine pest. Therefore, the control of bactrocera dorsalis is still an important problem to be faced by people.

In recent years, the research on bactrocera dorsalis has been advanced, and the initial biological foundation and ecology has been gradually shifted to the field of molecular biology. Insect reproduction is critical to the reproduction of its species. During population reproduction and expansion, the reproductive system is critical to maintaining population size and duration. Sexual mating is an important link in insect population reproduction, and reproductive fitness is influenced after interference of physiological factors and external ecological factors of some insects. Reproductive development of female insects mainly includes ovarian development, reproductive behavior and fertility. Because the adult citrus fruit fly needs to undergo reproductive development for a period of time after eclosion to achieve sexual maturity and further mate and lay eggs, the genes related to reproductive development of the female citrus fruit fly adult are identified and researched from the perspective of preventing and controlling pests, the regulation and control capability of the female citrus fruit fly adult fly on ovarian development and fertility is determined, and the green sustainable treatment measures of the citrus fruit fly are favorably developed.

Research shows that a plurality of genes and a plurality of signal pathways participate in regulating the reproductive development process of the female insects. The reproduction of female insects is regulated by various hormones, and in pattern insects such as Drosophila, Blattella germanica and Aedes aegypti, insulin and ecdysone signal pathways can influence the formation of ovarian yolk so as to regulate the reproduction of the insects. Comparative studies before and after the occurrence of drosophila ova demonstrated that the insulin signaling pathway regulates lipid stores and inhibits growth transitions. Knockout of Hr39, the Beadex gene, and the neuropeptide-related genes Nep1, Nep2, Nep4 by drosophila resulted in a significant decrease in fertility and egg production. In aedes aegypti, oocyte formation is regulated by a blood feeding triggered pathway responsible for transcription of the Vg gene, with the 20E signal being the major regulator. Inhibition of matrix metalloproteinase (Mmps) activity leads to delayed ovarian development of Bombyx mori, whereas overexpression of Mmps promotes ovarian development. In addition to the research on the genes related to the reproductive development of model species such as drosophila, the reproductive development of bactrocera dorsalis has also been greatly advanced in recent years. The silencing of genes BdRab40, csn3, csn5 and pts of bactrocera dorsalis can inhibit the development of ovaries and obviously reduce the egg laying amount. In the research on the bactrocera dorsalis vitellin receptor VgR, the VgR is found to be specifically expressed in ovarian tissues and plays an important role in the transportation and absorption of Vg, and the ovarian development can be remarkably inhibited by silencing VgR through an RNAi technology. The inhibition of the vitellin gene (Bdyp1) causes the hypoevolutism of ovaries, the egg laying amount is obviously reduced, and the egg laying device of female insects is malformed. In conclusion, the research on reproductive development mainly focuses on the transcriptional gene or signal pathway related to yolk deposition, so that the intensive research on the reproductive development related gene of the female citrus fruit fly can provide comprehensive data for explaining the complex mechanism of reproductive development and is helpful for developing efficient and green pest control strategies.

Disclosure of Invention

In order to solve the problems, the invention provides a novel gene UCP participating in the regulation and control of the reproductive development of bactrocera dorsalis, after the gene is silenced, the ovarian development of the bactrocera dorsalis is inhibited, the egg laying amount is obviously reduced, and the gene UCP can be used as a novel target for preventing and controlling the bactrocera dorsalis.

In order to achieve the purpose, the invention adopts the following technical scheme:

the nucleotide sequence of the citrus fruit fly reproductive development related gene UCP is shown as SEQ ID NO.1, and the coded amino acid sequence thereof is shown as SEQ ID NO. 2.

dsRNA of citrus fruit fly reproductive development related gene UCP, which consists of nucleotide with a sequence shown as SEQ ID NO.3 and nucleotide which is reversely complementary with the nucleotide, is obtained by the following steps:

performing genome-removing reverse transcription by taking citrus fruit fly 9-day-old female adult ovarian RNA (1 mu g) as a template to obtain cDNA; taking cDNA as a template, carrying out common PCR amplification (primer UCP-T7F: GGATCC TAATACGACTCACTATAGGCTGCTTGGCGTCTGCTTA, UCP-T7R: GGATC CTAATACGACTCACTATAGGTTGCTGCTTACATTCACCTT), recovering a target gene fragment by using a DNA gel recovery kit, and recovering a product for further synthesizing dsRNA. Can also be obtained by artificial synthesis.

