CN110106175A - A kind of dsRNA and its application in control of insect - Google Patents
A kind of dsRNA and its application in control of insect Download PDFInfo
- Publication number
- CN110106175A CN110106175A CN201910397167.9A CN201910397167A CN110106175A CN 110106175 A CN110106175 A CN 110106175A CN 201910397167 A CN201910397167 A CN 201910397167A CN 110106175 A CN110106175 A CN 110106175A
- Authority
- CN
- China
- Prior art keywords
- heat shock
- insect
- shock protein
- sequence
- migratory locusts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Abstract
A kind of application the invention discloses dsRNA and its in control of insect.DsRNA provided by the invention is the double-stranded RNA that nucleotide shown in the nucleotide shown in sequence 7 in sequence table and its reverse complementary sequence forms.It is experimentally confirmed: dsRNA being imported into migratory locusts with injection method and is compared with control, migratory locusts ovum Diapause rate is decreased obviously.The present invention is deeper into understanding that migratory locusts diapauze mechanism, the new biological pesticide preparation of initiative provide fundamental basis.
Description
Technical field
The invention belongs to technical field of biological control, and in particular to a kind of dsRNA and its application in control of insect, it is special
It is not related to a kind of dsRNA and its application in migratory locusts prevention and treatment.
Background technique
Locust is China great agricultural pests in history, it has, and type is more, influences greatly and the spy of population outbreak often
Point, occurrence scope and severity often result in heavy losses to Chinese national economy, especially in agricultural production.In recent years,
As global warming trend increases, high density locust swarm happens occasionally, and risk of migrating at a distance aggravation seriously threatens China's agriculture
The grain-production in owner producing region, traditional prevention and control of plant diseases, pest control are excessive to the prevention and control of plant diseases, pest control mostly based on emergence control and chemical prevention
Chemical pesticide is relied on, the perspective nuisanceless prevention and control medicament of exploitation novel green is badly in need of.
Diapause is that insect adapts to environment cyclically-varying and the heredity physiological reaction that evolves for a long time.Mother can be with for locust
Experiencing illumination and temperature influences the diapause of next-generation locust egg.Research shows that: the developmental condition of next-generation locust egg and maternal effect are close
Cut phase is closed, and the mother of different lighting processes can convert optical signal into the substances such as albumen, secondary metabolite for migratory locusts and pass to
Next-generation locust egg ultimately causes hatching rate difference.The light receptors such as opsin play a significant role mother for locust is photosensitive, alltrans
Vitamin A acid is equally particularly significant to the transmitting of optical signal as the important substance of opsin metabolic process.
Summary of the invention
The technical problem to be solved by the present invention is to how pest control.
In order to solve the above-mentioned technical problem, present invention firstly provides a kind of dsRNA.
DsRNA provided by the invention is shown in the nucleotide as shown in sequence 7 in sequence table and its reverse complementary sequence
The double-stranded RNA of nucleotide composition.
In order to solve the above-mentioned technical problem, invention further provides the DNA moleculars for encoding above-mentioned dsRNA.
The nucleotides sequence of the DNA molecular of the above-mentioned dsRNA of coding provided by the invention is classified as sequence 5 in sequence table.
Expression cassette, recombinant vector, recombinant bacterium or transgenic cell line containing above-mentioned DNA molecular also belong to guarantor of the invention
Protect range.
In order to solve the above-mentioned technical problem, the present invention also provides above-mentioned dsRNA or DNA molecular or expression cassette, recombination to carry
The new application of body, recombinant bacterium or transgenic cell line.
The present invention provides above-mentioned dsRNA or DNA molecular or expression cassette, recombinant vector, recombinant bacterium or transgenic cell lines
In following a1)-a7) in it is any in application:
A1) pest control；
A2 the product of pest control) is prepared；
A3 Insect Diapause rate) is reduced；
A4) preparation reduces the product of Insect Diapause rate；
A5) inhibit migratory locusts heat shock protein gene HSP70 expression；
A6) preparation inhibits the product of migratory locusts heat shock protein gene HSP70 expression；
A7) it is used as heat shock protein inhibitor.
In order to solve the above-mentioned technical problem, the present invention also provides a kind of methods for reducing Insect Diapause rate.
The method provided by the invention for reducing Insect Diapause rate includes reducing the expression quantity of heat shock protein and/or work in insect
Property the step of, thus realize reduce Insect Diapause rate.
Further, the expression quantity of heat shock protein and/or active method are will to inhibit in insect in the reduction insect
The substance of the encoding gene expression of heat shock protein imports in insect；
The heat shock protein can be migratory locusts heat shock protein HSP70.
Further, the substance of the encoding gene expression for inhibiting heat shock protein in insect can be above-mentioned dsRNA.
In the above method, the mode of the importing can be injection.
In the above method, the reduction Insect Diapause rate can be reduction migratory locusts ovum Diapause rate.Specifically, in short photoperiod condition
Under, compared with the migratory locusts of HSP70 gene normal expression, the disturbed migratory locusts filial generation ovum Diapause rate decline of HSP70 gene.
Application of the above method in pest control also belongs to protection scope of the present invention.
In order to solve the above-mentioned technical problem, the present invention also provides a kind of products.
The active constituent of product provided by the invention is following b1) or b2):
B1) above-mentioned dsRNA；
B2) above-mentioned DNA molecular；
The product have following c1)-c3) and in any function:
C1) pest control；
C2 Insect Diapause rate) is reduced；
C3) inhibit migratory locusts heat shock protein gene HSP70 expression.
In above-mentioned application or method or product, the pest or insect are migratory locusts.
In above-mentioned application or method or product, the migratory locusts heat shock protein HSP70 is following egg a) or b) or c) or d)
White matter:
A) amino acid sequence is protein shown in sequence 2；
B) fused protein that the N-terminal of the protein shown in sequence 2 and/or C-terminal connection label obtain；
C) by amino acid sequence shown in sequence 2 by one or several amino acid residues substitution and/or missing and/or
Add obtained protein with the same function；
D) homology with amino acid sequence shown in sequence 2 with 75% or 75% or more and egg with the same function
White matter.
