CN116376913A - miRNA and application thereof in rice insecticidal improvement - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering. In particular to miRNA and application thereof in rice insecticidal improvement. The nucleotide sequence of the miRNA is shown as SEQ ID NO. 1 or is obtained by modifying, substituting, deleting or adding at least one base into the nucleic acid sequence shown as SEQ ID NO. 1. The miRNA designed and synthesized by the invention, namely miR-1579, has the function of regulating and controlling reproduction and development of the chilo suppressalis, is lethal to the chilo suppressalis, and provides an effective product for preventing and controlling the chilo suppressalis; the prepared RNAi mediated novel insect-resistant crop is environment-friendly, can accurately target genes to regulate and control the physiological process of insects, and has low potential risk. The miRNA designed and synthesized by the invention provides a new research thought for prevention and control of crops, especially rice pests, and has high research value and wide application prospect.

Description

miRNA and application thereof in rice insecticidal improvement

Technical Field

The invention belongs to the technical field of plant genetic engineering. In particular to an miRNA and application thereof in rice insecticidal improvement. A chilo suppressalis miRNA sequence is obtained through cloning, and the function of the sequence is verified, so that the miRNA sequence can be proved to be used for rice insecticidal improvement.

Background

Plant-mediated RNA silencing is a posttranscriptional double-stranded RNA (dsRNA) -mediated gene silencing mechanism and has proven to be an effective and environmentally-friendly alternative method for pest control. microRNA (miRNA) is a non-coding RNA with a length of about 21-28 nt, which can trigger a corresponding RNA interference (RNAi) pathway to participate in various physiological processes such as development, reproduction and apoptosis of organisms. By using a natural plant miRNA precursor as a framework, a sequence of 21nt which is designed artificially and aims at a target gene is substituted for a corresponding natural miRNA sequence, and mature artificial miRNA (artificial microRNA, amiRNA) can be generated according to a biological formation mechanism of the natural miRNA. amiRNA can then silence the expression of the target gene as specifically as the natural miRNA.

Currently, amiRNA technology has been successfully applied to the specific inhibition of expression of endogenous or exogenous genes in a variety of plants such as Arabidopsis, tobacco, tomato, rice, moss, and algae (Niu et al 2006; schwabet et al 2006; qu et al 2007; khraiwish et al 2008; warthmann et al 2008; molnar et al 2009). amiRNA interference has higher specificity compared with dsRNA interference, is not easy to cause the phenomenon of off-target, and is known as a second generation gene silencing technology (Tang et al 2007). At present, the technology is widely applied to the fields of functional genome research, variety improvement and medical treatment.

The prior art CN 107663522B relates to a method for cultivating insect-resistant rice by using Chilo suppressalis small RNA. Functional verification and application research are carried out on the obtained Chilo suppressalis [ Chilo suppressalis (Walker) endogenous small RNA sequence, a nucleotide sequence of the Chilo suppressalis endogenous small RNA csu-53 is obtained by utilizing high-flux small RNA sequencing and bioinformatics analysis, an artificial microRNA (amiRNA) expression vector is constructed by utilizing the sequence of the csu-53, and rice is transformed, and an in-vitro stem grafting experiment shows that the transgenic rice can obviously prolong the growth cycle of Chilo suppressalis larvae on rice plants and reduce the insect weight and pupae weight. The rice stem borer endogenous small RNA isolated by the invention can be applied to rice pest resistance improvement, in particular to application in inhibiting rice pest stem borer growth.

The invention belongs to the technical field of plant genetic engineering and relates to the prior art CN 104673827A. In particular to application of Chilo suppressalis [ Chilo suppressalis (Walker) ] endogenous small RNA in rice insect-resistant improvement. The invention performs functional verification and application research on the obtained Chilo suppressalis endogenous small RNA sequence. And obtaining the DNA sequence of the stem borer endogenous small RNA csu-15 by utilizing a high-throughput small RNA sequencing and bioinformatics analysis method.

However, the two patents show that the transgenic rice can only reduce the weight of larvae and inhibit the growth of the Chilo suppressalis larvae through an in vitro stalk insect-grafting test, and has a certain insect-resistant effect, but cannot kill insects.

Disclosure of Invention

The invention aims at providing miRNA, the nucleotide sequence of which is shown as SEQ ID NO. 1 or the nucleic acid sequence shown as SEQ ID NO. 1 is modified, substituted, deleted or added with at least one base to obtain the nucleic acid sequence.

SEQ ID NO:1：CGUGGCGGGAAGCGGAUGCGGCC。

Preferably, the modification comprises cholesterol and/or four thio-skeleton modified full-chain methoxy modifications at the 3 'end of the nucleotide shown in SEQ ID NO. 1, and two thio-skeleton modifications at the 5' end.