The application of the bactrocera dorsalis gene UCP as a target gene in regulating the ovarian development and the fertility of the female bactrocera dorsalis is verified by the following method:

1) the method comprises the following steps of (1) adopting a preliminary-eclosion 3d female bactrocera dorsalis imago as an experimental insect, injecting 1 mu l of 2000ng target gene dsRNA into the abdomen of each test insect, treating two biological replicates each by taking dsEgfp with the same injection amount as a control, and carrying out three replicate experiments with 180 treated insects each;

2) the ovarian morphology and the oviposition amount of the RNAi bactrocera dorsalis are measured, and the result shows that about 60 percent of extremely obvious ovarian development retardation phenomenon appears after UCP is silenced; the average egg laying amount of 1-15 days per day of the treated group is lower than that of the control group, and the treatment groups have significant differences on days 1, 3, 5, 7, 9 and 11; the total egg production of the treatment group (28 grains) was also significantly lower than that of the control group (130 grains).

3) Samples of female adult ovaries and fat bodies 24h after dsUCP injection are dissected respectively, total RNA is extracted and is reversely transcribed into cDNA, and the cDNA is detected through qPCR. After finding that UCP is silenced by qPCR detection, the expression quantities of Vg1, Vg2 and VgR are all obviously up-regulated, and the endocytosis related gene Endopilin B1 is obviously down-regulated. The above results indicate that silencing UCP may be used to regulate ovarian development and fertility of female citrus fruit fly by affecting endocytosis.

Therefore, the UCP gene participates in regulating and controlling the ovarian development and the egg laying amount of female adults, plays an important role in the reproductive development of the female citrus fruit fly, after the UCP is silenced by dsRNA, the ovarian development is inhibited, the egg laying amount is obviously reduced, the gene UCP can be used as a new target for preventing and controlling the citrus fruit fly, and the dsRNA can be used for preventing and controlling the citrus fruit fly or used for preparing a citrus fruit fly insecticide by regulating the reproductive development of the female insect.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the invention discloses a gene UCP sequence related to the reproductive development of bactrocera dorsalis for the first time at home and abroad, and no related report is provided for the function of the gene capable of regulating and controlling the reproductive development of the female bactrocera dorsalis. RNAi experiments using Bactrocera dorsalis as a receptor prove that compared with a control group, the treatment group has an extremely obvious phenomenon of ovarian development retardation, and the egg laying amount is extremely lower than that of the control group. The female citrus fruit fly adult UCP silencing can effectively inhibit the development and egg laying amount of the ovary of the citrus fruit fly, thereby being beneficial to the green sustainable prevention and control of the citrus fruit fly.

Drawings

FIG. 1: effect of injected dsUCP on bactrocera dorsalis ovary development and oviposition. A-C: ovarian morphology injected with dsEgfp; D-F: ovarian morphology injected with dsUCP; scale bar 500 μm, 7 d: seven days after eclosion, 10 d: ten days after eclosion, 13 d: thirteen days after eclosion; g: mean diameter of ovaries (. mu.m); h: oviposition of single female in 15 days after mating; i: total egg laying amount of a single bactrocera dorsalis 15 days after mating; indicates significant differences at P <0.05 level, indicates significant differences at P <0.01 level, and indicates significant differences at P <0.001 level.

FIG. 2: the influence of dsUCP24 hours after the female adult is injected on the UCP expression quantity of the gene is detected.

FIG. 3: the influence of dsUCP on the expression quantity of related genes (Vg1, Vg2, VgR and Endophilin B1) is detected after the female adults are injected for 24 hours.

Detailed Description

The following examples facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were all available commercially, unless otherwise specified.

Example 1: cloning of citrus fruit fly reproductive development related gene UCP and in-vitro synthesis of dsRNA thereof

The UCP gene is identified and obtained from a bactrocera dorsalis female adult transcriptome library, the nucleotide sequence of the UCP gene is shown as SEQ ID NO.1, and the coded amino acid sequence of the UCP gene is shown as SEQ ID NO. 2.

