CN110106175B

CN110106175B - dsRNA (double-stranded ribonucleic acid) and application thereof in pest control

Info

Publication number: CN110106175B
Application number: CN201910397167.9A
Authority: CN
Inventors: 涂雄兵; 张泽华; 陈俊; 郝昆; 崔栋楠; 王广君; 农向群; 赵亚斋
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2019-05-14
Filing date: 2019-05-14
Publication date: 2022-11-22
Anticipated expiration: 2039-05-14
Also published as: CN110106175A

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) and application thereof in pest control. The dsRNA provided by the invention is double-stranded RNA consisting of nucleotides shown in a sequence 7 in a sequence table and nucleotides shown in a reverse complementary sequence of the nucleotides. Experiments prove that: compared with the control, the diapause rate of the migratory locust egg is obviously reduced by introducing dsRNA into the migratory locust by using an injection method. The invention provides theoretical basis for further understanding locusta migratoria diapause mechanism and creating a new biological pesticide preparation.

Description

dsRNA (double-stranded ribonucleic acid) and application thereof in pest control

Technical Field

The invention belongs to the technical field of biological control, particularly relates to dsRNA (double-stranded ribonucleic acid) and application thereof in pest control, and particularly relates to dsRNA and application thereof in locust control.

Background

Locust is a historically important agricultural pest in China, has the characteristics of multiple species, great influence and frequent outbreak and disaster formation, and causes great loss to national economy in China and particularly to agricultural production in the occurrence range and the severity. In recent years, with the increasing trend of global warming, locusts with high density are frequently generated, the risk of long-distance migratory flight is aggravated, the grain production in the agricultural main producing area of China is seriously threatened, the traditional pest control mainly comprises emergency control and chemical control, the pest control excessively depends on chemical pesticides, and the prospective development of novel green pollution-free prevention and control agents is urgently needed.

Diapause is a hereditary physiological response developed by insects adapting to the periodic change of the environment for a long time. The maternal locust can sense light and temperature to influence diapause of the next generation of locust eggs. The research shows that: the development state of the next generation of locust eggs is closely related to the effect of the mother generation, and the mother generation locusts treated by different light can convert light signals into substances such as proteins and secondary metabolites to be transferred to the next generation of locust eggs, so that the difference of hatchability is finally caused. The photoreceptors such as opsin and the like have important effects on the sensitization of the maternal locust, and the all-trans retinoic acid as an important substance in the opsin metabolic process is also very important for transmitting optical signals.

Disclosure of Invention

The technical problem to be solved by the invention is how to control pests.

In order to solve the technical problems, the invention firstly provides dsRNA.

The dsRNA provided by the invention is double-stranded RNA consisting of nucleotides shown in a sequence 7 in a sequence table and nucleotides shown in a reverse complementary sequence of the nucleotides.

In order to solve the technical problems, the invention also provides a DNA molecule encoding the dsRNA.

The nucleotide sequence of the DNA molecule for coding the dsRNA provided by the invention is sequence 5 in a sequence table.

Expression cassettes, recombinant vectors, recombinant bacteria or transgenic cell lines containing the above DNA molecules also belong to the scope of protection of the present invention.

In order to solve the technical problems, the invention also provides a new application of the dsRNA or DNA molecule or the expression cassette, the recombinant vector, the recombinant bacterium or the transgenic cell line.

The invention provides an application of the dsRNA or DNA molecule or expression cassette, recombinant vector, recombinant bacterium or transgenic cell line in any one of the following a 1) -a 7):

a1 Control of pests;

a2 Preparing a product for controlling pests;

a3 Reducing diapause rate of insects;

a4 Preparing a product for reducing diapause rate of insects;

a5 Suppressing the expression of a heat shock protein gene HSP70 of the migratory locust;

a6 Preparing a product for inhibiting the expression of a heat shock protein gene HSP70 of the migratory locust;

a7 As heat shock protein inhibitors.

In order to solve the technical problem, the invention also provides a method for reducing the diapause rate of the insects.

The method for reducing the diapause rate of the insects comprises the step of reducing the expression quantity and/or activity of the heat shock protein in the insects, so that the diapause rate of the insects is reduced.

Further, the method for reducing the expression amount and/or activity of the heat shock protein in the insect is to introduce a substance for inhibiting the expression of a gene encoding the heat shock protein in the insect into the insect;

the heat shock protein may be locust fly heat shock protein HSP70.

Further, the substance inhibiting the expression of a gene encoding a heat shock protein in an insect may be the above-mentioned dsRNA.

In the above method, the introduction may be by injection.

In the above method, the reduction of the diapause rate of the insect may be a reduction of the diapause rate of the locusta migratoria egg. Specifically, under the condition of short light, compared with the migratory locust with the normal expression of the HSP70 gene, the offspring egg diapause rate of the migratory locust with the interfered HSP70 gene is reduced.

The application of the method in pest control also belongs to the protection scope of the invention.

In order to solve the technical problem, the invention also provides a product.