The second object of the present invention is to provide a kit, recombinant vector or transgenic cell comprising the above miRNA.

The invention also aims to provide the application of the miRNA or the kit, the recombinant vector or the transgenic cell in insect control, wherein the application is the killing of insect bodies.

Preferably, the insect is a rice pest.

Further preferably, the rice pest is Chilo suppressalis.

The fourth object of the invention is to provide the application of the miRNA or the kit, the recombinant vector or the transgenic cell in preparing pesticides.

The invention also provides a pesticide containing the miRNA or the kit, the recombinant vector or the transgenic cell.

The sixth object of the present invention is to provide an insect control method comprising the steps of: allowing the plant body to express the miRNA.

Preferably, the plant is rice.

Preferably, the insect control method comprises the steps of:

s1, constructing a miRNA expression cassette for mediating gene silencing in vitro by using the miRNA; and transforming the constructed final expression vector into rice through agrobacterium-mediated transformation to obtain a transgenic rice plant.

S2, cutting fresh stems of the obtained transgenic rice plants into stem segments, feeding the stem segments to newly hatched 1-year-old larvae, placing the larvae in a culture dish until death, and recording the death rate and the individual development condition;

or taking a plurality of first 1-year larvae to be connected to transgenic rice plants, placing the transgenic rice plants in a pest cage until death, and recording the death rate and the damage condition of the plants.

Preferably, the number of the heads is 10-30.

MiRNAs are mainly involved in life processes such as ontogenesis, cell differentiation, apoptosis and proliferation of organisms at posttranscriptional level through three modes of transcriptional regulation, transcriptional inhibition and translational inhibition. Because of their important role in insect development, inhibition of expression and overexpression of mirnas may both affect normal development of the organism. Direct knockout of mirnas is not well achieved due to the limitations in miRNA size. Studies of miRNA function are mainly identified by enhancing or attenuating expression of the miRNA of interest. The most widely used is to chemically synthesize miRNA antagonists (miRNA antagomir) and miRNA agonists (miRNA agomir) by using specific miRNAs sequences, and compared with common miRNA inhibitors (miRNA inhibitors) and miRNA mimics (miRNA mini), the miRNA antagonists (miRNA inhibitors) and miRNA mimics (miRNA mini) have stronger cell affinity, stability and inhibition. By introducing miRNA into the organism, the expression of the target gene in the organism is enhanced or weakened, so that the normal growth and development process of the organism is influenced. Especially those target genes for preventing and controlling pests have strong pertinence and lethality to rice pests after silencing, and the genes can be used as ideal candidate gene resources for creating novel RNAi-mediated insecticidal crops.

The miRNA designed and synthesized by the invention, namely miR-1579, has the function of regulating and controlling reproduction and development of the chilo suppressalis, is lethal to the chilo suppressalis, and provides an effective product for preventing and controlling the chilo suppressalis; the prepared RNAi mediated novel insect-resistant crop is environment-friendly, can accurately target genes to regulate and control the physiological process of insects, and has low potential risk. Provides a new research thought for preventing and controlling crop pests, especially rice pests, and has high research value and wide application prospect.

Drawings

FIG. 1 is a Vg expression profile;

FIG. 2 shows in vitro and in vivo experiments to demonstrate that miR-1579 directly targets Kr-h1;

FIG. 3 shows that overexpression of miR-1579 resulted in high mortality of Chilo suppressalis larvae;

FIG. 4 is a molecular characterization of transgenic rice;

FIG. 5 shows the bioassay of Chilo suppressalis on transgenic rice;

FIG. 6 is a safety evaluation of transgenic rice against non-target insects;

FIG. 7 is an agronomic trait evaluation of transgenic rice.

Detailed Description

Example 1 acquisition of miR-1579

1. Bioinformatics analysis miR-1579 targeting Kr-h1

Since Vg is a gene encoding a major vitellin precursor (YPP), it is commonly used to monitor the physiological phase of vitelline genesis. The expression level of Vg was detected by qPCR method as follows:

a qPCR reaction was performed using specific primers for Vg (Cs-Vg-F: GGCTCGCTTGGAGAAGCCTA (SEQ ID NO: 2); cs-Vg-R: GCCACCTTCTACGGCGATCT (SEQ ID NO: 3)) in combination with a qPCR kit (Takara) in the following system:

TB Green Premix Ex TaqII：5μL

Cs-Vg-F：0.4μL

Cs-Vg-R：0.4μL

a DNA template: 2 mu L

Sterilizing water: 2.2 mu L

The reaction conditions are as follows: 95 ℃ for 30s;95 ℃ for 5 seconds, 60 ℃ for 30 seconds, 40cycles; dissolution profile: 95℃5s,60℃1min,95℃15s,1 cycle.