Firstly, gene fragment primers (table 1) containing a T7 promoter are designed by utilizing Primer Premier 5 software according to transcriptome sequence information, common PCR amplification is carried out by taking 9-day-old female bactrocera dorsalis adult cDNA as a template, a target gene fragment is recovered by a DNA gel recovery kit, and a recovered product is used for further synthesizing dsRNA. At the same time, dsRNA of the Egfp gene was synthesized as a control group.

TABLE 1 Bactrocera dorsalis target Gene dsRNA synthetic primer sequences

(Note: bold type thick portion is T7 promoter.)

The dsRNA synthesis steps are as follows:

the first step is as follows: two single-stranded RNAs (ssRNAs) were synthesized, and were used after the 5 × Transcript air reaction Buffer precipitated before being dissolved at 37 ℃.

The reaction system is as follows:

reaction conditions are as follows: water bath at 42 deg.C for 30min

The second step is that: the two single-stranded RNAs (ssRNAs) synthesized were mixed, water-washed at 72 ℃ for 10min, and naturally cooled in water to room temperature.

The third step: digestion reaction, the reaction system is as follows (wherein RNase solution is used after being diluted 200 times in situ).

Reaction conditions are as follows: treating at 37 deg.C for 30min

The fourth step: adding 0.1 volume of sodium acetate and 1 volume of isopropanol, mixing and ice-cooling for 5min, and centrifuging at 4 ℃ for 13000 Xg for 10 min.

The fifth step: the supernatant was discarded, and the precipitate was washed with 500. mu.l of 75% ethanol and centrifuged at 13000 Xg for 5min at 4 ℃. Drying at room temperature for 15min, adding 2-5 times volume of RNase Free dH₂Dissolving the precipitate with O, taking a small amount of dsRNA for electrophoresis detection, and measuring by using Nanodrop2000The concentration, OD260/OD280 and OD260/OD230 values were recorded, and the samples were stored in an ultra-low temperature freezer at-80 ℃.

The dsRNA is named as dsUCP and consists of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is shown as SEQ ID NO.3, the nucleotide sequence of the antisense strand is reversely complementary with the sequence shown as SEQ ID NO.3, and the dsUCP can also be obtained by an artificial synthesis method.

Example 2: application and verification of dsRNA of reproductive development related gene UCP in prevention and control of bactrocera dorsalis

First, microinjection of dsUCP

The micro-injection needle is prepared by using a microelectrode glass capillary of Wuhan micro-probing scientific instruments, Inc., adopting a needle drawing instrument of Narishige corporation in Japan at the temperature of 60.4 ℃, and is ground into the injection needle by using a micro-needle grinding instrument of the Narishige corporation, the injection pressure is 300-400hPa, and the injection time is 0.2 s. The preliminary 3d female citrus fruit fly imagoes are used as experimental insects, 1 mul 2000ng of target gene dsUCP is injected into the abdomen of each test insect, the same amount of dsEgfp is injected as a control, each biological repetition is processed, the number of each processed insect is 180, and the experiment is repeated for three times.

Second, observation of ovary morphology and statistics of ovary diameter

Dissecting the ovary tissues of female adults at 7, 10 and 13 days of age respectively after dsUCP injection, wherein compared with the microscope image of dsEgfp, the ovary development of the dsUCP injected female adults at 7 days of age has no significant difference in morphology (figures 1A and D), and about 60 percent of extremely obvious development retardation phenomenon appears in the bactrocera dorsalis ovary picture treatment groups at 10 and 13 days of age compared with the control group (figures 1B-C, E-F); statistical comparison of ovarian diameters at a uniform scale revealed that dsUCP groups of 7, 10, and 13 day old female adults all inhibited ovarian development significantly compared to dsEgfp groups, with inhibition rates around 20%, 63%, and 23%, respectively (fig. 1G).