The active ingredients of the product provided by the invention are the following b 1) or b 2):

b1 The above dsRNA;

b2 The above DNA molecules;

the product has any one of the following functions of c 1) -c 3):

c1 Control of pests;

c2 Reducing diapause rate of insects;

c3 Suppressing the expression of the heat shock protein gene HSP70 of the migratory locust.

In the above application or method or product, the pest or insect is locusta migratoria.

In the above use or method or product, the migratory locust heat shock protein HSP70 is a protein of a) or b) or c) or d) as follows:

a) The amino acid sequence is a protein shown in a sequence 2;

b) A fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 2;

c) The protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2;

d) And (b) a protein having a homology of 75% or more to the amino acid sequence shown in SEQ ID No. 2 and having the same function.

Wherein, the sequence 2 consists of 654 amino acid residues.

In order to facilitate the purification of the protein in a), a tag as shown in Table 1 can be attached to the amino terminal or the carboxyl terminal of the protein shown in the sequence 2 in the sequence table.

TABLE 1 sequences of tags

Label (R)	Residue(s) of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Protein HSP70 in c) above, wherein the substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The protein HSP70 in the step c) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The gene encoding protein HSP70 in c) above can be obtained by deleting one or several amino acid residues of codons in the DNA sequence shown in sequence No. 1, and/or performing missense mutation of one or several base pairs, and/or connecting the coding sequence of the tag shown in Table 1 at the 5 'end and/or 3' end thereof.

The locust shock protein gene HSP70 is a gene shown in the following 1) or 2) or 3):

1) The coding sequence is a cDNA molecule or a genome DNA molecule shown in a sequence 1;

2) A cDNA molecule or a genome DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes the locust shock protein;

3) A cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and encodes a migratory locust heat shock protein.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

Wherein, the sequence 1 consists of 1962 nucleotides, and the coding sequence 2 shows an amino acid sequence.

The nucleotide sequence encoding HSP70 protein of the present invention can be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of HSP70 isolated in the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode HSP70 and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In order to solve the above technical problems, the present invention finally provides a substance for suppressing the expression of the heat shock protein gene HSP70 of migratory locust.

The substance for inhibiting the expression of the heat shock protein gene HSP70 of the migratory locust provided by the invention is any one of the following d 1) -d 3):

d1 The above dsRNA;

d2 The above DNA molecule;

d3 The above expression cassette, recombinant vector, recombinant bacterium or transgenic cell line.

The invention designs primers for the heat shock protein genes HSP70 and HSP20.5 of the migratory locust, synthesizes dsRNA for interfering the heat shock protein genes HSP70 and HSP20.5 of the migratory locust, and introduces the dsRNA into the migratory locust by an injection method to carry out RNAi on the heat shock protein genes HSP70 and HSP20.5 of the migratory locust. The results show that: the locust migratory shock protein HSP70 can regulate the diapause of the locust migratory, while HSP20.5 has no influence on the diapause of the locust migratory. The invention provides theoretical basis for further understanding locusta migratoria diapause mechanism and creating a new biological pesticide preparation.

Drawings

FIG. 1 is the electrophoresis diagram of positive clone of HSP70 gene fragment screened by PCR.

FIG. 2 is the electrophoresis diagram of positive clone of HSP20.5 gene fragment screened by PCR.

FIG. 3 shows the interfering efficiency of the heat shock protein gene HSP20.5 of migratory locust under the short-day condition.

FIG. 4 shows the interference efficiency of the heat shock protein gene HSP70 of migratory locust under the short-day condition.

FIG. 5 shows the diapause rate of locust after the heat shock protein gene HSP20.5 of RNAi migratory locust.

FIG. 6 shows the detection of locusts diapause rate after the heat shock protein gene HSP70 of RNAi migratory locusts.

Detailed Description

The test insect sources in the following examples: locusts migratoria collected from Taian mountain east are continuously raised in a laboratory for a plurality of generations. Incubating locusta migratoria manilensis eggs in an intelligent artificial climate box at the temperature of 30 ℃ and the relative humidity of 60 percent. Feeding conditions are as follows: diapause inducing conditions, photoperiod L: d =10h:14h, at the temperature of 28 ℃; non-diapause conditions, photoperiod L: d =16h:8h,28 ℃. Feeding wheat seedlings.

The main reagents and reagents in the following examples:

RNA isolation reagent (Invitrogen kit), RNA spin column (all gold), gel recovery kit (Axygen), EX Taq DNA polymerase (Takara), T4DNA ligase (Takara), pThe reagents such as GEM-T Easy Vector Systems (Promega), absolute ethyl alcohol, isopropanol, glycerol and the like are all domestic analytical alcohols.