The results showed that the expression level of Vg was in an upward trend in the female pupa fat bodies of 1 to 7 days old and was sharply increased on day 4 (see fig. 1), which laterally indicated that the pupal stage was a key period for the vitelline occurrence of chilo suppressalis.

Thus, the fat body on day 4 of the selection of female pupae was sent to Hua big gene (Shenzhen) for high throughput sequencing to obtain small RNA library. Early experiments found that transcription factor Kr-h1 was able to regulate vitelline formation in female pupae (Tang et al 2020), we predicted MiRNAs in the small RNA pool that were likely to target Kr-h1 using three software, miRanda v3.3a, targetScan v7.0, and RNAhybrid 2.1.2. A total of 10 miRNAs were predicted to bind Kr-h1, respectively: miR-6475-5p, miR-1902, miR-7044-5p, miR-3715, miR-453, miR-2965, novel-miR-77, novel-miR-41 and miR-1579 bind to the CDS region of Kr-h1, and novel-miR-23 binds to the 3' UTR of Kr-h1.

2. In vitro and in vivo experiments prove that miR-1579 targets Kr-h1

1) Intracellular validation: the CDS and 3' UTR of Kr-h1 were inserted into psiCHECK-2 plasmid to obtain recombinant plasmid, and the predicted mimics of 10 miRNAs were synthesized by Ruibo biological Co., guangzhou, and the recombinant plasmid was co-transfected with 10 miRNAs into HEK293T cells, respectively, and analyzed for luciferase activity.

The method for constructing the recombinant plasmid is as follows:

linearisation of psicheck-2 plasmid: the circular plasmid was linearized with XhoI and MssI endonucleases (Thermo Fisher) in the system: 10X FastDigest Green buffer:2 mu L

psiCHECK-2 plasmid: 1 μg

XhoI：1μL

MssI：1μL

Supplement DEPC H ₂ O to 20. Mu.L

Reaction conditions: 30min at 37 ℃;80 ℃ for 5min. And (3) performing gel electrophoresis after the reaction is finished, and cutting gel and recovering to obtain the purified psiCHECK-2 linearized plasmid.

B, double enzyme digestion of PCR products: firstly, designing a primer (Cs-Kr-h 1-F: ACTCTTATACCCCACTCCCCC (SEQ ID NO: 4) according to a Kr-h1 sequence and an enzyme cutting site, wherein the primer is Cs-Kr-h1-R:

GGGTTTTTAAGAGAAGTGCATGGAT(SEQ ID NO:5))

the primer (the engineering) is synthesized, and the PCR reaction is carried out according to the specification by combining high-fidelity enzyme PrimeSTAR Max Premix (2X) (Takara), wherein the PCR reaction system is as follows:

PrimeSTAR Max Premix(2X):5μL

Cs-Kr-h1-F:1μL

Cs-Kr-h1-R:1μL

Template:1μL

sterilizing water: make up to 10 mu L

The reaction conditions are as follows: 98 ℃ for 5min;98℃for 10s,54-60℃for 15s,72℃for 1min for 30s;2-4 steps of reaction for 30cycles; and at 72℃for 10min.

And (3) gel electrophoresis, gel cutting and recovery to obtain a PCR product of Kr-h1, and then double enzyme cutting is carried out on the PCR product, wherein an enzyme cutting system is as follows: PCR product: 0.2. Mu.g, the remainder being the same as the system and reaction conditions for linearization of the psiCHECK-2 plasmid described above. And (3) performing gel electrophoresis after the reaction is finished, and cutting gel and recovering to obtain a purified Kr-h1 double enzyme cutting product.

C. And (3) connection: the PCR product and psiCHECK-2 plasmid linearization product were ligated using T4 ligase (NEB) in the following system:

T4 DNA Ligase：1μL

T4 DNA Ligase Buffer(10X):2μL

PCR product and psiCHECK-2 linearized plasmid: the molar ratio is 3:1 add in

Nuclease-free water to 10. Mu.L

Overnight connection at 16℃and 15min at 65 ℃. Then it is transformed into competent cell Trans1-T1, sequencing (engineering) to determine the correctness of the insert, and obtaining psiCHECK-2+Kr-h1 recombinant plasmid.

Hek293t cell culture:

incomplete medium: dulbecco's Modified Eagle's Medium (Gibco)

Preparing a complete culture medium: incomplete culture medium+10% fetal bovine serum (Gibco) +1% green streptomycin mixed solution

A T25 flask was charged with 4mL complete medium containing 5% CO at 37 ℃ ₂ Culturing in an incubator.