Third, the influence of dsRNA injection on the egg laying amount of bactrocera dorsalis

Female worms at 12 days after UCP injection and male worms at 12 days after normal non-mating were placed in a 1:1 ratio in transparent boxes of 14.4cm × 8.5cm × 8.5cm (length × width × height, caliber 6.6cm), 2 pairs per box, and eggs laying of female worms 15 days after mating was counted. The treatment method comprises the following steps: the hole is pricked on the wall of the small paper cup so that the female can lay eggs, then the small paper cup after the hole is pricked is placed in the transparent box, the box opening is sealed, the blocky bananas are placed in the paper cup, and the smell of the bananas can be only distributed out through the small holes in the paper cup, so that the female can be induced to lay eggs on the paper cup. The egg laying amount in the treated group and the control group was counted, respectively, and the average egg laying amount per day and the total egg laying amount per female were calculated, and the difference in mating rate between the interference group (the female injected with UCP-dsRNA) and the control group (the female injected with EGFP-dsRNA) was analyzed by t-test using Graph Pad Primer7 software. After 12d injection, observing the average egg laying amount and total egg laying amount of the single female of the female in the control group and the female in the treatment group on day, wherein the results show that the average egg laying amount of the single female in the treatment group from 1 d to 15d is lower than that of the control group, and the single female in the treatment group has significant difference on days 1, 3, 5, 7, 9 and 11 (figure 1H); the total egg laying amount of the treatment group is also very significantly lower than that of the control group, the total egg laying amount of the treatment group is 28 grains, and the total egg laying amount of the control group is 130 grains (figure 1I). Therefore, the UCP gene participates in regulating and controlling the ovarian development and the egg laying amount of the female adult and plays an important role in the reproductive development of the female citrus fruit fly.

Four, real-time fluorescent quantitative PCR

The real-time fluorescent quantitative method is carried out on a Bio-Rad CFX96 real-time fluorescent quantitative PCR instrument by adopting a 2 XT 5 Fast qPCR Mix (SYBR Green I) kit. Three technical replicates were set for each sample, and corresponding blanks were set as required, with a 20. mu.l total PCR system, as shown below. The lysis curve was analyzed after the fluorescent quantitative PCR was finished to ensure specific amplification. Real-time fluorescent quantitative PCR result utilization 2^-ΔCtThe method analysis and the related primer synthesis are completed by Nanjing Kingsrei Biotech Co., Ltd, and the sequence is shown in the following table.

TABLE 2 real-time fluorescent quantitative PCR primer sequences

The method comprises the following specific steps:

real-time fluorescent quantitative PCR reaction program:

stage 1: pre-denaturation

95℃ 3min

Stage 2: PCR reaction

Stage 3: the melting curve analysis temperature was slowly increased from 55 ℃ to 94 ℃ at a rate of 0.5 ℃/s, and the fluorescence intensity of the sample was continuously measured to obtain a melting curve, thereby judging the specificity of the amplification reaction.

After the dsUCP is injected for 24h, the RNA of the ovary tissue and the adipose tissue is respectively extracted, and after the RNA is reversely transcribed into cDNA and qPCR detection is carried out, the result shows that: the relative expression level of dsUCP treated group was significantly down-regulated compared to the control group, the relative expression level of UCP in ovary was reduced by about 49%, and the relative expression level of UCP in adipose body was reduced by about 22% (FIG. 2). After the female bactrocera dorsalis adults silence UCP, the expression levels of Vg1, Vg2 and VgR are found to be remarkably up-regulated (figure 3A, B, C), and the endocytosis related gene Endopilin B1 is remarkably down-regulated in both ovary and fat body (figure 3D).

Sequence listing

<110> university of agriculture in Huazhong

<120> application of reproductive development related gene UCP and dsRNA thereof in prevention and control of bactrocera dorsalis