Wherein, sequence 2 is made of 654 amino acid residues.
In order to make protein in a) convenient for purifying, can in sequence table the amino terminal of protein shown in sequence 2 or
Carboxyl terminal connects upper label as shown in Table 1.
The sequence of table 1, label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
It is above-mentioned c) in protein HSP70, the substitution of one or several amino acid residues and/or missing and/or add
Add as the substitution and/or deletion and/or addition no more than 10 amino acid residues.
It is above-mentioned c) in protein HSP70 can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain
It arrives.
It is above-mentioned c) in protein HSP70 encoding gene can by will in DNA sequence dna shown in sequence 1 lack one or
The codon of several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or at its 5 ' end and/or
The coded sequence that 3 ' ends connect label shown in table 1 obtains.
The migratory locusts heat shock protein gene HSP70 be it is following 1) or 2) or 3) shown in gene:
1) its coded sequence is cDNA molecule or genomic DNA molecule shown in sequence 1；
2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes migratory locusts heat shock protein
CDNA molecule or genomic DNA molecule；
1) or 2) 3) and cDNA points of migratory locusts heat shock protein are encoded with the nucleotide sequence hybridization that limits under strict conditions
Son or genomic DNA molecule.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Wherein, sequence 1 is made of 1962 nucleotide, amino acid sequence shown in coded sequence 2.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding HSP70 protein of the invention.Those by manually modified, have and this
The nucleotide sequence 75% of isolated HSP70 or the nucleotide of higher identity are invented, as long as encoding HSP70 and having
Identical function is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Amino acid sequence shown in bright coded sequence 2 composition protein nucleotide sequence have 75% or higher or 85% or
Higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or computer software
It is evaluated.Using computer software, identity between two or more sequences can be indicated with percentage (%), can be with
For evaluating the identity between correlated series.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
In order to solve the above-mentioned technical problem, the present invention, which finally provides, inhibits migratory locusts heat shock protein gene HSP70 expression
Substance.
The substance provided by the invention for inhibiting migratory locusts heat shock protein gene HSP70 expression is any in following d1)-d3):
D1) above-mentioned dsRNA；
D2) above-mentioned DNA molecular；
D3) above-mentioned expression cassette, recombinant vector, recombinant bacterium or transgenic cell line.
The present invention has synthesized for interfering migratory locusts heat shock migratory locusts heat shock protein gene HSP70 and HSP20.5 design primer
The dsRNA of protein gene HSP70 and HSP20.5, and dsRNA is imported into migratory locusts to migratory locusts heat shock protein gene with injection method
HSP70 and HSP20.5 carries out RNAi.The result shows that: the controllable migratory locusts diapause of migratory locusts heat shock protein HSP70, and HSP20.5 is to winged
Locust diapause does not influence.The present invention is deeper into understanding that migratory locusts diapauze mechanism, the new biological pesticide preparation of initiative provide theoretical base
Plinth.
Detailed description of the invention
Fig. 1 is that PCR screens HSP70 genetic fragment positive colony electrophoretogram.
Fig. 2 is that PCR screens HSP20.5 genetic fragment positive colony electrophoretogram.
Fig. 3 is migratory locusts heat shock protein gene HSP20.5 jamming effectiveness under the conditions of short-day.
Fig. 4 is migratory locusts heat shock protein gene HSP70 jamming effectiveness under the conditions of short-day.
Locust egg Diapause rate detects after Fig. 5 is RNAi migratory locusts heat shock protein gene HSP20.5.
Locust egg Diapause rate detects after Fig. 6 is RNAi migratory locusts heat shock protein gene HSP70.
Specific embodiment
Selected insect source in following embodiments: migratory locusts ovum is collected in Taian Shandong, continuously raises mostly generation in laboratory.Migratory locusts
Ovum is hatched in intelligent growth cabinet, and 30 DEG C of temperature, relative humidity 60%.Rearing conditions: Diapause inducement condition, photoperiod L:
D=10h:14h, 28 DEG C of temperature；Non- diapause condition, photoperiod L:D=16h:8h, 28 DEG C.Feeding wheat seedling.
Main agents and reagent in following embodiments:RNA separation agent (invitrogen is original-pack), RNA
Spin column (Quan Shijin), plastic recovery kit (Axygen), EX Taq archaeal dna polymerase (Takara), T4DNA ligase
(Takara), pGEM-T Easy Vector Systems (Promega), the reagents such as dehydrated alcohol, isopropanol, glycerine are
Domestic analysis alcohol.
Key instrument in following embodiments: superclean bench (Shanghai Bo Xun Industrial Co., Ltd.), east victory dragon ETC-
811PCR instrument (Beijing Eastwin Scientific, Inc.), Germany's Sigma 3K15 refrigerated centrifuge (German sigma from
Scheming Co., Ltd), NanoPhotometer micro-spectrophotometer (German IMPLEN company), HPX-9052MBE digital display electricity
Hot incubator (Shanghai Bo Xun Industrial Co., Ltd.), THZ-D Desk type constant-temperatureoscillator oscillator (magnificent biochemical instrument factory), vortex oscillator
QL-901 (its woods Bell instrument manufacturing of Haimen City), high-pressure sterilizing pot YXQ-LS-50SII (Shanghai Bo Xun Industrial Co., Ltd. doctor
Treat instrument factory), electric converter (Eppendorf), high speed freezing centrifuge (Sigma), assay balance (Sartorius), constant temperature
Incubator ZHWY-103B (Shanghai intelligence city).
The formula of culture medium in following embodiments:
1) YPD culture medium: 20g peptone, 10g yeast powder, 20g glucose add H2O is settled to 1L, 115 DEG C of high pressure sterilizations
20min (every liter of solid medium needs to add 15g agar powder).
2) 1M D-glucitol: 182g D-glucitol adds H2O is settled to 1L, 121 DEG C of high pressure sterilization 20min.