E. The cell transfection method is as follows:

cells were seeded into 24-well cell culture plates and cell transfection was performed at a cell confluence of approximately 80%.

a. Diluting the miRNA mimic to a final concentration of 50nM;

b. dilution transfection reagent Lipofectamine ^TM 3000 (invitrogen) 1.5. Mu.L Lipofectamine per well in 25. Mu.L of incomplete medium ^TM Diluting at 3000, and incubating for 5min at room temperature;

c. the incomplete medium diluted psiCHECK-2+kr-h1 recombinant plasmid, per well plasmid: the ratio of transfection reagents was 1:1.5, incubating for 5min at room temperature;

d. mixing the diluted solutions a, b and c to prepare a mixed solution, and incubating for 15min at room temperature;

e. removing old complete medium in the culture plate, adding 200 μl of complete medium without double antibody (complete medium without 1% of mixture of penicillin and streptomycin), and adding the mixture, and adding CO at 37deg.C ₂ Culturing in an incubator for 24 hours;

f. the dual luciferase reporter kit (Promega) detects luciferase activity as follows:

all media in 24 well plates after transfection was discarded, washed once with 200 μl PBS, and lysed cells with 100 μl 1X Passive Lysis Buffer; placing on a shaking table, shaking at room temperature for 15-20min; 10 mu L of lysate is taken and added into an ELISA plate, 50 mu L Luciferase Assay Reagent II is added, a multifunctional ELISA (Tecan) is used for detecting the activity of firefly luciferase, 50 mu L of Stop & Glo Reagent is added, the activity of Renilla luciferase is detected, and the ratio of firefly luciferase to Renilla luciferase is calculated.

The result shows that: after transfection, the luciferase activities of miR-3715, miR-453, miR-1902, miR-2965, novel-miR-41, novel-miR-23 or miR-6475-5p were unchanged, and the luciferase activities of miR-7044-5p and novel-miR-77 were up-regulated by 1.63 times and 1.7 times respectively, while the luciferase reporter activities of miR-1579 were significantly reduced (see FIG. 2 a), indicating that miR-1579 down-regulates Kr-h1.

Subsequently, the "seed region" of the mutant miR-1579 and Kr-h1 binding site, method reference to the mutant binding site (Chiu et al 2004) designed a mutant primer:

miR-1579-Rt：GGGGGAGTGGGGTATAAGAGT(SEQ ID NO:6)

miR-1579-Ft：GGGAAGCTTCACGCGGTACCAAGGATCCACACTGGCGAAAGAC(SEQ ID NO:7)

miR-1579-Rs：TCCTTGGTACCGCGTGAAGCTTCCCAGAGTGTTCAAAGGCCG(SEQ ID NO:8)

miR-1579-Fs：ATCCATGCACTTCTCTTAAAAACCC(SEQ ID NO:9)。

the detailed steps of mutating the binding site are:

first, psiCHECK-2+kr-h1 recombinant plasmid was used as a template, and diluted to 100-300 pg/. Mu.l, using

HS DNA Polymerase with GC Buffer (Takara) was subjected to PCR reaction in the following reaction system:

5×Prime STAR HS Buffer/2×GCbuffer：10μl/25μL

dNTPs(2.5mM)：4μL

miR-1579-Ft/Fs/Rt/Rs (10. Mu.M): 2 mu L each

Plasmid template: 2 mu L

Polymerase: 0.5 mu L

Sterilizing water: make up to 50 mu L

The reaction procedure: 98 ℃ for 10s,55 ℃ for 15s and 72 ℃ for 7min, 29cycles and 72 ℃ for 15min are carried out in three steps; and detecting the PCR product by agarose gel electrophoresis, and cutting gel and recovering to obtain the full length of the plasmid. Then the obtained plasmid is digested with restriction enzyme DpnI (Thermo Fisher), and the digestion system is as follows:

1X FastDigest Buffer：2μL

plasmid: 500ng

DpnI：1μL

Nuclease-free water to 20. Mu.L

Incubating for 1h at 37 ℃; subsequent denaturation and renaturation. The procedure was followed at 99℃for 3min;65 ℃ for 5min; 15min at 30 ℃, and the last two steps are circulated twice; and directly converting the obtained product, picking clone, sequencing, and verifying mutation result. The mutant plasmid and miR-1579 mimetic were transfected into cells according to the cell transfection method (which was identical to the procedure described in examples 1-2-1E except that the recombinant plasmid was replaced with the mutant plasmid). As a result, the inhibition of miR-1579 on Kr-h1 luciferase activity is remarkably eliminated after mutation (see FIG. 2 b), which shows that the mutation site is a real binding site of miR-1579 and Kr-h1.