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3549

<212> DNA

<213> Artificial Sequence

<400> 1

atgatgtaca atcaaaaatg ggcacgtaca attgagctga tagtagtagt gcttttattc 60

acagttttta gcagtagcaa tggcaaaaac ttagttatcc ctcagctagg taaaagcgat 120

atatttaata gtgaatatga acgcgtgcaa caaaaatcaa tgccaatgga atttgatgtt 180

tctgaagctg aacgcggtaa aaaaattaat cagcggttgc aaccccgcag tgttaaatat 240

aaatattttg ccttggaaag cgggacagat gtatcgatat cgtcaacaat agtaccactt 300

caaatctcta ccgaactgga taccgacgag aaaacttcag gagatacgct aagtatggtt 360

gaagctctct cggaaacgtc gagtatcact ccaacaacgc atcgaccagt acgactttcc 420

gtttcgtcaa atatatcctc acaggagagg gagcggagac tgatgatggt tctggctgcc 480

cgtcgtaatg cattacctcg tgtgagtgtc cgaacacgcc ttggcaccac cggacgatcc 540

tcactcttag agacaacatc taaagcacca agtgatgtac gatcagattg tttaaaaaac 600

tgtacaaaga actttacgcg tcgtacgact gctagttgta tgcgaaagtg ctctaattta 660

acacgtacaa tgaatggtac ggtcatcatt cacgaatcat ctctaaccgg ttcagctacg 720

ctgacctccg atcgagacaa caacgagata ctctttacgg acgaatcttc ccatggacta 780

tttattgttg caaagggaca aaatgataca tcaaatcata tacaagatgt tatgaaaaat 840

gtgaaagtgc ggcctaaaaa taaggattta tcatcagtaa ccattacttc cagttccatt 900

gaggaagatg atatccaacc gtacttgtac ttcggtgaaa aacttccacc tattaagccc 960

ggtacattga caattacttc cgttagcgag ggacttccca ggctattgga gatttctgca 1020

aataaattag gtcctactac tcctacctca cgcgtctctt catcaacttt aaccgctgtt 1080

gagcgcagcc gatcaagata taaatataga gatcgaggat acaactattc tagacgttcg 1140

cctccgcatg cgagtgcaat aacttccgtg gaaactaaga gtggactttc ttttaacaac 1200

gaaagtatag catctttcat caatgaaaat aaagaacaga atatggacca aagagttgtt 1260

ttacaattaa caaaactacc atcagttaca tctacagttg tttcttctac accattatta 1320

ataacggttt ccgacgagag taatgaaact tctgggccta ttcagaccac cacagaattc 1380

actaaaaact ttgtgtctga ttcacccatt attttgtacc ctacaacact tcgcgttcat 1440

tcaaccaacg ctacaatgaa aacatttgtc agaaatacaa ctgtaccaaa tgactcaatc 1500

ataaaaatca cctcttctgc gttcagaaaa ttatcaccag tttcacctac tgttcgacca 1560

agaacagttg atgaagaggg gattagaaac cctgattttc tgaaccaaaa agtaacacaa 1620

gaaattaata gtcacgaaac tgtaaaacca actacaaata atacaaattc aagggccatt 1680

gttaaagagg acattgagaa acttcgagct ctaggcccaa gtctcactca agaaataaaa 1740

aatgatgaaa atatagttat atttcttaac cagtcttctc cagatcgatc aaatggggaa 1800

atagaaatca tcgacaaacc aggtgcaata ttacacccga ctttgaaatc gagacactcc 1860

tatgagaatc caatcactga aacaccatct gtgccgttag agtcatcttc tcccaattca 1920

aatgaagata ttgaaccctc tcttgtaggt gttatagaaa cagccccaat aaaaaaacag 1980

actcagcttg agcaaacgaa tataaataga ggagatatta agtatacttt cgtcgccaat 2040

gatagagaag tatctttaga tatgcggcgc gttaatattg ccaccatggt gctggctgga 2100

atcggaataa tacctctttg tgcacttacc ctttaccttg tgcgatcata catatttcgt 2160

cgcaccgtta aaattgagga agatttcgat gtatgcattg gtgaccaaca gcctattagt 2220

cctgtaaaga aacttgattc gaagtttcaa aacaaaggcg aaaaggaaaa ctatgaaatc 2280

gaccatcacc gatccgatca tccgaaagca attaacaaag ttacctctcg gaaaacaaat 2340