3) agarose 2g (20g/L) is added in MD plate (100mL): 80mL water, 121 DEG C sterilize 20 minutes, low to temperature
In 60 DEG C, 10 × YNB 10mL (13.4g/L) is added on the super-clean bench, 10 × glucose 10mL (20g/L), 500 × biotin
0.2mL(4×10-4g/L)。
4) BMGY (1L): 10g yeast extract, 20g peptone, 3g K2HPO4, 11.8g KH2PO4, 890mL is added water to,
121 DEG C sterilize 20 minutes, and 10 × YNB100mL (13.4g/L) is added on the super-clean bench after temperature is lower than 60 DEG C, 500 × raw
Object element 1mL (4 × 10-4G/L), glycerol 10mL.
5) BMMY (1L): 10g yeast extract, 20g peptone, 3g K2HPO4, 11.8g KH2PO4, 890mL is added water to,
121 DEG C sterilize 20 minutes, and 10 × YNB100mL (13.4g/L) is added on the super-clean bench after temperature is down to 60 DEG C, 500 × raw
Object element 1mL (4 × 10-4G/L), methanol 5mL.
As shown in sequence 1, coding flies the cDNA sequence overall length of migratory locusts heat shock protein gene HSP70 in following embodiments
The amino acid sequence of locust heat shock protein HSP70 is as shown in sequence 2.Migratory locusts heat shock protein gene HSP20.5 in following embodiments
CDNA sequence overall length as shown in sequence 3, the amino acid sequence of the migratory locusts heat shock protein HSP20.5 of coding is as shown in sequence 4.
Embodiment 1, the synthesis of dsRNA and its application in prevention and treatment migratory locusts
One, the synthesis of dsRNA
Using T7RiboMAXTMExpress RNAi System kit synthesizes dsRNA.Specific step is as follows:
1) preparation of recombinant plasmid
1-1) using migratory locusts cDNA as template, PCR amplification is carried out with primer 1F/1R and 2F/2R, obtains PCR product.
1F:ACCTGTTGCTGCTTGATGTC；
1R:GCCTTCTGTTTCTCGTCCTC.
2F:AATGTCTGTCGTTCCTGCC；
2R:TTCTCTCTCCTCCCTGCTGT.
PCR reaction system is following (50 μ L of total volume): 1 μ L of cDNA template, 4 dNTP μ L, 10 × Buffer, 5 μ L, leading
1 μ L of object, 1 μ L of rear primer, 0.25 μ L of Taq enzyme, ddH2O 38μL。
PCR reaction condition is as follows: 95 DEG C of 3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min 30s, 35 circulations；72℃
10min；4 DEG C of preservations.
PCR product 1-2) is subjected to electrophoresis on 1% Ago-Gel that TAE is prepared, when object tape separation is preferable,
Blob of viscose where cutting object tape with blade is put into sterile centrifuge tube.Plastic recovery kit (Axygen) recovery purifying is used again
Object tape, recovery purifying process are carried out referring to kit specification.
PGEM-T Easy carrier 1-3) is connected after PCR product recycling, obtains recombinant vector.Linked system is as follows: T4DNA
1 μ L of ligase, 2 × buffer, 5 μ L, 1 μ L of pGEM-T Easy, 3 μ L of PCR recovery product.Condition of contact: 6 are connected at room temperature
A hour.
1-4) the preparation and conversion of competent cell
In 1.5mL centrifuge tube, 33.3 μ L Trans1-t1 competent cells are added, place 15min, 42 DEG C of water-baths on ice
90s places 10min on ice.The liquid LB culture solution of 500 μ L is added in each 1.5mL centrifuge tube, 37 DEG C, 200rpm shakes bacterium
2h.After shaking bacterium, 100 μ L bacterium solutions are drawn into 1 ‰ AMP LB solid mediums, 37 DEG C of overnight incubations.Picking individual colonies are in 2mL's
In centrifuge tube, the 1 ‰ AMP LB liquid mediums of Guan Zhongyou 1mL.37 DEG C, 200rpm shakes bacterium 3-6h, observes growing state.
1-5) bacterium solution PCR
To 1-4) in bacterium solution carry out PCR verifying, PCR screening positive clone electrophoretogram result is as depicted in figs. 1 and 2.Bacterium
Liquid PCR reaction system (50 μ L of total volume) is as follows: 1 μ L of bacterium solution, 4 dNTP μ L, 10 × Buffer, 5 μ L, 1 μ L of preceding primer, after draw
1 μ L of object, 0.25 μ L of Taq enzyme, ddH2O 38μL。
Reaction condition is as follows: 95 DEG C of 3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min 30s, 35 circulations；72℃
10min；4 DEG C of preservations.
By positive colony bacterial strain be sent to Beijing Zi Xi Biotechnology Co., Ltd carry out sequencing and to sequencing result into
Row analysis.
Sequencing result shows: after DNA fragmentation shown in sequence 5 is is inserted into pGEM-T Easy carrier by recombinant vector 1, and
Keep the carrier obtained after the other sequences of pGEM-T Easy carrier are constant.
After DNA fragmentation shown in sequence 6 is is inserted into pGEM-T Easy carrier by recombinant vector 2, and keep pGEM-T
The carrier obtained after the other sequences of Easy carrier are constant.
2) preparation of DNA profiling
With the recombinant vector 1 in step 1) for template, using 1F0And 1R0PCR amplification is carried out, is obtained containing T7 promoter sequence
The target fragment 1 of column.
With the recombinant vector 2 in step 1) for template, using 2F0And 2R0PCR amplification is carried out, is obtained containing T7 promoter sequence
The target fragment 2 of column.
Primer sequence difference is as follows:
1F0: 5 '-TAATACGACTCACTATAGGACCTGTTGCTGCTTGATGTC-3 '；
1R0: 5 '-TAATACGACTCACTATAGGGCCTTCTGTTTCTCGTCCTC-3 '.
2F0: 5 '-TAATACGACTCACTATAGGAATGTCTGTCGTTCCTGCC-3 '；
2R0: 5 '-TAATACGACTCACTATAGGTTCTCTCTCCTCCCTGCTGT-3 '.