2) In vivo miR-1579 and Kr-h1 expression levels are inversely related: the RNA of the head, ovary and fat body of the 1-7d female pupae and the 4 th day female pupae were extracted according to RNAiso Plus reagent Specification (Takara), the extraction steps were as follows:

grinding the sample by a grinding rod, continuously adding liquid nitrogen until the sample is ground into powder, adding 1mL of RNAiso Plus to form a homogenate, and standing at room temperature for 5min; centrifuging at 12000 Xg and 4 ℃ for 5min; carefully aspirate the supernatant and transfer into a new centrifuge tube; adding 200 mu L of chloroform, shaking and mixing until the solution is emulsified to be milky white; standing at room temperature for 5min; centrifuging at 12000 Xg and 4 ℃ for 15min; sucking colorless supernatant and transferring the supernatant to another new centrifuge tube; adding isopropanol with the volume of 0.5-1 times of RNAiso Plus into the supernatant, reversing the centrifuge tube upside down, fully and uniformly mixing, and standing for 10min at room temperature; centrifuging at 12000 Xg and 4 ℃ for 10min; the supernatant was discarded, 1mL of 75% ethanol was added, the tube wall of the centrifuge tube was gently washed upside down, and after centrifugation at 7500 Xg at 4℃for 5min, the supernatant was carefully discarded; washing once again with 1mL of 75% ethanol; discarding the supernatant, opening a centrifugal tube cover, and drying and precipitating for a few minutes at room temperature; the precipitate was dissolved by adding 20-50. Mu.L of RNase-free water to obtain RNA. The obtained RNA is used for respectively detecting the expression quantity of miR-1579 and Kr-h1, and the specific steps are as follows:

A. detection of the spatiotemporal and tissue expression of Kr-h 1: by PrimeScript ^TM RT reagent Kit with gDNA Eraser (Perfect Real Time) kit reverse transcribes RNA into cDNA, and reverse transcription is performed as follows:

A1. the system for removing the genomic DNA reaction is as follows:

5×gDNA Eraser Buffer：2μL

gDNA Eraser：1μL

Total RNA：1μg

RNase Free dH2O: supplement to 10. Mu.L

42 ℃ for 2min; immediately placing on ice;

A2. the reverse transcription reaction is then carried out, and the reverse transcription system is as follows:

reaction solution after removing genomic DNA reaction: 10 mu L

PrimeScript RT Enzyme Mix I：1μL

RT Primer Mix：1μL

5×PrimeScript Buffer 2(for Real Time)：4μL

RNase Free dH ₂ O：4μL

The cDNA was stored for a short period of time at 37℃for 15min,85℃for 5s, and 4℃for a long period of time at-20 ℃.

A3. The obtained cDNA was used for qPCR analysis of the space-time and tissue expression of Kr-h1, the qPCR method was identical to that in example 1-1, and Kr-h1 specific primers were: cs-Kr-h1-F: ATGGCGAACGTTGTTACCGC (SEQ ID NO: 10); cs-Kr-h1-R: GAGTTTCCGCACCGTGTTCC (SEQ ID NO: 11);

B. detecting the space-time expression and the tissue expression of miR-1579: and (3) designing and synthesizing miR-1579 specific qPCR primers in the Ruibo organism (Guangzhou), and detecting the expression quantity by adopting a miRNA tailing method. According to MIDETECT A Track ^TM The miRNA qRT-PCR Starter kit (Ruibo) instruction book detects the expression level of miR-1579, and the specific steps for detecting the expression level of miRNA by a tail addition method are as follows:

poly (A) carrying out a carrying out reaction, wherein the system is as follows:

Total RNA：1μg

5×Poly(A)Polymerase Buffe：2μL

Poly(A)Polymerase：1μL

RNase-free water：up to 10μL

placing the mixture on ice for standby after the reaction is finished at 37 ℃ for 1h;

then reverse transcription reaction is carried out, and the system is as follows:

RTase mix：4μL

5×RTase Buffer：4μL

miDETECT A TrackTM Uni-RT Primer：2μL

poly (A) training product: 10 mu L

42 ℃ for 1h at 72 ℃ for 10min, and placing the obtained cDNA on ice for standby or preserving at-20 ℃.

The obtained cDNA is further used for miRNA qPCR reaction, and the system is as follows:

miDETECT A TrackTM miRNA Forward Primer 10μM：0.4μL

miDETECT A TrackTM Uni-Reverse Primer 10μM：0.4μL

2×SYBR Green Mix：5μL

cDNA：2μL

RNase-free water：2.2μL

the reaction conditions are as follows: 95 ℃ for 10min;95 ℃ for 5s,60 ℃ for 20s,70 ℃ for 10s,40cycles; dissolution profile: 95℃5s,70℃1min,95℃15s,1 cycle.

The results show that: 1-7d and the expression levels of miR-1579 and Kr-h1 in each tissue are in negative correlation (see figures 2 c-d), which shows that miR-1579 and Kr-h1 interact in the stem borer.