The main instruments in the following examples: an ultra-clean workbench (Shanghai Bo-Cai-Kai Co., ltd.), an Toshenong ETC-811PCR instrument (Beijing Tosheng Innovation Biotechnology Co., ltd.), a German Sigma 3K15 refrigerated centrifuge (German Hegma centrifuge Co., ltd.), a NanoPhotometer micro spectrophotometer (German IMPLEN Co., ltd.), an HPX-9052MBE digital display electrothermal incubator (Shanghai Bo Cai-Kai Co., ltd.), a THZ-D desk type constant temperature oscillator (Huamei Biochemical apparatus factory), a vortex oscillator QL-901 (manufactured by Linbel apparatus of Haimei), a high pressure sterilizer YXQ-LS-50SII (Shanghai Bo Cai Co., ltd.), an electric converter (Eppendorf), a high-speed refrigerated centrifuge (Sigma), an analytical balance (Sartorius), and a constant temperature incubator ZHWY-103B (Shanghai Zhi City).

The media formulations in the following examples:

1) YPD medium: 20g peptone, 10g yeast powder, 20g glucose, add H ₂ O constant volume to 1L, and autoclaving at 115 deg.C for 20min (15 g agar powder per liter of solid culture medium).

2) 1M D-sorbitol: 182g of D-sorbitol, adding H ₂ O constant volume to 1L, and autoclaving at 121 deg.C for 20min.

3) MD plate (100 mL): 80mL of water was supplemented with 2g (20 g/L) of agarose, sterilized at 121 ℃ for 20 minutes, and when the temperature was below 60 ℃,10 mL (13.4 g/L) of 10 XYNB (10 Xglucose) (20 g/L), and 0.2mL (4X 10) of 500 Xbiotin (20 Xbiotin) were added to the resulting mixture on a clean bench ^-4 g/L)。

4) BMGY (1L): 10g Yeast extract, 20g peptone, 3g K ₂ HPO ₄ ，11.8g KH ₂ PO ₄ Adding water to 890mL, sterilizing at 121 deg.C for 20min, adding 10 XYNB 100mL (13.4 g/L) and 500 XYNB 1mL (4X 10) on a super clean bench after the temperature is lower than 60 deg.C ^-4 g/L), 10mL of glycerol.

5) BMMY (1L): 10g Yeast extract, 20g peptone, 3g K ₂ HPO ₄ ，11.8g KH ₂ PO ₄ Adding water to 890mL, sterilizing at 121 deg.C for 20min, cooling to 60 deg.C, adding 10 XYNB 100mL on a super clean bench(13.4 g/L), 500 × Biotin 1mL (4 × 10) ^-4 g/L), 5mL of methanol.

The whole length of cDNA sequence of heat shock protein gene HSP70 of migratory locust in the following examples is shown in sequence 1, and the amino acid sequence of the coded heat shock protein HSP70 of migratory locust is shown in sequence 2. The full length of cDNA sequence of heat shock protein gene HSP20.5 of migratory locust in the following examples is shown in sequence 3, and the amino acid sequence of coded heat shock protein HSP20.5 of migratory locust is shown in sequence 4.

Example 1 Synthesis of dsRNA and its use for controlling locusta migratoria

1. Synthesis of dsRNA

Using T7RiboMAX ^TM The Express RNAi System kit synthesizes dsRNA. The method comprises the following specific steps:

1) Preparation of recombinant plasmid

1-1) carrying out PCR amplification by using the migratory locust cDNA as a template and using primers 1F/1R and 2F/2R to obtain a PCR product.

1F：ACCTGTTGCTGCTTGATGTC；

1R：GCCTTCTGTTTCTCGTCCTC。

2F：AATGTCTGTCGTTCCTGCC；

2R：TTCTCTCTCCTCCCTGCTGT。

The PCR reaction system was as follows (total volume 50. Mu.L): cDNA template 1. Mu.L, dNTP 4. Mu.L, 10 XBuffer 5. Mu.L, front primer 1. Mu.L, back primer 1. Mu.L, taq enzyme 0.25. Mu.L, ddH ₂ O 38μL。

The PCR reaction conditions were as follows: 3min at 95 ℃; 30s at 95 deg.C, 30s at 55 deg.C, 1min 30s at 72 deg.C, 35 cycles; 10min at 72 ℃; storing at 4 ℃.

1-2) the PCR product was electrophoresed on a 1% agarose gel prepared in TAE, and when the band of interest was well separated, the gel piece where the band of interest was located was cut off with a razor blade and placed in a sterile centrifuge tube. And then recovering and purifying the target zone by using a gel recovery kit (Axygen), wherein the recovery and purification process is carried out according to the kit instruction.

1-3) recovering the PCR product, and then connecting the PCR product with a pGEM-T Easy vector to obtain a recombinant vector. The linking system is as follows: 1. Mu.L of T4DNA ligase, 5. Mu.L of 2 XBuffer, 1. Mu.L of pGEM-T Easy, and 3. Mu.L of PCR-recovered product. Connection conditions are as follows: the connection was carried out at room temperature for 6 hours.