gatggcatgc gatatgatga acaatgctca gtgactagtg agcaagaatt tgatcgtagc 2400

aatattcgcc tgaagagtct actaggtgag ggtaactttg gtcaagtgtg gaaagctgag 2460

gcagataatc ttagcggcca ttttggagct acacgtattg ttgccgttaa aacgatccgg 2520

aaattcagtc ctcaatccag tttgaaagaa gaagcagaca ttatgcgaaa actgggttca 2580

catcaaaacg ttgtgactct gcttggcgtc tgcttagaaa ttgagccaca catgctaatt 2640

atggagtatg caatgcgtgg acgattgttg tcattactgc gcgctgcgcg tagtgctgta 2700

aatattttac cagcctcagt gcctggtggt cgcagttcca cacctctgtc gccacggacg 2760

ctaggtggat ttgcattgga cattgcttgt ggaatggagt acattgctga aaagaggatt 2820

gtacatcgtg atcttgccgc acgcaacgtc cttctggatc ataatggtgt ttgtaaaatt 2880

tgtgattttg gaatgtcaat tgatttagaa ggtgaatgta agcagcaaga ggttgaccta 2940

aagagtgcta acaaaataat aagtagcaat acgaagagga aattagattt cggcagccgt 3000

ttcataataa accattggaa caataacttc aatacaaacc aaatcccaac aaaagatgct 3060

attgaaaaaa gaacccattc tcatgatcac agtcatggac atgctcatga ttcgattaat 3120

cgtaggcctg cattaccaat acgatggatg gccccagaag cgttacaata tcatattttt 3180

acgcatgaga ctgatgtatg ggcttttggc atagtattgt gggaaatatc tacattggga 3240

tctacaccat atgccaatct aacaggacgc gaagttatcc gacgagttcc aaatggtctt 3300

aggccagagc tgccaaagga atcgcgttta gaattttaca atttaatgac tcgatgttgg 3360

cataaggatt cccatttacg accttcgttt tcatatgcga gacaggaaat atctcgttcc 3420

ctccacaaat gggatgagga tgactcggca gaatcggact atatggatgt tagcggattt 3480

agtgaagatc tggaacatgg catggtttat ttcaatcaac gaatatccga gtttgaatgc 3540

gaaatatga 3549

<210> 2

<211> 1182

<212> PRT

<213> Artificial Sequence

<400> 2

Met Met Tyr Asn Gln Lys Trp Ala Arg Thr Ile Glu Leu Ile Val Val

1 5 10 15

Val Leu Leu Phe Thr Val Phe Ser Ser Ser Asn Gly Lys Asn Leu Val

20 25 30

Ile Pro Gln Leu Gly Lys Ser Asp Ile Phe Asn Ser Glu Tyr Glu Arg

35 40 45

Val Gln Gln Lys Ser Met Pro Met Glu Phe Asp Val Ser Glu Ala Glu

50 55 60

Arg Gly Lys Lys Ile Asn Gln Arg Leu Gln Pro Arg Ser Val Lys Tyr

65 70 75 80

Lys Tyr Phe Ala Leu Glu Ser Gly Thr Asp Val Ser Ile Ser Ser Thr

85 90 95

Ile Val Pro Leu Gln Ile Ser Thr Glu Leu Asp Thr Asp Glu Lys Thr

100 105 110

Ser Gly Asp Thr Leu Ser Met Val Glu Ala Leu Ser Glu Thr Ser Ser

115 120 125

Ile Thr Pro Thr Thr His Arg Pro Val Arg Leu Ser Val Ser Ser Asn

130 135 140

Ile Ser Ser Gln Glu Arg Glu Arg Arg Leu Met Met Val Leu Ala Ala

145 150 155 160

Arg Arg Asn Ala Leu Pro Arg Val Ser Val Arg Thr Arg Leu Gly Thr

165 170 175

Thr Gly Arg Ser Ser Leu Leu Glu Thr Thr Ser Lys Ala Pro Ser Asp

180 185 190

Val Arg Ser Asp Cys Leu Lys Asn Cys Thr Lys Asn Phe Thr Arg Arg

195 200 205

Thr Thr Ala Ser Cys Met Arg Lys Cys Ser Asn Leu Thr Arg Thr Met

210 215 220

Asn Gly Thr Val Ile Ile His Glu Ser Ser Leu Thr Gly Ser Ala Thr

225 230 235 240

Leu Thr Ser Asp Arg Asp Asn Asn Glu Ile Leu Phe Thr Asp Glu Ser

245 250 255

Ser His Gly Leu Phe Ile Val Ala Lys Gly Gln Asn Asp Thr Ser Asn