3) RNA co-immunoprecipitation (RIP) evaluates whether miR-1579 interacts with Kr-h1 in vivo. After 750nL miR-1579 agonist (agomiR-1579, synthesized by Ji Ma company, 200 μm, agomiR modified on the antisense strand, cholesterol modified at the 3' end, two thio-backbone modifications at the 5' end, four thio-backbone modified full-chain methoxy modifications at the 3' end) and agomiR-NC (control) were injected separately into the female pupae, RIP was performed using Ago1 antibodies (Jin Kairui, marchantia). The RIP specifically comprises the following steps: was performed using a Magna RIP kit (Millipore).

A. Tissue pretreatment: grinding the collected fresh female pupa fat bodies of the treatment group and the control group with precooled PBS, centrifuging at 800-1500rcf at 4 ℃ for 5min, discarding the supernatant, and collecting the precipitate;

B. cracking: adding 200-300 mu L of complete RIP (RIP) lysis buffer into the precipitate, blowing and mixing uniformly, carrying out ice lysis for 5min, centrifuging at 14000rcf at 4 ℃ for 15min, and collecting supernatant at-80 ℃ overnight;

C. preparing magnetic beads: reversing the microcentrifuge tube for multiple times to uniformly re-suspend the magnetic beads, placing the magnetic beads in a 1.5mL centrifuge tube, washing the magnetic beads twice by using a RIP washing solution, adding 100 mu L of the RIP washing solution after discarding the washing solution, adding 5 mu g of Ago-1 antibody or normal mouse IgG antibody, performing rotary culture at room temperature for 30min, taking out the short centrifugation, discarding the supernatant, washing the magnetic beads twice, placing the magnetic beads on a magnetic rack, and adding 900 mu L of the RIP immunoprecipitation buffer to form a RIP immunoprecipitation buffer of a magnetic bead-antibody complex;

co-immunoprecipitation of RNA binding protein-RNA complexes: rapidly thawing the lysate obtained in the step B, centrifuging at 14000rcf at 4 ℃ for 10min, taking 100 mu L of supernatant in RIP immunoprecipitation buffer of the magnetic bead-antibody complex, and incubating overnight at 4 ℃;

and E, RNA purification: taking out an immunoprecipitation reaction centrifuge tube, placing the immunoprecipitation reaction centrifuge tube in a magnetic rack, discarding supernatant, washing, discarding washing liquid, adding 150 mu L of proteinase K buffer solution, resuspending, incubating at 55 ℃ for 30min to digest protein, centrifuging briefly after incubation, placing the immunoprecipitation reaction centrifuge tube in the magnetic rack, sucking supernatant in a new centrifuge tube, adding 250 mu L of RIP washing liquid into the new centrifuge tube, and adding 400 mu L of phenol: chloroform: isoamyl alcohol (125:24:1), shaking, centrifuging at 14000rcf at 4 ℃ for 10min, taking the upper phase into a new centrifuge tube, adding 400 mu L of chloroform, shaking, centrifuging at 14000rcf at 4 ℃ for 10min, taking the upper phase into the new centrifuge tube, adding 50 mu L Salt Solution I, 15 mu L Salt Solution II, 5 mu L precipitate Enhancer and 850 mu L of absolute ethanol, and uniformly mixing, and standing overnight at-80 ℃ to precipitate RNA; taking out centrifuge tube, centrifuging at 14000rcf at 4deg.C for 30min, discarding supernatant, washing precipitate with 80% ethanol, centrifuging at 14000rcf at 4deg.C for 10min, discarding supernatant, air drying precipitate, and adding about 20 μl DEPC H ₂ O resuspension precipitation to obtain RNA;

F. by PrimeScript ^TM RT reagent Kit with gDNA Eraser (Perfect Real Time) kit reverse transcribing the RNA obtained in the previous step into cDNA, in a manner consistent with that of examples 1-2-2A, but using PrimeScript ^TM II 1st Strand cDNA The random hexamers of the random hexamer primers of (Takara) in the Synthesis Kit replaces the RT Primer Mix primers in the Kit; qPCR detects the abundance of Kr-h1, and the qPCR method is identical to the qPCR method in example 1-1, and the primers used in example 1-2-2A for detecting Kr-h1.

The results show that Kr-h1 is significantly enriched after the agomiR-1579 treatment compared to the control (see FIG. 2 e), demonstrating the interaction of miR-1579 with Kr-h1 in vivo.

The above experimental description is summarized: miR-1579 directly targets Kr-h1 and inhibits its expression.

Example 2miR-1579 functional verification

Injecting 350nL miR-1579 agonist (synthesized by agomiR-1579, ji Ma company, 200 mu M) into larvae of 3 days old 2 to overexpress miR-1579, collecting samples for 48 hours, and respectively detecting the expression levels of miR-1579 and Kr-h1, wherein a qPCR detection method is consistent with that of the embodiment 1-2-2A/2B; at the same time, survival rates of 24h, 48h, 72h, 96h and 144h larvae after injection were recorded. The results show that: after the miR-1579 agonist is injected, the expression level of miR-1579 is obviously increased by 113.9 times (see FIG. 3 a), and the expression level of Kr-h1 is reduced by 83.2 percent (see FIG. 3 b), and compared with the death rate of a control (25.9 percent), the death rate of larvae in a treatment group is 91.7 percent (see FIG. 3 c); in addition, dead larvae had smaller and shorter larvae than the control (see fig. 3 d), demonstrating that miR-1579 can act as a potential target for controlling chilo suppressalis.

Example 3 acquisition and screening of MiR-1579-transformed Rice

1. Acquisition of transgenic miR-1579 rice

1) Construction of an artificial miR-1579 expression vector: the expression cassette was constructed from the artificial miRNA expression cassette reported by Jiang et al (2017), in a manner consistent with this example.

2) Genetic transformation of rice: the constructed final expression vector pUbi-amiR-1579 was transformed into well-formed flower 11 by Agrobacterium-mediated transformation. Agrobacterium-mediated genetic transformation essentially comprises the following steps: husking rice seeds and then sterilizing; inducing embryo callus; screening positive rice transformants by using a kanamycin-containing culture medium; somatic embryogenesis; rooting the callus; the fully regenerated plants were transferred to a greenhouse for continued cultivation to obtain T0 generation rice (He et al, 2019).

2. Screening of miR-1579 transformed rice

1) Firstly, extracting genome DNA of 30T 0 generation transgenic rice leaves by adopting a CTAB method, extracting (cool beating, beijing) by using a 2X CTAB extracting solution according to the specification, and then utilizing an hpt gene sequence (hpt-F: ACACTACATGGCGTGATTTCAT (SEQ ID NO: 12); PCR analysis was performed on hpt-R TCCACTATCGGCGAGTACTTCT (SEQ ID NO: 13)) to obtain 30 transgenic rice plants each positive for the transformant (see FIG. 4 a).

2) Digoxin (DIG) label probes using the HPT complement (HPT-F: ACACTACATGGCGTGATTTCAT (SEQ ID NO: 14); HPT-R: TCCACTATCGGCGAGTACTTCT (SEQ ID NO: 15)) to determine the integration and copy number of the genome of transgenic rice, the southern blot experiment was as follows:

A. genomic DNA and plasmid DNA cleavage: the sample was digested with HindIII, genomic DNA 10. Mu.g, 10 XM buffer 3. Mu.L, hindIII 40U, and ddH ₂ O to 30 mu L, and enzyme cutting at 37 ℃ for 16h;

B. electrophoresis: preparing 0.8% agarose gel by TAE, and electrophoresis of enzyme digestion products for 16h under 30V voltage;

C. transfer film by capillary method: imprinting the enzyme-digested product after electrophoresis on a nylon membrane by utilizing a capillary method;

D. hybridization and detection: the target fragment in the sample is detected by a non-radioactive detection method, and the result shows that: of the 15 lines, 8 contained one copy of amiR-1579 and the other lines contained multiple copies (see FIG. 4 b).

3) And finally, determining the expression quantity of miR-1579 in each transgenic plant strain by qPCR, so as to select a strain with single copy and high miR-1579 expression for subsequent bioassay experiments. The results show that: since the expression level of 5 lines miR-1579 was high (C#4, C#5, C#10, C#17, C#22) (FIG. 4C), 3 lines (C#10, C#17, C#22) were selected for bioassay.

Example 4 transgenic plant insect-receiving bioassay

The method comprises the following specific steps:

bioassays include indoor bioassays and outdoor bioassays.

(1) Indoor bioassay: cutting the fresh stems of the 3 high miR-1579 expression rice lines obtained in the above way into stem segments, feeding the stem segments to newly hatched 1-year-old larvae, and placing the larvae in a culture dish. Fresh stalks were replaced every 3d until death, and mortality and related parameters were recorded. The results show that: the survival rate of larvae feeding on transgenic amiR-1579 rice was significantly reduced compared to control. The average mortality of the 3 transgenic lines (c#10, c#17, c#22) after 30d treatment was 44.4%, 51.1% and 56.7%, respectively. However, the average mortality of the control group was 12.23% (see fig. 5 a), showing a relatively high inhibition of chilo suppressalis. As shown in fig. 5b, larvae fed on transgenic plants showed death and darkened epidermis. The larval survival times were shorter for lines c#17 and c#22 compared to the control group, but the differences were not significant (see fig. 5C). Furthermore, the pupae weight of surviving chilo suppressalis was significantly reduced (see FIGS. 5d,5 e).