1-4) preparation and transformation of competent cells

To a 1.5mL centrifuge tube, 33.3. Mu.L of Trans1-t1 competent cells were added, placed on ice for 15min, water bath at 42 ℃ for 90s, and placed on ice for 10min. 500. Mu.L of liquid LB medium was added to each 1.5mL centrifuge tube, and the cells were shaken at 200rpm at 37 ℃ for 2 hours. After shaking, 100. Mu.L of the bacterial solution was aspirated into 1 ‰ AMP LB solid medium and cultured overnight at 37 ℃. Single colonies were picked in 2mL centrifuge tubes containing 1mL of 1 ‰ AMP LB broth. And (5) shaking the bacteria at the speed of 200rpm for 3-6h at the temperature of 37 ℃ and observing the growth condition.

1-5) PCR of bacterial liquid

PCR verification is carried out on the bacterial liquid in 1-4), and the results of PCR screening positive clone electrophoretograms are shown in FIG. 1 and FIG. 2. The PCR reaction system (total volume 50. Mu.L) of the bacterial liquid is as follows: bacterial solution 1. Mu.L, dNTP 4. Mu.L, 10 XBuffer 5. Mu.L, front primer 1. Mu.L, rear primer 1. Mu.L, taq enzyme 0.25. Mu.L, ddH ₂ O 38μL。

The reaction conditions were as follows: 3min at 95 ℃; 30s at 95 deg.C, 30s at 55 deg.C, 1min 30s at 72 deg.C, 35 cycles; 10min at 72 ℃; storing at 4 ℃.

The positive clone strain is sent to Beijing catalpi biotechnology limited for sequence determination and analysis of the sequencing result.

The sequencing result shows that: the recombinant vector 1 was obtained by inserting the DNA fragment shown in SEQ ID No. 5 into the pGEM-T Easy vector while keeping the other sequences of the pGEM-T Easy vector unchanged.

The recombinant vector 2 was obtained by inserting the DNA fragment shown in SEQ ID No. 6 into the pGEM-T Easy vector while keeping the other sequences of the pGEM-T Easy vector unchanged.

2) Preparation of DNA template

Taking the recombinant vector 1 in the step 1) as a template and adopting 1F ₀ And 1R ₀ PCR amplification was performed to obtain the target fragment 1 containing the T7 promoter sequence.

Using the recombinant vector 2 in the step 1) as a template and adopting 2F ₀ And 2R ₀ PCR amplification was performed to obtain a target fragment 2 containing a T7 promoter sequence.

The primer sequences are respectively as follows:

1F ₀ ：5’-TAATACGACTCACTATAGGACCTGTTGCTGCTTGATGTC-3’；

1R ₀ ：5’-TAATACGACTCACTATAGGGCCTTCTGTTTCTCGTCCTC-3’。

2F ₀ ：5’-TAATACGACTCACTATAGGAATGTCTGTCGTTCCTGCC-3’；

2R ₀ ：5’-TAATACGACTCACTATAGGTTCTCTCTCCTCCCTGCTGT-3’。

the PCR reaction system was as follows (total volume 50. Mu.L): 1 uL recombinant vector, 4 uL dNTP, 5 uL 10 xBuffer, 1 uL front primer, 1 uL rear primer, 0.25 uL Taq enzyme, ddH ₂ O 38μL。

The PCR reaction conditions were as follows: 3min at 95 ℃; 30s at 95 deg.C, 30s at 55 deg.C, 1min at 72 deg.C, and 35 cycles; 10min at 72 ℃; storing at 4 deg.C.

Recovering PCR product, and detecting the target DNA concentration with a NanoPhotometer spectrophotometer, wherein the recovered concentration needs to be more than 150 ng/. Mu.L.

3) Synthesis of dsRNA

Using T7RiboMAX ^TM The Express RNAi System kit transcribes the recovered target fragment 1 in vitro to synthesize dsRNA of the locust shock protein gene HSP70. Using T7RiboMAX ^TM The Express RNAi System kit transcribes the recovered target fragment 2 in vitro into dsRNA of the locust shock protein gene HSP20.5. And the dsRNA concentration was measured with a NanoPhotometer microspectrophotometer and adjusted to 1000 ng/. Mu.l to obtain a dsRNA solution (as a solvent, nuclear free water).

The dsRNA of the locust fly heat shock protein gene HSP70 is double-stranded RNA and consists of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is a sequence 7, and the nucleotide sequence of the antisense strand is a reverse complementary sequence of the sequence 7. The dsRNA of the locust fly heat shock protein gene HSP20.5 obtained by the invention is double-stranded RNA and consists of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is a sequence 8, and the nucleotide sequence of the antisense strand is a reverse complementary sequence of the sequence 8.

The dsRNA of the heat shock protein genes HSP70 and HSP20.5 of the migratory locust can also be obtained by an artificial synthesis method. The dsRNA of the heat shock protein gene HSP70 of the migratory locust is named as dsHSP70. The dsRNA of the heat shock protein gene HSP20.5 of the migratory locust is named as dsHSP20.5.

2. Application of dsRNA (double-stranded ribonucleic acid) in controlling locusta migratoria

1. Experimental methods

Experimental group (dsHSP 70): mu.L of dsHSP70 solution at a concentration of 1000 ng/. Mu.L was injected into the locust body.