PCR reaction system is following (50 μ L of total volume): 1 μ L of recombinant vector, 4 dNTP μ L, 10 × Buffer, 5 μ L, leading
1 μ L of object, 1 μ L of rear primer, 0.25 μ L of Taq enzyme, ddH2O 38μL。
PCR reaction condition is as follows: 95 DEG C of 3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72℃10min；
4 DEG C of preservations.
PCR product is recycled, and detects target DNA concentration with NanoPhotometer micro-spectrophotometer, recycles concentration
150ng/ μ L need to be greater than.
3) synthesis of dsRNA
Using T7RiboMAXTMThe target fragment 1 of recycling is transcribed in vitro and closes by Express RNAi System kit
At the dsRNA of migratory locusts heat shock protein gene HSP70.Using T7RiboMAXTMExpress RNAi System kit will return
The dsRNA of synthesis migratory locusts heat shock protein gene HSP20.5 is transcribed in vitro in the target fragment 2 of receipts.And it is micro- with NanoPhotometer
It measures spectrophotometer and detects dsRNA concentration, dsRNA concentration is adjusted to 1000ng/ μ l, obtaining dsRNA solution, (solvent is
Nucleause free water)。
The dsRNA for the migratory locusts heat shock protein gene HSP70 that the present invention obtains is double-stranded RNA, by positive-sense strand and antisense strand
At the nucleotides sequence of positive-sense strand is classified as sequence 7, and the nucleotides sequence of antisense strand is classified as the reverse complementary sequence of sequence 7.This hair
The dsRNA of the migratory locusts heat shock protein gene HSP20.5 of bright acquisition is double-stranded RNA, by positive-sense strand and antisense strand at positive-sense strand
Nucleotides sequence be classified as sequence 8, the nucleotides sequence of antisense strand is classified as the reverse complementary sequence of sequence 8.
The dsRNA of above-mentioned migratory locusts heat shock protein gene HSP70 and HSP20.5 can also be obtained by artificial synthesized method.
The dsRNA of migratory locusts heat shock protein gene HSP70 is named as dsHSP70.By the dsRNA of migratory locusts heat shock protein gene HSP20.5
It is named as dsHSP20.5.
Two, application of the dsRNA in prevention and treatment migratory locusts
1, experimental method
Experimental group (dsHSP70): the dsHSP70 solution that 5 μ L concentration are 1000ng/ μ L is injected into locust body.
Experimental group (dsHSP20.5): the dsHSP20.5 solution that 5 μ L concentration are 1000ng/ μ L is injected into locust body.
Control group: 5 μ L distilled waters are injected into locust body.
Specific step is as follows: raising under short photoperiod (diapause condition, photoperiod L:D=10h:14h) condition (28 DEG C of temperature)
Support migratory locusts, with the micro syringe of 10 μ L draw respectively dsHSP20.5 solution (experimental group) that 5 μ L concentration are 1000ng/ μ L,
DsHSP70 solution (experimental group) and double steaming solution (control group) are sprouted wings first day in migratory locusts female adult pest and are injected into respectively into winged
In coria between third and fourth uromere of locust female adult pest abdomen, the syringe needle of syringe is parallel with abdomen, avoids damage to locust
The internal organ tissues of worm.Under the conditions of long-day and short-day, experimental group and control group inject 25 female adult pests respectively.Injection
After 36h, each processing takes 5 female adult pests at random, and dissection obtains migratory locusts fat body tissue.
2, real-time fluorescence quantitative PCR
Extract migratory locusts fat body tissue in total serum IgE, Takara reverse transcription reagent box synthesize cDNA, detection HSP20.5 and
HSP70 gene expression amount.Using actin gene as reference gene.Primer sequence is as follows:
Actin-F:5 '-GTTACAAACTGGGACGACAT-3 '；
Actin-R:5 '-AGAAAGCACAGCCTGAATAG-3 '；
HSP70-3F:5 '-ACCTGTTGCTGCTTGATGT-3 '；
HSP70-3R:5 '-TCTGCTTTGTTGGGATGG-3 '；
HSP20.5-3F:5 '-TCTGGTGTATCTTCCATCCA-3 '；
HSP20.5-3R:5 '-GTAACCGTGGTCATCTTGG-3 '.
As a result as shown in Figure 3 and Figure 4.As can be seen from Figure: under the conditions of short photoperiod, HSP20.5 and HSP70 gene is in reality
The relative expression levels and control group tested in the migratory locusts fat-body of group have significant difference (P < 0.05), and are lower than control group.?
Under the conditions of short photoperiod, the expression quantity of the HSP20.5 and HSP70 gene in the migratory locusts of experimental group is significantly reduced, and illustrates dsHSP20.5
Successfully disturb the expression of HSP20.5 and HSP70 gene in migratory locusts fat-body respectively with dsHSP70.
3, migratory locusts Diapause rate counts
Ovum (locust egg) juxtaposition for taking the migratory locusts for injecting dsHSP20.5 and dsHSP70 or distilled water under the conditions of short photoperiod to produce
Hatch under the conditions of 27 DEG C, count larvae number D1, remaining ovum is placed in 4 DEG C and saves one month, it is therefore an objective to termination of diapause, then
32 DEG C of hatchings, count larvae number D2, and remaining ovum is unfertilized egg or dead ovum, then locust egg Diapause rate=D2/ (D1+D2) ×
100%.
As a result as shown in Figure 5 and Figure 6.As can be seen from Figure: after interference migratory locusts female adult pest HSP70 gene, short photoperiod condition
Lower migratory locusts filial generation ovum Diapause rate declines compared with the control group, and there were significant differences (P < 0.05).Illustrate that HSP70 gene participates in adjusting
Migratory locusts diapause is controlled, when HSP70 gene transcription level declines, the decline of migratory locusts ovum Diapause rate.But interference migratory locusts female adult pest HSP20.5
After gene, migratory locusts filial generation ovum Diapause rate has no significant difference (P=0.0866) compared with the control under the conditions of short photoperiod, illustrate even if
It is the gene of same family, the biological function executed is also not quite similar.