260 265 270

His Ile Gln Asp Val Met Lys Asn Val Lys Val Arg Pro Lys Asn Lys

275 280 285

Asp Leu Ser Ser Val Thr Ile Thr Ser Ser Ser Ile Glu Glu Asp Asp

290 295 300

Ile Gln Pro Tyr Leu Tyr Phe Gly Glu Lys Leu Pro Pro Ile Lys Pro

305 310 315 320

Gly Thr Leu Thr Ile Thr Ser Val Ser Glu Gly Leu Pro Arg Leu Leu

325 330 335

Glu Ile Ser Ala Asn Lys Leu Gly Pro Thr Thr Pro Thr Ser Arg Val

340 345 350

Ser Ser Ser Thr Leu Thr Ala Val Glu Arg Ser Arg Ser Arg Tyr Lys

355 360 365

Tyr Arg Asp Arg Gly Tyr Asn Tyr Ser Arg Arg Ser Pro Pro His Ala

370 375 380

Ser Ala Ile Thr Ser Val Glu Thr Lys Ser Gly Leu Ser Phe Asn Asn

385 390 395 400

Glu Ser Ile Ala Ser Phe Ile Asn Glu Asn Lys Glu Gln Asn Met Asp

405 410 415

Gln Arg Val Val Leu Gln Leu Thr Lys Leu Pro Ser Val Thr Ser Thr

420 425 430

Val Val Ser Ser Thr Pro Leu Leu Ile Thr Val Ser Asp Glu Ser Asn

435 440 445

Glu Thr Ser Gly Pro Ile Gln Thr Thr Thr Glu Phe Thr Lys Asn Phe

450 455 460

Val Ser Asp Ser Pro Ile Ile Leu Tyr Pro Thr Thr Leu Arg Val His

465 470 475 480

Ser Thr Asn Ala Thr Met Lys Thr Phe Val Arg Asn Thr Thr Val Pro

485 490 495

Asn Asp Ser Ile Ile Lys Ile Thr Ser Ser Ala Phe Arg Lys Leu Ser

500 505 510

Pro Val Ser Pro Thr Val Arg Pro Arg Thr Val Asp Glu Glu Gly Ile

515 520 525

Arg Asn Pro Asp Phe Leu Asn Gln Lys Val Thr Gln Glu Ile Asn Ser

530 535 540

His Glu Thr Val Lys Pro Thr Thr Asn Asn Thr Asn Ser Arg Ala Ile

545 550 555 560

Val Lys Glu Asp Ile Glu Lys Leu Arg Ala Leu Gly Pro Ser Leu Thr

565 570 575

Gln Glu Ile Lys Asn Asp Glu Asn Ile Val Ile Phe Leu Asn Gln Ser

580 585 590

Ser Pro Asp Arg Ser Asn Gly Glu Ile Glu Ile Ile Asp Lys Pro Gly

595 600 605

Ala Ile Leu His Pro Thr Leu Lys Ser Arg His Ser Tyr Glu Asn Pro

610 615 620

Ile Thr Glu Thr Pro Ser Val Pro Leu Glu Ser Ser Ser Pro Asn Ser

625 630 635 640

Asn Glu Asp Ile Glu Pro Ser Leu Val Gly Val Ile Glu Thr Ala Pro

645 650 655

Ile Lys Lys Gln Thr Gln Leu Glu Gln Thr Asn Ile Asn Arg Gly Asp

660 665 670

Ile Lys Tyr Thr Phe Val Ala Asn Asp Arg Glu Val Ser Leu Asp Met

675 680 685

Arg Arg Val Asn Ile Ala Thr Met Val Leu Ala Gly Ile Gly Ile Ile

690 695 700

Pro Leu Cys Ala Leu Thr Leu Tyr Leu Val Arg Ser Tyr Ile Phe Arg

705 710 715 720

Arg Thr Val Lys Ile Glu Glu Asp Phe Asp Val Cys Ile Gly Asp Gln

725 730 735

Gln Pro Ile Ser Pro Val Lys Lys Leu Asp Ser Lys Phe Gln Asn Lys

740 745 750

Gly Glu Lys Glu Asn Tyr Glu Ile Asp His His Arg Ser Asp His Pro

755 760 765

Lys Ala Ile Asn Lys Val Thr Ser Arg Lys Thr Asn Asp Gly Met Arg

770 775 780

Tyr Asp Glu Gln Cys Ser Val Thr Ser Glu Gln Glu Phe Asp Arg Ser

785 790 795 800

Asn Ile Arg Leu Lys Ser Leu Leu Gly Glu Gly Asn Phe Gly Gln Val

805 810 815

Trp Lys Ala Glu Ala Asp Asn Leu Ser Gly His Phe Gly Ala Thr Arg

820 825 830

Ile Val Ala Val Lys Thr Ile Arg Lys Phe Ser Pro Gln Ser Ser Leu

835 840 845