Experimental group (dshsp20.5): mu.L of dsHSP20.5 solution at a concentration of 1000 ng/. Mu.L was injected into a locust.

Control group: 5 μ L of double distilled water was injected into the locust body.

The method comprises the following specific steps: migratory locust is raised under the condition of short illumination (diapause condition, photoperiod L: D = 10h. Under the conditions of long sunshine and short sunshine, 25 female adults are injected into the experimental group and the control group respectively. After 36h of injection, 5 female adults were randomly selected for each treatment, and adipose body tissues of migratory locusts were dissected and obtained.

2. Real-time fluorescent quantitative PCR

Extracting total RNA in locusta migratoria adipose body tissues, synthesizing cDNA by a Takara reverse transcription kit, and detecting the expression quantity of HSP20.5 and HSP70 genes. The actin gene was used as an internal reference gene. The primer sequences are as follows:

actin-F：5’-GTTACAAACTGGGACGACAT-3’；

actin-R：5’-AGAAAGCACAGCCTGAATAG-3’；

HSP70-3F：5’-ACCTGTTGCTGCTTGATGT-3’；

HSP70-3R：5’-TCTGCTTTGTTGGGATGG-3’；

HSP20.5-3F：5’-TCTGGTGTATCTTCCATCCA-3’；

HSP20.5-3R：5’-GTAACCGTGGTCATCTTGG-3’。

the results are shown in FIGS. 3 and 4. It can be seen from the figure that: under the condition of short illumination, the relative expression levels of HSP20.5 and HSP70 genes in fat bodies of migratory locusts in an experimental group are remarkably different from those in a control group (P < 0.05), and are lower than those in the control group. Under the condition of short light, the expression levels of HSP20.5 and HSP70 genes in migratory locusts in an experimental group are obviously reduced, which shows that dsHSP20.5 and dsHSP70 successfully interfere with the expression of the HSP20.5 and HSP70 genes in fat bodies of migratory locusts respectively.

3. Migratory locust diapause rate statistics

Eggs (locust eggs) laid by migratory locusts injected with dsHSP20.5 and dsHSP70 under the condition of short light or double distilled water are taken and incubated at 27 ℃, the number D1 of incubated young insects is counted, the rest eggs are kept at 4 ℃ for one month to remove diapause, then the eggs are incubated at 32 ℃, the number D2 of the incubated young insects is counted, the rest eggs are unfertilized eggs or dead eggs, and the diapause rate of the locust eggs = D2/(D1 + D2) multiplied by 100 percent.

The results are shown in FIGS. 5 and 6. From the figure can be seen: after the interference of the female migratory locust HSP70 gene, the diapause rate of the filial egg of the migratory locust under the condition of short illumination is reduced compared with that of a control group, and the diapause rate is obviously different (P is less than 0.05). The HSP70 gene is involved in regulating and controlling the locusta migratoria diapause, and the locusta migratoria egg diapause rate is reduced when the HSP70 gene transcription level is reduced. However, after interfering with the female migratory locust HSP20.5 gene, the diapause rate of the offspring eggs of migratory locust under the condition of short illumination is not significantly different from that of the control (P = 0.0866), which indicates that the executed biological functions of the migratory locust are different even if the migratory locust is a gene of the same family.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> dsRNA and application thereof in pest control

<160>8

<170>PatentIn version 3.5

<210>1

<211>1962

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atggcggtaa aagcacccgc agttggaatt gatttgggta ccacctactc ctgtgttgga 60

gtattccagc acgggaaagt agaaatcatc gccaatgatc aaggaaatcg tacaacaccc 120

agttatgtcg catttacaga tacagagcga cttattggtg atgctgccaa gaaccaggtg 180

gccatgaacc caagtaacac tatttttgat gcaaagcgtc ttattgggcg ccgtttcgac 240

gaccaggctg tacaaagtga tatgaagcat tggcctttca aagttataaa tgatagtggc 300

aaaccaaaga ttcaggttca gtacaaagga gaaacaaaaa ccttcttccc tgaggaggtt 360

agctcaatgg ttctaacaaa aatgaaagaa acggcagagg cataccttgg aaagaatgtc 420

agtaatgccg tgatcacagt tcccgcctac ttcaatgatt cgcaaagaca agccaccaaa 480

gacgccggag ccattgctgg tctcaatgtg ctgcgaatta ttaatgaacc tacagcagct 540

gcaattgcct atggtctcga taagaagggt catggtgaaa gaaatgtcct tatttttgat 600

ttgggtggtg gtacatttga tgtgtctatt ttgacaatag aagatggtat ctttgaagta 660

aaggccacag caggagacac tcatttggga ggtgaagact ttgataatcg catggtaaat 720

cattttgttc aagaattcaa aagaaagtac aagaaggacc ttactaccaa caagagagca 780

ctgcgcagat tgagaaccgc ttgtgaaaga gcgaagcgca cactgtcctc gtcaacacag 840

gccagcattg aaatagattc cctctatgag ggcattgatt tctatacctc tatcaccagg 900

gcaaggtttg aagagctcaa tgctgacttg ttcagatcca ccatggaacc tgtggagaaa 960

gcacttcgtg atgctaagat ggacaaggct caaattcatg acattgtgtt ggtgggtggg 1020

tcaactcgta ttccaaaagt acaaaaactg ttgcaagatt tctttaatgg caaggaactg 1080

aacaagtcta tcaacccaga tgaggctgta gcatatggag ctgctgtgca ggcagcaatt 1140

ttggcaggcg acaagtctga ggaagtgcag gacctgttgc tgcttgatgt cacaccactg 1200

tctctgggta ttgaaactgc tggtggtgtg atgaccactc ttatcaaaag aaataccacc 1260

atcccaacaa agcagactca aacattcaca acatattcag acaaccagcc tggtgtgctc 1320

attcaggtat acgagggtga gcgtgccatg acaaaagata acaatcttct gggtaaattc 1380

gagttgactg gaataccacc tgccccacga ggtgtgcctc aaattgaagt gacctttgat 1440

attgatgcta atggtatctt gaatgtaact gctgtggaga aatcgacagg caaagagaac 1500

aagatcacaa ttacaaacga caagggccgt ttgagcaagg aagaaattga gcgcatggtc 1560

aatgaagctg aacgttatcg tgcagaggac gagaaacaga aggcgacaat tgcggcgaag 1620

aacgggctcg agtcttactg cttcaatatg aaatctactg ttgaagacga gaaactgaaa 1680

gacaagatct ccgactctga taagcagacc atcttggaca agtgcaatga agtcatccgt 1740

tggcttgatg ccaaccagtt ggctgagaag gaagagtttg aggagaagca gaaggaactg 1800

gagcagatct gcaatcccat cattaccaag ttgtaccagg gtgcaggcgg agctcctgga 1860

ggaatgcctg gtggtttccc tggaggcttc ccaggtgccg gtggagctgc tgctggtggt 1920

gctggtgctg gtggcgctgg cccaactatc gaagaggtcg ac 1962

<210>2

<211>654

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Ala Val Lys Ala Pro Ala Val Gly Ile Asp Leu Gly Thr Thr Tyr