Sequence table
<110>Plant Protection institute, Chinese Academy of Agricultral Sciences
<120>a kind of dsRNA and its application in control of insect
<160>8
<170>PatentIn version 3.5
<210>1
<211>1962
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>1
atggcggtaa aagcacccgc agttggaatt gatttgggta ccacctactc ctgtgttgga 60
gtattccagc acgggaaagt agaaatcatc gccaatgatc aaggaaatcg tacaacaccc 120
agttatgtcg catttacaga tacagagcga cttattggtg atgctgccaa gaaccaggtg 180
gccatgaacc caagtaacac tatttttgat gcaaagcgtc ttattgggcg ccgtttcgac 240
gaccaggctg tacaaagtga tatgaagcat tggcctttca aagttataaa tgatagtggc 300
aaaccaaaga ttcaggttca gtacaaagga gaaacaaaaa ccttcttccc tgaggaggtt 360
agctcaatgg ttctaacaaa aatgaaagaa acggcagagg cataccttgg aaagaatgtc 420
agtaatgccg tgatcacagt tcccgcctac ttcaatgatt cgcaaagaca agccaccaaa 480
gacgccggag ccattgctgg tctcaatgtg ctgcgaatta ttaatgaacc tacagcagct 540
gcaattgcct atggtctcga taagaagggt catggtgaaa gaaatgtcct tatttttgat 600
ttgggtggtg gtacatttga tgtgtctatt ttgacaatag aagatggtat ctttgaagta 660
aaggccacag caggagacac tcatttggga ggtgaagact ttgataatcg catggtaaat 720
cattttgttc aagaattcaa aagaaagtac aagaaggacc ttactaccaa caagagagca 780
ctgcgcagat tgagaaccgc ttgtgaaaga gcgaagcgca cactgtcctc gtcaacacag 840
gccagcattg aaatagattc cctctatgag ggcattgatt tctatacctc tatcaccagg 900
gcaaggtttg aagagctcaa tgctgacttg ttcagatcca ccatggaacc tgtggagaaa 960
gcacttcgtg atgctaagat ggacaaggct caaattcatg acattgtgtt ggtgggtggg 1020
tcaactcgta ttccaaaagt acaaaaactg ttgcaagatt tctttaatgg caaggaactg 1080
aacaagtcta tcaacccaga tgaggctgta gcatatggag ctgctgtgca ggcagcaatt 1140
ttggcaggcg acaagtctga ggaagtgcag gacctgttgc tgcttgatgt cacaccactg 1200
tctctgggta ttgaaactgc tggtggtgtg atgaccactc ttatcaaaag aaataccacc 1260
atcccaacaa agcagactca aacattcaca acatattcag acaaccagcc tggtgtgctc 1320
attcaggtat acgagggtga gcgtgccatg acaaaagata acaatcttct gggtaaattc 1380
gagttgactg gaataccacc tgccccacga ggtgtgcctc aaattgaagt gacctttgat 1440
attgatgcta atggtatctt gaatgtaact gctgtggaga aatcgacagg caaagagaac 1500
aagatcacaa ttacaaacga caagggccgt ttgagcaagg aagaaattga gcgcatggtc 1560
aatgaagctg aacgttatcg tgcagaggac gagaaacaga aggcgacaat tgcggcgaag 1620
aacgggctcg agtcttactg cttcaatatg aaatctactg ttgaagacga gaaactgaaa 1680
gacaagatct ccgactctga taagcagacc atcttggaca agtgcaatga agtcatccgt 1740
tggcttgatg ccaaccagtt ggctgagaag gaagagtttg aggagaagca gaaggaactg 1800
gagcagatct gcaatcccat cattaccaag ttgtaccagg gtgcaggcgg agctcctgga 1860
ggaatgcctg gtggtttccc tggaggcttc ccaggtgccg gtggagctgc tgctggtggt 1920
gctggtgctg gtggcgctgg cccaactatc gaagaggtcg ac 1962
<210>2
<211>654
<212>PRT
<213>artificial sequence (Artificial Sequence)
<400>2
Met Ala Val Lys Ala Pro Ala Val Gly Ile Asp Leu Gly Thr Thr Tyr
1 5 10 15
Ser Cys Val Gly Val Phe Gln His Gly Lys Val Glu Ile Ile Ala Asn
20 25 30
Asp Gln Gly Asn Arg Thr Thr Pro Ser Tyr Val Ala Phe Thr Asp Thr
35 40 45
Glu Arg Leu Ile Gly Asp Ala Ala Lys Asn Gln Val Ala Met Asn Pro
50 55 60
Ser Asn Thr Ile Phe Asp Ala Lys Arg Leu Ile Gly Arg Arg Phe Asp
65 70 75 80
Asp Gln Ala Val Gln Ser Asp Met Lys His Trp Pro Phe Lys Val Ile
85 90 95
Asn Asp Ser Gly Lys Pro Lys Ile Gln Val Gln Tyr Lys Gly Glu Thr
100 105 110
Lys Thr Phe Phe Pro Glu Glu Val Ser Ser Met Val Leu Thr Lys Met
115 120 125
Lys Glu Thr Ala Glu Ala Tyr Leu Gly Lys Asn Val Ser Asn Ala Val
130 135 140
Ile Thr Val Pro Ala Tyr Phe Asn Asp Ser Gln Arg Gln Ala Thr Lys
145 150 155 160
Asp Ala Gly Ala Ile Ala Gly Leu Asn Val Leu Arg Ile Ile Asn Glu
165 170 175
Pro Thr Ala Ala Ala Ile Ala Tyr Gly Leu Asp Lys Lys Gly His Gly
180 185 190
Glu Arg Asn Val Leu Ile Phe Asp Leu Gly Gly Gly Thr Phe Asp Val
195 200 205
Ser Ile Leu Thr Ile Glu Asp Gly Ile Phe Glu Val Lys Ala Thr Ala
210 215 220
Gly Asp Thr His Leu Gly Gly Glu Asp Phe Asp Asn Arg Met Val Asn
225 230 235 240
His Phe Val Gln Glu Phe Lys Arg Lys Tyr Lys Lys Asp Leu Thr Thr
245 250 255
Asn Lys Arg Ala Leu Arg Arg Leu Arg Thr Ala Cys Glu Arg Ala Lys
260 265 270
Arg Thr Leu Ser Ser Ser Thr Gln Ala Ser Ile Glu Ile Asp Ser Leu
275 280 285
Tyr Glu Gly Ile Asp Phe Tyr Thr Ser Ile Thr Arg Ala Arg Phe Glu