Lys Glu Glu Ala Asp Ile Met Arg Lys Leu Gly Ser His Gln Asn Val

850 855 860

Val Thr Leu Leu Gly Val Cys Leu Glu Ile Glu Pro His Met Leu Ile

865 870 875 880

Met Glu Tyr Ala Met Arg Gly Arg Leu Leu Ser Leu Leu Arg Ala Ala

885 890 895

Arg Ser Ala Val Asn Ile Leu Pro Ala Ser Val Pro Gly Gly Arg Ser

900 905 910

Ser Thr Pro Leu Ser Pro Arg Thr Leu Gly Gly Phe Ala Leu Asp Ile

915 920 925

Ala Cys Gly Met Glu Tyr Ile Ala Glu Lys Arg Ile Val His Arg Asp

930 935 940

Leu Ala Ala Arg Asn Val Leu Leu Asp His Asn Gly Val Cys Lys Ile

945 950 955 960

Cys Asp Phe Gly Met Ser Ile Asp Leu Glu Gly Glu Cys Lys Gln Gln

965 970 975

Glu Val Asp Leu Lys Ser Ala Asn Lys Ile Ile Ser Ser Asn Thr Lys

980 985 990

Arg Lys Leu Asp Phe Gly Ser Arg Phe Ile Ile Asn His Trp Asn Asn

995 1000 1005

Asn Phe Asn Thr Asn Gln Ile Pro Thr Lys Asp Ala Ile Glu Lys Arg

1010 1015 1020

Thr His Ser His Asp His Ser His Gly His Ala His Asp Ser Ile Asn

1025 1030 1035 1040

Arg Arg Pro Ala Leu Pro Ile Arg Trp Met Ala Pro Glu Ala Leu Gln

1045 1050 1055

Tyr His Ile Phe Thr His Glu Thr Asp Val Trp Ala Phe Gly Ile Val

1060 1065 1070

Leu Trp Glu Ile Ser Thr Leu Gly Ser Thr Pro Tyr Ala Asn Leu Thr

1075 1080 1085

Gly Arg Glu Val Ile Arg Arg Val Pro Asn Gly Leu Arg Pro Glu Leu

1090 1095 1100

Pro Lys Glu Ser Arg Leu Glu Phe Tyr Asn Leu Met Thr Arg Cys Trp

1105 1110 1115 1120

His Lys Asp Ser His Leu Arg Pro Ser Phe Ser Tyr Ala Arg Gln Glu

1125 1130 1135

Ile Ser Arg Ser Leu His Lys Trp Asp Glu Asp Asp Ser Ala Glu Ser

1140 1145 1150

Asp Tyr Met Asp Val Ser Gly Phe Ser Glu Asp Leu Glu His Gly Met

1155 1160 1165

Val Tyr Phe Asn Gln Arg Ile Ser Glu Phe Glu Cys Glu Ile

1170 1175 1180

<210> 3

<211> 330

<212> DNA

<213> Artificial Sequence

<400> 3

ctgcttggcg tctgcttaga aattgagcca cacatgctaa ttatggagta tgcaatgcgt 60

ggacgattgt tgtcattact gcgcgctgcg cgtagtgctg taaatatttt accagcctca 120

gtgcctggtg gtcgcagttc cacacctctg tcgccacgga cgctaggtgg atttgcattg 180

gacattgctt gtggaatgga gtacattgct gaaaagagga ttgtacatcg tgatcttgcc 240

gcacgcaacg tccttctgga tcataatggt gtttgtaaaa tttgtgattt tggaatgtca 300

attgatttag aaggtgaatg taagcagcaa 330

Claims

1. A method for inhibiting the reproductive development of female citrus fruit fly is characterized by targeted silencing the reproductive development related gene of citrus fruit flyUCPGenes ofUCPThe nucleotide sequence of (A) is shown as SEQ ID NO.1。

2. The method of claim 1, wherein targeted silencing of genes associated with reproductive development of bactrocera dorsalis is performedUCPThe dsRNA of (1) consists of nucleotide with a sequence shown in SEQ ID NO.3 and nucleotide which is reversely complementary with the nucleotide.

dsRNA consisting of the nucleotide of sequence SEQ ID No.3 and the nucleotide complementary to the reverse direction thereof.

4. Use of the dsRNA of claim 3 for control of Bactrocera dorsalis.