(2) Outdoor bioassay: since line c#22 showed more stable and higher resistance in the indoor bioassay, resistance to chilo suppressalis was evaluated using 4-strain jointing booting stage T1 generation transgenes and wild type rice, respectively. Each rice plant is connected with 25 first 1-year larvae, and the larvae are respectively placed in insect-raising cages, and the damage degree of the rice plants is observed. The results show that: after 18d of inoculation, the damage degree of the chilo suppressalis to the transgenic rice is obviously lower than that of the wild rice. Specifically, chilo suppressalis only causes local tissue damage to transgenic rice, but causes extensive damage to wild-type rice (see FIGS. 5g,5h,5i,5 j). In addition, 3 wild-type rice plants died, 1 survived, and 3 survived in 4 transgenic rice plants, with only local tissue damage.

Example 5 safety assessment of transgenic Rice against non-target insects

In order to determine the safety of the transgenic rice against non-target insects, the rice pests Bai Beifei lice Sogatella furcifera (WBPH) in the same ecological niche are used as representative insects, the transgenic rice and the wild rice are fed in the same way, the plant injury condition and the plant hopper mortality rate are observed for each plant of 20 first 1-year nymphs, and relevant parameters are recorded until death. The results show that: the population size, nymph calendar period, cumulative emergence rate and adult life of transgenic miR-1579 rice are not affected (see FIGS. 6 a-e). Meanwhile, the fertility of the long-wing planthoppers fed with the transgenic miR-1579 rice strain is not changed (see figure 6 f). In combination, the miR-1579 rice has no influence on the development and reproduction of the sogatella furcifera, and has stronger specificity.

Example 6 evaluation of agronomic Properties of MiR-1579 transformed Rice

One transgenic rice line (C#10) was selected for evaluation of agronomic traits. Transgenic and wild type rice were grown in the field (FIGS. 7 a-c). From the booting stage to the mature stage, 5 characters of plant height, single plant tillering number, spike length, 500 grain weight and fruiting rate are counted respectively. The seeds were weighed after washing and drying. The results show that: the plant line C#10 and the wild rice have no obvious difference in plant height (figure 7 d), single plant tillering number (figure 7 e), 500 grain weight (figure 7 f), spike length (figure 7 g) and fruiting rate (figure 7 h), which indicates that the yield of the rice is not affected by transferring miR-1579.

Reference to the literature

Jiang S,Wu H,Liu H,Zheng J,Lin Y,Chen H.2017The overexpression of insect endogenous small RNAs in transgenic rice inhibits growth and delays pupation of striped stem borer(Chilo suppressalis).Pest Manag Sci.73(7),1453-1461.

Chiu J,March PE,Lee R,Tillett D.2004Site-directed,Ligase-Independent Mutagenesis(SLIM):a single-tube methodology approaching 100％efficiency in 4h.Nucleic Acids Res.32(21),e174.

Tang Y,He H,Qu X,Cai Y,Ding W,Qiu L,Li Y.2020RNA interference-mediated knockdown of the transcription factor Krüppel homologue 1suppresses vitellogenesis in Chilo suppressalis.Insect Mol Biol.29(2),183-192.

He K,Xiao H,Sun Y,Ding S,Situ G,Li F.2019Transgenic microRNA-14rice shows high resistance to rice stem borer.Plant Biotechnol J 17(2),461-471。

Claims (10)

1. A miRNA is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1 or the nucleotide sequence shown as SEQ ID NO. 1 is modified, substituted, deleted or added with at least one base to obtain the nucleic acid sequence.

2. A kit, recombinant vector or transgenic cell comprising the miRNA of claim 1.

3. Use of a miRNA according to claim 1 or a kit, recombinant vector or transgenic cell according to claim 2 for insect control, wherein the use is killing of insect bodies.

4. The use according to claim 3, wherein the insect is a rice pest.

5. The use according to claim 4, wherein the rice pest is Chilo suppressalis.

6. Use of a miRNA according to claim 1 or a kit, recombinant vector or transgenic cell according to claim 2 for the preparation of an insecticide.

7. An insecticide containing the miRNA of claim 1 or the kit, recombinant vector or transgenic cell of claim 2.

8. A method of controlling insects, comprising the steps of: expressing the miRNA of claim 1 in a plant.

9. The method of claim 8, wherein the plant is rice.

10. The method according to claim 8, comprising the steps of:

s1, constructing a miRNA expression cassette for mediating gene silencing in vitro by using the miRNA; and transforming the constructed final expression vector into a plant through agrobacterium-mediated transformation to obtain a transgenic plant.

S2, cutting fresh stems of the obtained transgenic plants into stem segments, feeding the stem segments to newly hatched 1-year-old larvae, placing the larvae in a culture dish until death, and recording the death rate and the individual development condition;

or taking a plurality of first 1-year larvae to be connected to the transgenic plants, placing the transgenic plants in an insect-raising cage until death, and recording the death rate and the damage condition of the plants.

Images