1 5 10 15

Ser Cys Val Gly Val Phe Gln His Gly Lys Val Glu Ile Ile Ala Asn

20 25 30

Asp Gln Gly Asn Arg Thr Thr Pro Ser Tyr Val Ala Phe Thr Asp Thr

35 40 45

Glu Arg Leu Ile Gly Asp Ala Ala Lys Asn Gln Val Ala Met Asn Pro

50 55 60

Ser Asn Thr Ile Phe Asp Ala Lys Arg Leu Ile Gly Arg Arg Phe Asp

65 70 75 80

Asp Gln Ala Val Gln Ser Asp Met Lys His Trp Pro Phe Lys Val Ile

85 90 95

Asn Asp Ser Gly Lys Pro Lys Ile Gln Val Gln Tyr Lys Gly Glu Thr

100 105 110

Lys Thr Phe Phe Pro Glu Glu Val Ser Ser Met Val Leu Thr Lys Met

115 120 125

Lys Glu Thr Ala Glu Ala Tyr Leu Gly Lys Asn Val Ser Asn Ala Val

130 135 140

Ile Thr Val Pro Ala Tyr Phe Asn Asp Ser Gln Arg Gln Ala Thr Lys

145 150 155 160

Asp Ala Gly Ala Ile Ala Gly Leu Asn Val Leu Arg Ile Ile Asn Glu

165 170 175

Pro Thr Ala Ala Ala Ile Ala Tyr Gly Leu Asp Lys Lys Gly His Gly

180 185 190

Glu Arg Asn Val Leu Ile Phe Asp Leu Gly Gly Gly Thr Phe Asp Val

195 200 205

Ser Ile Leu Thr Ile Glu Asp Gly Ile Phe Glu Val Lys Ala Thr Ala

210 215 220

Gly Asp Thr His Leu Gly Gly Glu Asp Phe Asp Asn Arg Met Val Asn

225 230 235 240

His Phe Val Gln Glu Phe Lys Arg Lys Tyr Lys Lys Asp Leu Thr Thr

245 250 255

Asn Lys Arg Ala Leu Arg Arg Leu Arg Thr Ala Cys Glu Arg Ala Lys

260 265 270

Arg Thr Leu Ser Ser Ser Thr Gln Ala Ser Ile Glu Ile Asp Ser Leu

275 280 285

Tyr Glu Gly Ile Asp Phe Tyr Thr Ser Ile Thr Arg Ala Arg Phe Glu

290 295 300

Glu Leu Asn Ala Asp Leu Phe Arg Ser Thr Met Glu Pro Val Glu Lys

305 310 315 320

Ala Leu Arg Asp Ala Lys Met Asp Lys Ala Gln Ile His Asp Ile Val

325 330 335

Leu Val Gly Gly Ser Thr Arg Ile Pro Lys Val Gln Lys Leu Leu Gln

340 345 350

Asp Phe Phe Asn Gly Lys Glu Leu Asn Lys Ser Ile Asn Pro Asp Glu

355 360 365

Ala Val Ala Tyr Gly Ala Ala Val Gln Ala Ala Ile Leu Ala Gly Asp

370 375 380

Lys Ser Glu Glu Val Gln Asp Leu Leu Leu Leu Asp Val Thr Pro Leu

385 390 395 400

Ser Leu Gly Ile Glu Thr Ala Gly Gly Val Met Thr Thr Leu Ile Lys

405 410 415

Arg Asn Thr Thr Ile Pro Thr Lys Gln Thr Gln Thr Phe Thr Thr Tyr

420 425 430

Ser Asp Asn Gln Pro Gly Val Leu Ile Gln Val Tyr Glu Gly Glu Arg

435 440 445

Ala Met Thr Lys Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu Thr Gly

450 455 460

Ile Pro Pro Ala Pro Arg Gly Val Pro Gln Ile Glu Val Thr Phe Asp

465 470 475 480

Ile Asp Ala Asn Gly Ile Leu Asn Val Thr Ala Val Glu Lys Ser Thr

485 490 495

Gly Lys Glu Asn Lys Ile Thr Ile Thr Asn Asp Lys Gly Arg Leu Ser

500 505 510

Lys Glu Glu Ile Glu Arg Met Val Asn Glu Ala Glu Arg Tyr Arg Ala

515 520 525

Glu Asp Glu Lys Gln Lys Ala Thr Ile Ala Ala Lys Asn Gly Leu Glu

530 535 540

Ser Tyr Cys Phe Asn Met Lys Ser Thr Val Glu Asp Glu Lys Leu Lys

545 550 555 560

Asp Lys Ile Ser Asp Ser Asp Lys Gln Thr Ile Leu Asp Lys Cys Asn

565 570 575

Glu Val Ile Arg Trp Leu Asp Ala Asn Gln Leu Ala Glu Lys Glu Glu

580 585 590

Phe Glu Glu Lys Gln Lys Glu Leu Glu Gln Ile Cys Asn Pro Ile Ile

595 600 605

Thr Lys Leu Tyr Gln Gly Ala Gly Gly Ala Pro Gly Gly Met Pro Gly

610 615 620

Gly Phe Pro Gly Gly Phe Pro Gly Ala Gly Gly Ala Ala Ala Gly Gly

625 630 635 640

Ala Gly Ala Gly Gly Ala Gly Pro Thr Ile Glu Glu Val Asp

645 650

<210>3

<211>549

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atggcactta caccggtgat ccgtcacttg ctggatgatg tcgacaggca gatgtcacta 60

ttcgaccagc attttggtat gggcctgacg cacgatgact tacttttccc gcgaatgtct 120

gtcgttcctg ccctgtctgg ctattacaga ccatggcgtc atttggcagc tcgaaactct 180

ggtgtatctt ccatccagaa taacaaggaa ggattcaagg taaatttaga cgtccaacag 240

ttcaaaccag aggagctgac tgtaaaagtt gtgggtgaca gtgtggtggt cgaggccaaa 300

catgaagagc gccaagatga ccacggttac atttcgcgtc atatgcagcg gcgctatatg 360

ctgccgaagg acgtggaagt tgaccaggtg cagacgcagc tgtcatcgga cggtgttttc 420

accatttcag caccaaagaa ggctctccca gcaccagaag gcggtgagcg tgtggtacaa 480

gttgtgcaga ctggtgttcc agcattgacc aaccagcaac agcagggagg agagagaatg 540

gagcagtga 549

<210>4

<211>182

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Met Ala Leu Thr Pro Val Ile Arg His Leu Leu Asp Asp Val Asp Arg

1 5 10 15

Gln Met Ser Leu Phe Asp Gln His Phe Gly Met Gly Leu Thr His Asp

20 25 30

Asp Leu Leu Phe Pro Arg Met Ser Val Val Pro Ala Leu Ser Gly Tyr

35 40 45

Tyr Arg Pro Trp Arg His Leu Ala Ala Arg Asn Ser Gly Val Ser Ser

50 55 60

Ile Gln Asn Asn Lys Glu Gly Phe Lys Val Asn Leu Asp Val Gln Gln

65 70 75 80

Phe Lys Pro Glu Glu Leu Thr Val Lys Val Val Gly Asp Ser Val Val

85 90 95

Val Glu Ala Lys His Glu Glu Arg Gln Asp Asp His Gly Tyr Ile Ser

100 105 110

Arg His Met Gln Arg Arg Tyr Met Leu Pro Lys Asp Val Glu Val Asp

115 120 125

Gln Val Gln Thr Gln Leu Ser Ser Asp Gly Val Phe Thr Ile Ser Ala

130 135 140

Pro Lys Lys Ala Leu Pro Ala Pro Glu Gly Gly Glu Arg Val Val Gln

145 150 155 160

Val Val Gln Thr Gly Val Pro Ala Leu Thr Asn Gln Gln Gln Gln Gly

165 170 175

Gly Glu Arg Met Glu Gln

180

<210>5

<211>433

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

acctgttgct gcttgatgtc acaccactgt ctctgggtat tgaaactgct ggtggtgtga 60

tgaccactct tatcaagaga aataccacca tcccaacaaa gcagactcaa acattcacaa 120

catattcaga caaccagcct ggtgtgctca ttcaggtata cgagggtgag cgtgccatga 180

caaaagataa caatcttctg ggtaaatttg agttgactgg aataccacct gccccacgag 240

gtgtgcctca aattgaagtg accttcgata ttgatgctaa tggtatcttg aatgtaactg 300

ctgtggagaa atcgacaggc aaagagaaca agatcacaat tacaaacgac aagggccgtt 360

tgagcaagga agaaattgag cgcatggtca acgaagctga acgttatcgt gcagaggacg 420

agaaacagaa ggc 433

<210>6

<211>425

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

aatgtctgtc gttcctgccc tgtctggcta ttacagacca tggcgtcatt tggcagctcg 60

aaactctggt gtatcttcca tccagaataa caaggaagga ttcaaggtaa atttagacgt 120

ccaacagttc aaaccagagg agctgactgt aaaagttgtg ggtgacagtg tggtggtcga 180

ggccaaacat gaagagcgcc aagatgacca cggttacatt tcgcgtcata tgcagcggcg 240

ctatatgctg ccgaaggacg tggaagttga ccaggtgcag acgcagctgt catcggacgg 300

tgttttcacc atttcagcac caaagaaggc tctcccagca ccagaaggcg gtgagcgtgt 360

ggtacaagtt gtgcagactg gtgttccagc attgaccaac cagcaacagc agggaggaga 420

gagaa 425

<210>7

<211>433

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

accuguugcu gcuugauguc acaccacugu cucuggguau ugaaacugcu ggugguguga 60

ugaccacucu uaucaagaga aauaccacca ucccaacaaa gcagacucaa acauucacaa 120

cauauucaga caaccagccu ggugugcuca uucagguaua cgagggugag cgugccauga 180

caaaagauaa caaucuucug gguaaauuug aguugacugg aauaccaccu gccccacgag 240

gugugccuca aauugaagug accuucgaua uugaugcuaa ugguaucuug aauguaacug 300

cuguggagaa aucgacaggc aaagagaaca agaucacaau uacaaacgac aagggccguu 360

ugagcaagga agaaauugag cgcaugguca acgaagcuga acguuaucgu gcagaggacg 420

agaaacagaa ggc 433

<210>8

<211>425

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aaugucuguc guuccugccc ugucuggcua uuacagacca uggcgucauu uggcagcucg 1

aaacucuggu guaucuucca uccagaauaa caaggaagga uucaagguaa auuuagacgu 61

ccaacaguuc aaaccagagg agcugacugu aaaaguugug ggugacagug ugguggucga 121

ggccaaacau gaagagcgcc aagaugacca cgguuacauu ucgcgucaua ugcagcggcg 181

cuauaugcug ccgaaggacg uggaaguuga ccaggugcag acgcagcugu caucggacgg 241

uguuuucacc auuucagcac caaagaaggc ucucccagca ccagaaggcg gugagcgugu 301

gguacaaguu gugcagacug guguuccagc auugaccaac cagcaacagc agggaggaga 361

gagaa 425

Claims

Use of a dsRNA or a DNA molecule encoding said dsRNA or an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line comprising said DNA molecule in any one of the following a 1) to a 7):

a1 Control of pests;

a2 Preparing a product for controlling pests;

a3 Reducing diapause rate of insects;

a4 Preparing a product for reducing diapause rate of insects;

a5 Suppressing the expression of a locust shock protein gene HSP70;

a6 Preparing a product for inhibiting the expression of a heat shock protein gene HSP70 of the migratory locust;

a7 As heat shock protein inhibitors;

the dsRNA is double-stranded RNA consisting of nucleotide shown in a sequence 7 in a sequence table and nucleotide shown in a reverse complementary sequence of the dsRNA;

the nucleotide sequence of the DNA molecule for coding the dsRNA is a sequence 5 in a sequence table;

the pest or insect is locusta migratoria.
2. A method for reducing diapause rate of insects, comprising the step of reducing the expression level and/or activity of a heat shock protein in an insect, thereby achieving reduction of diapause rate of the insect;

the method for reducing the expression quantity and/or the activity of the heat shock protein in the insect is to introduce a substance for inhibiting the expression of a gene coding for the heat shock protein in the insect into the insect;

the heat shock protein is a migratory locust heat shock protein HSP70;

the substance for inhibiting the expression of the coding gene of the heat shock protein in the insect is dsRNA;

the dsRNA is double-stranded RNA consisting of nucleotide shown in a sequence 7 in a sequence table and nucleotide shown in a reverse complementary sequence of the dsRNA;

the insect is locusta migratoria.
3. Use of the method according to claim 2 for controlling pests; the pest is locusta migratoria.