290 295 300
Glu Leu Asn Ala Asp Leu Phe Arg Ser Thr Met Glu Pro Val Glu Lys
305 310 315 320
Ala Leu Arg Asp Ala Lys Met Asp Lys Ala Gln Ile His Asp Ile Val
325 330 335
Leu Val Gly Gly Ser Thr Arg Ile Pro Lys Val Gln Lys Leu Leu Gln
340 345 350
Asp Phe Phe Asn Gly Lys Glu Leu Asn Lys Ser Ile Asn Pro Asp Glu
355 360 365
Ala Val Ala Tyr Gly Ala Ala Val Gln Ala Ala Ile Leu Ala Gly Asp
370 375 380
Lys Ser Glu Glu Val Gln Asp Leu Leu Leu Leu Asp Val Thr Pro Leu
385 390 395 400
Ser Leu Gly Ile Glu Thr Ala Gly Gly Val Met Thr Thr Leu Ile Lys
405 410 415
Arg Asn Thr Thr Ile Pro Thr Lys Gln Thr Gln Thr Phe Thr Thr Tyr
420 425 430
Ser Asp Asn Gln Pro Gly Val Leu Ile Gln Val Tyr Glu Gly Glu Arg
435 440 445
Ala Met Thr Lys Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu Thr Gly
450 455 460
Ile Pro Pro Ala Pro Arg Gly Val Pro Gln Ile Glu Val Thr Phe Asp
465 470 475 480
Ile Asp Ala Asn Gly Ile Leu Asn Val Thr Ala Val Glu Lys Ser Thr
485 490 495
Gly Lys Glu Asn Lys Ile Thr Ile Thr Asn Asp Lys Gly Arg Leu Ser
500 505 510
Lys Glu Glu Ile Glu Arg Met Val Asn Glu Ala Glu Arg Tyr Arg Ala
515 520 525
Glu Asp Glu Lys Gln Lys Ala Thr Ile Ala Ala Lys Asn Gly Leu Glu
530 535 540
Ser Tyr Cys Phe Asn Met Lys Ser Thr Val Glu Asp Glu Lys Leu Lys
545 550 555 560
Asp Lys Ile Ser Asp Ser Asp Lys Gln Thr Ile Leu Asp Lys Cys Asn
565 570 575
Glu Val Ile Arg Trp Leu Asp Ala Asn Gln Leu Ala Glu Lys Glu Glu
580 585 590
Phe Glu Glu Lys Gln Lys Glu Leu Glu Gln Ile Cys Asn Pro Ile Ile
595 600 605
Thr Lys Leu Tyr Gln Gly Ala Gly Gly Ala Pro Gly Gly Met Pro Gly
610 615 620
Gly Phe Pro Gly Gly Phe Pro Gly Ala Gly Gly Ala Ala Ala Gly Gly
625 630 635 640
Ala Gly Ala Gly Gly Ala Gly Pro Thr Ile Glu Glu Val Asp
645 650
<210>3
<211>549
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>3
atggcactta caccggtgat ccgtcacttg ctggatgatg tcgacaggca gatgtcacta 60
ttcgaccagc attttggtat gggcctgacg cacgatgact tacttttccc gcgaatgtct 120
gtcgttcctg ccctgtctgg ctattacaga ccatggcgtc atttggcagc tcgaaactct 180
ggtgtatctt ccatccagaa taacaaggaa ggattcaagg taaatttaga cgtccaacag 240
ttcaaaccag aggagctgac tgtaaaagtt gtgggtgaca gtgtggtggt cgaggccaaa 300
catgaagagc gccaagatga ccacggttac atttcgcgtc atatgcagcg gcgctatatg 360
ctgccgaagg acgtggaagt tgaccaggtg cagacgcagc tgtcatcgga cggtgttttc 420
accatttcag caccaaagaa ggctctccca gcaccagaag gcggtgagcg tgtggtacaa 480
gttgtgcaga ctggtgttcc agcattgacc aaccagcaac agcagggagg agagagaatg 540
gagcagtga 549
<210>4
<211>182
<212>PRT
<213>artificial sequence (Artificial Sequence)
<400>4
Met Ala Leu Thr Pro Val Ile Arg His Leu Leu Asp Asp Val Asp Arg
1 5 10 15
Gln Met Ser Leu Phe Asp Gln His Phe Gly Met Gly Leu Thr His Asp
20 25 30
Asp Leu Leu Phe Pro Arg Met Ser Val Val Pro Ala Leu Ser Gly Tyr
35 40 45
Tyr Arg Pro Trp Arg His Leu Ala Ala Arg Asn Ser Gly Val Ser Ser
50 55 60
Ile Gln Asn Asn Lys Glu Gly Phe Lys Val Asn Leu Asp Val Gln Gln
65 70 75 80
Phe Lys Pro Glu Glu Leu Thr Val Lys Val Val Gly Asp Ser Val Val
85 90 95
Val Glu Ala Lys His Glu Glu Arg Gln Asp Asp His Gly Tyr Ile Ser
100 105 110
Arg His Met Gln Arg Arg Tyr Met Leu Pro Lys Asp Val Glu Val Asp
115 120 125
Gln Val Gln Thr Gln Leu Ser Ser Asp Gly Val Phe Thr Ile Ser Ala
130 135 140
Pro Lys Lys Ala Leu Pro Ala Pro Glu Gly Gly Glu Arg Val Val Gln
145 150 155 160
Val Val Gln Thr Gly Val Pro Ala Leu Thr Asn Gln Gln Gln Gln Gly
165 170 175
Gly Glu Arg Met Glu Gln
180
<210>5
<211>433
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>5
acctgttgct gcttgatgtc acaccactgt ctctgggtat tgaaactgct ggtggtgtga 60
tgaccactct tatcaagaga aataccacca tcccaacaaa gcagactcaa acattcacaa 120
catattcaga caaccagcct ggtgtgctca ttcaggtata cgagggtgag cgtgccatga 180
caaaagataa caatcttctg ggtaaatttg agttgactgg aataccacct gccccacgag 240
gtgtgcctca aattgaagtg accttcgata ttgatgctaa tggtatcttg aatgtaactg 300
ctgtggagaa atcgacaggc aaagagaaca agatcacaat tacaaacgac aagggccgtt 360
tgagcaagga agaaattgag cgcatggtca acgaagctga acgttatcgt gcagaggacg 420
agaaacagaa ggc 433
<210>6
<211>425
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>6
aatgtctgtc gttcctgccc tgtctggcta ttacagacca tggcgtcatt tggcagctcg 60
aaactctggt gtatcttcca tccagaataa caaggaagga ttcaaggtaa atttagacgt 120
ccaacagttc aaaccagagg agctgactgt aaaagttgtg ggtgacagtg tggtggtcga 180
ggccaaacat gaagagcgcc aagatgacca cggttacatt tcgcgtcata tgcagcggcg 240
ctatatgctg ccgaaggacg tggaagttga ccaggtgcag acgcagctgt catcggacgg 300
tgttttcacc atttcagcac caaagaaggc tctcccagca ccagaaggcg gtgagcgtgt 360
ggtacaagtt gtgcagactg gtgttccagc attgaccaac cagcaacagc agggaggaga 420
gagaa 425
<210>7
<211>433
<212>RNA
<213>artificial sequence (Artificial Sequence)
<400>7
accuguugcu gcuugauguc acaccacugu cucuggguau ugaaacugcu ggugguguga 60
ugaccacucu uaucaagaga aauaccacca ucccaacaaa gcagacucaa acauucacaa 120
cauauucaga caaccagccu ggugugcuca uucagguaua cgagggugag cgugccauga 180
caaaagauaa caaucuucug gguaaauuug aguugacugg aauaccaccu gccccacgag 240
gugugccuca aauugaagug accuucgaua uugaugcuaa ugguaucuug aauguaacug 300
cuguggagaa aucgacaggc aaagagaaca agaucacaau uacaaacgac aagggccguu 360
ugagcaagga agaaauugag cgcaugguca acgaagcuga acguuaucgu gcagaggacg 420
agaaacagaa ggc 433
<210>8
<211>425
<212>RNA
<213>artificial sequence (Artificial Sequence)
<400>8
aaugucuguc guuccugccc ugucuggcua uuacagacca uggcgucauu uggcagcucg 1
aaacucuggu guaucuucca uccagaauaa caaggaagga uucaagguaa auuuagacgu 61
ccaacaguuc aaaccagagg agcugacugu aaaaguugug ggugacagug ugguggucga 121
ggccaaacau gaagagcgcc aagaugacca cgguuacauu ucgcgucaua ugcagcggcg 181
cuauaugcug ccgaaggacg uggaaguuga ccaggugcag acgcagcugu caucggacgg 241
uguuuucacc auuucagcac caaagaaggc ucucccagca ccagaaggcg gugagcgugu 301
gguacaaguu gugcagacug guguuccagc auugaccaac cagcaacagc agggaggaga 361
gagaa 425
Claims (10)
1. a kind of dsRNA forms for nucleotide shown in the nucleotide shown in sequence 7 in sequence table and its reverse complementary sequence
Double-stranded RNA.
2. encoding the DNA molecular of dsRNA described in claim 1, nucleotides sequence is classified as sequence 5 in sequence table.
3. containing expression cassette, recombinant vector, recombinant bacterium or the transgenic cell line of DNA molecular as claimed in claim 2.
4. dsRNA described in claim 1 or DNA molecular as claimed in claim 2 or expression cassette as claimed in claim 3, again
Group carrier, recombinant bacterium or transgenic cell tie up to following a1)-a7) in it is any in application:
A1) pest control；
A2 the product of pest control) is prepared；
A3 Insect Diapause rate) is reduced；
A4) preparation reduces the product of Insect Diapause rate；
A5) inhibit migratory locusts heat shock protein gene HSP70 expression；
A6) preparation inhibits the product of migratory locusts heat shock protein gene HSP70 expression；
A7) it is used as heat shock protein inhibitor.
5. a kind of method for reducing Insect Diapause rate includes the steps that the expression quantity and/or activity that reduce heat shock protein in insect,
Insect Diapause rate is reduced to realize.
6. according to the method described in claim 5, it is characterized by: it is described reduce insect in heat shock protein expression quantity and/or
Active method is that the substance that the encoding gene of heat shock protein in insect will be inhibited to express imports in insect；
Or, the heat shock protein is migratory locusts heat shock protein HSP70；
Or, the substance of the encoding gene expression for inhibiting heat shock protein in insect is dsRNA described in claim 1.
7. the application in method pest control described in claim 5 or 6.
8. a kind of product, active constituent is following b1) or b2):
B1) dsRNA described in claim 1；
B2) DNA molecular as claimed in claim 2；
The product have following c1)-c3) and in any function:
C1) pest control；
C2 Insect Diapause rate) is reduced；
C3) inhibit migratory locusts heat shock protein gene HSP70 expression.
9. it is according to claim 4 application method described in claim 5 or 6 or it is as claimed in claim 7 application or
Product according to any one of claims 8, it is characterised in that: the pest or insect are migratory locusts.
It is any in following d1)-d3) 10. inhibiting the substance of migratory locusts heat shock protein gene HSP70 expression:
D1) dsRNA described in claim 1；
D2) DNA molecular as claimed in claim 2；
D3) expression cassette as claimed in claim 3, recombinant vector, recombinant bacterium or transgenic cell line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910397167.9A CN110106175B (en) | 2019-05-14 | 2019-05-14 | dsRNA (double-stranded ribonucleic acid) and application thereof in pest control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910397167.9A CN110106175B (en) | 2019-05-14 | 2019-05-14 | dsRNA (double-stranded ribonucleic acid) and application thereof in pest control |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110106175A true CN110106175A (en) | 2019-08-09 |
| CN110106175B CN110106175B (en) | 2022-11-22 |
Family
ID=67489854
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910397167.9A Active CN110106175B (en) | 2019-05-14 | 2019-05-14 | dsRNA (double-stranded ribonucleic acid) and application thereof in pest control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110106175B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112695045A (en) * | 2021-01-26 | 2021-04-23 | 郑州轻工业大学 | Lepidoptera insect Hpx12 gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120135941A1 (en) * | 2009-08-21 | 2012-05-31 | Joseph Collard | Treatment of 'c terminus of hsp70-interacting protein' (chip) related diseases by inhibition of natural antisense transcript to chip |
| CN104561018A (en) * | 2015-02-03 | 2015-04-29 | 东北林业大学 | Lymantria dispar linnaeus heatshock protein Hsp23 gene and application of dsRNA thereof in nuisanceless control |
| CN107641658A (en) * | 2017-10-31 | 2018-01-30 | 中国农业科学院植物保护研究所 | Method and application with the heat shock protein Hsp70 genetic test insect life-spans |
-
2019
- 2019-05-14 CN CN201910397167.9A patent/CN110106175B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120135941A1 (en) * | 2009-08-21 | 2012-05-31 | Joseph Collard | Treatment of 'c terminus of hsp70-interacting protein' (chip) related diseases by inhibition of natural antisense transcript to chip |
| CN104561018A (en) * | 2015-02-03 | 2015-04-29 | 东北林业大学 | Lymantria dispar linnaeus heatshock protein Hsp23 gene and application of dsRNA thereof in nuisanceless control |
| CN107641658A (en) * | 2017-10-31 | 2018-01-30 | 中国农业科学院植物保护研究所 | Method and application with the heat shock protein Hsp70 genetic test insect life-spans |
Non-Patent Citations (5)
| Title |
|---|
| WENSHENG QIN ET AL: "Cloning and characterization of a member of the Hsp70 gene family from Locusta migratoria, a highly thermotolerant insect", 《CELL STRESS CHAPERONES》 * |
| 王宪辉等: "飞蝗热休克蛋白70cDNA片段的克隆和序列分析", 《动物学研究》 * |
| 秦晶等: "一种新的昆虫热诱导型HSP70基因的克隆与表达分析", 《应用昆虫学报》 * |
| 肖海军等: "昆虫滞育关联差异基因的筛选方法", 《江西农业大学学报》 * |
| 韩艳华等: "RNA干扰技术在昆虫滞育机制研究中的应用", 《中国植物保护学会2016年学术年会》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112695045A (en) * | 2021-01-26 | 2021-04-23 | 郑州轻工业大学 | Lepidoptera insect Hpx12 gene and application thereof |
| CN112695045B (en) * | 2021-01-26 | 2022-11-11 | 郑州轻工业大学 | Lepidoptera insect Hpx12 gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110106175B (en) | 2022-11-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| CN114957426B (en) | SP6RARS and application thereof in preventing and treating cockroaches | |
| CN109734798A (en) | Migratory locusts serpin 7 and its encoding gene and application | |
| CN111944824B (en) | Tachykinin receptor gene of fall webworm, dsRNA and application in preventing and treating fall webworm | |
| CN114853861B (en) | Periplaneta americana PRP protein expression inhibitor, and encoding gene and application thereof | |
| CN108546694A (en) | Oedaleus asiaticus B Protein-tyrosine-phosphatase PTPN4 and its encoding gene and application | |
| CN110106175A (en) | A kind of dsRNA and its application in control of insect | |
| CN108611338A (en) | Oedaleus asiaticus B lactase-Phlorizin hydrolase LPH and its encoding gene and application | |
| CN109734789A (en) | Migratory locusts FK506 binding protein 46 and its encoding gene and application | |
| CN114478735B (en) | High-mortality dsRNA of aphids and application of high-mortality dsRNA in aphid control | |
| CN108374003A (en) | Migratory locusts Protein-tyrosine-phosphatase PTP1B and its encoding gene and application | |
| CN112695045B (en) | Lepidoptera insect Hpx12 gene and application thereof | |
| CN108060146A (en) | Migratory locusts peroxiredoxin PRX5 and its encoding gene and application | |
| CN109468336A (en) | Brown paddy plant hopper protein phosphatase gene NlPP1, albumen and its dsRNA and application | |
| CN106434680B (en) | A kind of shrimps masculine gene and its application | |
| CN108060147A (en) | Migratory locusts protein tyrosine kinase PTK and its encoding gene and application | |
| CN111440810B (en) | Migratory locust V-ATPase-V0 structural domain gene and application of dsRNA thereof in pest control | |
| CN110669790B (en) | Application of CvBV12-7 gene in reducing humoral immune response of insect | |
| CN111394371B (en) | Migratory locust V-ATPase-V1 structural domain gene and application of dsRNA thereof in pest control | |
| CN110129327B (en) | Migratory locust pore canal formation related geneLmsnarAnd application of dsRNA thereof in locusta migratoria control | |
| CN116751798B (en) | Trehalase gene of Asian small car locust and application thereof | |
| CN110157690A (en) | Migratory locusts peroxiredoxin and its encoding gene and application | |
| CN116769810B (en) | Asiatic dolly locust TRE gene and application thereof in locust control | |
| CN108546692A (en) | Oedaleus asiaticus B protein tyrosine kinase PTK and its encoding gene and application | |
| CN112391389B (en) | Migratory locust C-type scavenger receptor gene and targeting dsRNA and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |