CN115927316A

CN115927316A - Application of miR408 in enhancing plant disease resistance

Info

Publication number: CN115927316A
Application number: CN202210972518.6A
Authority: CN
Inventors: 梁超琼; 梁艳红; 郭婕; 惠冰心; 朱晶晶; 李洋
Original assignee: Shaanxi Academy of Forestry
Current assignee: Shaanxi Academy of Forestry
Priority date: 2022-08-15
Filing date: 2022-08-15
Publication date: 2023-04-07

Abstract

The invention discloses application of miR408 in enhancing plant disease resistance. The invention takes miR 408-transformed cucumber as a research object, researches the influence of miR408 on the damage degree of the affected cucumber from the perspective of molecular biology, and proves that miR408 regulates and controls the disease-resistant way of cucumber. The invention has great significance for revealing the function of miR408 and cultivating new cucumber varieties.

Description

Application of miR408 in enhancing plant disease resistance

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of miR408 in enhancing plant disease resistance.

Background

MicroRNAs (miRNA) are endogenous micromolecule non-coding RNAs with the length of 21-25 nucleotides, and are mainly used for regulating the expression of plant genes by guiding shearing or inhibiting translation, and participating in regulating and controlling various aspects of plant growth and development, signal transduction, adversity stress and the like. Plant endogenous mirnas play an important role in regulating gene expression in Pathogen-associated molecular patterns (PAMPs) triggered immunity (PTIs) and Effector-triggered immunity (ETIs). When a pathogen invades, miRNA directly resists the invasion of the pathogen by enhancing physical and mechanical resistance of plant cell walls and the like, or is used as an initial signal source to activate key transcription factors of a disease-resistant path by participating in regulation and control of disease-resistant related signal paths so as to reasonably regulate and control various resistance mechanisms of the plant to resist the invasion of the pathogen, and miRNA can also directly regulate and control plant resistance genes and proteins thereof to cause the expression of the disease-resistant defense genes, so that the expression products of the miRNA can inhibit the growth of the pathogen. These mirnas function by up-regulating or down-regulating expression upon pathogen infestation, by inhibiting negative regulators in the defence response and by promoting positive regulators in the defence response.

The cucurbitaceae crop virus disease caused by Cucumber Green Mottle Mosaic Virus (CGMMV) is continuously enlarged in the area of China, the damage is increasingly serious, the cucurbitaceae crop virus disease gradually becomes one of the main diseases in the production of cucurbitaceae crops such as Cucumber in China, and the improvement of the yield and quality characters of the Cucumber is severely restricted. In view of the fact that no effective antiviral agent is developed at present, breeding of disease-resistant varieties is still the first choice for preventing and treating viral diseases in production. Therefore, the identification and screening of the CGMMV-resistant key gene of the cucumber and the exploration of the antiviral molecular mechanism can provide a theoretical basis for the breeding of disease-resistant varieties.

Disclosure of Invention

The invention aims to provide a miRNA related to plant disease resistance and application thereof.

The cucumber endogenous miRNA provided by the invention is named miR408, the nucleotide sequence of the cucumber endogenous miRNA is SEQ ID No.1, wherein the SEQ ID No.1 consists of 21 nucleotides.

Biological materials related to miR408 also belong to the protection scope of the invention.

The biological material related to miR408 is a Short Tandem Target Mimetic (STTM) sequence, which encodes a nucleic acid molecule that inhibits the miRNA molecule.

The biological material related to miR408 is an expression cassette comprising a nucleic acid molecule encoding for inhibition of the miRNA molecule.

Wherein the nucleic acid molecule may be a DNA, such as a cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In one embodiment of the invention, the nucleic acid molecule encoding for inhibiting said miRNA molecule is SEQ ID No.2.

The biological material related to miR408 is a recombinant vector which comprises a nucleic acid molecule for encoding and inhibiting the miRNA molecule or the expression cassette.

The biological material associated with miR408 is a recombinant microorganism comprising a nucleic acid molecule encoding for inhibition of the miRNA molecule, or the expression cassette, or the recombinant vector.

The biological material associated with miR408 is a transgenic plant cell line comprising a nucleic acid molecule encoding for inhibition of the miRNA, or the expression cassette, or the recombinant vector.

The miRNA molecule, the short tandem target mimic sequence, the expression cassette, or the recombinant vector, or the recombinant microorganism, or the transgenic plant cell line can be used to modulate plant disease resistance.

In embodiments of the invention, the vector may be a plasmid, a phage, or a viral vector.

In a specific embodiment of the invention, the recombinant vector can be an expression vector expressing a nucleic acid molecule that inhibits expression of miR408. Specifically, the recombinant vector can be a recombinant vector containing SEQ ID No.2. The recombinant vector containing SEQ ID No.2 is a vector pTRV2: STTM-miR408 obtained by integrating a Short Tandem Target Mimic (STTM) sequence (DNA fragment shown in SEQ ID No. 2) of miR408 with the length of 126bp into a pTRV2 vector through homologous recombination. Wherein, STTM is a specific sequence (GTTGTTGTTGTTATGGTCTAATTTAAATGGTCTAAAGAGAAGAAGAAGAA T) with the length of 48 bases, two TMs (Target mics) are connected, a protrusion structure consisting of 3 bases (cta) is arranged at the miRNA cutting sites on the two TMs, and due to the existence of the protrusion, the miRNA can be combined with the miRNA but can not really cut the miRNA, thereby playing the role of inhibiting the miRNA function. Thus, the vector can be used to express a target mimic of a miRNA to silence a plant endogenous miRNA.

miR408 can be transiently silenced in cucumber by a Virus-based MicroRNA Silencing (VBMS) technique based on Tobacco Rattle Virus (TRV). The recombinant vector is a pTRV2: STTM-miR408 vector, and the pTRV2: STTM-miR408 vector is a recombinant vector obtained by introducing a fragment shown in SEQ ID No.2 into a pTRV2 vector.

The invention provides a method for cultivating a transgenic plant with enhanced disease resistance, which comprises the steps of silencing miRNA molecules in a receptor plant and obtaining the transgenic plant with higher disease resistance than the receptor plant.

Specifically, miR408 can be transiently silenced in cucumber by VbMS technology. In an embodiment of the present invention, the recombinant expression vector is obtained by co-transfecting the recipient plant with a recombinant microorganism containing pTRV1 and a recombinant microorganism containing pTRV2: STTM-miR408 vector.

In the method for producing a transgenic plant with enhanced disease resistance, the miRNA molecule, the expression cassette, or the recombinant vector is introduced into the recipient plant by using the recombinant microorganism.

In an embodiment of the present invention, the recombinant microorganism may be a yeast, a bacterium, an algae, or a fungus. The bacteria may be agrobacterium; the agrobacterium may specifically be GV3101 agrobacterium.

In a specific embodiment of the present invention, in the method for breeding a transgenic plant with enhanced disease resistance, the recombinant microorganism is Agrobacterium GV3101 containing pTRV1 or pTRV2: STTM-miR408.

In the above method, the transgenic plant has a disease resistance higher than that of the recipient plant expressed in all or part of the following A1) -A2):

a1 The accumulated amount of CGMMV RNA in the transgenic plant is lower than that in the recipient plant;

a2 Less chlorosis, less yellowing spots on leaves of said transgenic plant than on leaves of said recipient plant.

In embodiments of the invention, the transgenic plant cell line does not include propagation material of the plant.

In the embodiment of the invention, the regulation and control of plant disease resistance is to improve plant disease resistance, and is embodied in all or part of the following B1) -B2):

b1 When the expression level of miR408 in the plant is reduced, the accumulation amount of CGMMV RNA in the plant is reduced;

b2 When the expression level of miR408 in the plant is decreased, the chlorosis and yellowing spots on the leaves of the plant are decreased.

In the above method, the plant is a dicotyledonous plant; the dicotyledonous plant can be cucumber; the cucumber can be specifically a Xintai Mici cucumber.

In the above method, the transgenic plant is understood to include not only the first generation transgenic plant obtained by transforming the target plant with the gene, but also the progeny thereof. For transgenic plants, the gene can be propagated in the species, or transferred into other varieties of the same species, including commercial varieties in particular, using conventional breeding techniques. The transgenic plants include seeds, whole plants and cells.

The invention adopts bioinformatics prediction, molecular cloning technology, agrobacterium-mediated transformation, miRNA Silencing (Virus-based MicroRNA Silencing, VBMS) based on tobacco rattle Virus, real-time fluorescence quantitative PCR and other biological means, takes miR 408-Silencing cucumber as a research object, takes cucumber transferred into an empty vector pTRV1+ pTRV2 as a contrast, silences miR408 for the first time, observes chlorosis and etiolation spots on leaves after diseases occur by measuring the Virus RNA accumulation after CGMMV inoculation, and researches the influence of miR408 on the damage degree of infected plants from the aspect of molecular biology. Compared with a control group plant, the disease resistance of the miR 408-silencing transgenic plant is higher than that of the control group plant, and miR408 is micro RNA related to plant disease resistance and can be used for regulating and controlling the disease resistance of a target plant.

Drawings

FIG. 1 is a schematic diagram of short tandem target simulation sequence of cucumber miR408

FIG. 2 is a quantitative analysis of miR408 in miR 408-silenced cucumber

FIG. 3 is analysis of CGMMV RNA accumulation in miR408 silent cucumber

TRV:00 in FIGS. 2-3 represents a blank control group (cucumber seedlings were infiltrated with a pTRV1+ pTRV2 mixed bacterial solution mixed at a ratio of 1

TS in FIGS. 2-3 represents Transient silencing (Transient silencing)

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention.

The experimental procedures in the following examples are all conventional ones unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Agrobacterium-competent cells GV3101 in the examples described below were purchased from Shanghai-Weidi Biotech Ltd.

The inbred line "Xintai Mici" of cucumber in the following examples was purchased from the Xintai Mici cucumber stock farm, xintai City, shandong province.

The vectors pTRV1, pTRV2 in the following examples are commercially available from Hunan Fenghui Biotech Co., ltd.

The mature sequence of miR408 in the invention is an RNA molecule shown in SEQ ID No.1 in a sequence table.

The nucleic acid sequence for silencing miR408 in the invention is a DNA molecule shown in SEQ ID No.2 in a sequence table.

The invention takes miR 408-transformed cucumber as a research object, takes wild-type Xintai mici cucumber as a contrast, researches the influence of miR408 on the damage degree of an infected plant from the perspective of molecular biology by detecting the accumulation amount of virus RNA in a receptor plant challenging to inoculate cucumber green mottle mosaic virus, and proves that miR408 regulates and controls a plant disease-resistant way. The invention has great significance for revealing the disease-resistant function of miR408 and cultivating disease-resistant cucumber varieties, and is beneficial to enriching vegetable breeding resources.

Example 1 application of miR408 in regulation of cucumber disease resistance

1. Influence of silent miR408 on cucumber disease resistance

Short Tandem Target Mimics (STTM) sequences of miR408 were designed and synthesized (fig. 1), and miR408 was silenced in cucumber seedlings using miRNA Silencing technology (VbMS) based on Tobacco Rattle Virus (TRV).

1. Construction of silent miR408 vector and cucumber obtaining

(1) Construction of silencing vector pTRV2: STTM-miR408 and agrobacterium transformation

An STTM fragment (SEQ ID No. 2) of miR408 was synthesized by Cloning the target fragment into a pTRV2 vector (purchased from Takara Biotech Co., ltd.) using Infusion HD Cloning Kit (purchased from Takara Co., ltd.) to obtain a pTRV2: STTM-miR408 vector, and 2.5. Mu.L of In-Fusion reaction solution was taken to transform the pTRV2: STTM-miR408 vector into an E.coli competent cell Stellar (purchased from Beijing hologold Biotech Co., ltd.); plasmid DNAs of pTRV1 (purchased from Hunan Fenghui Biotechnology Co., ltd.) and pTRV2: STTM-miR408 which are identified as positive by sequencing analysis are respectively transferred into agrobacterium GV3101 competent cells (purchased from Shanghai Weishi Biotechnology Co., ltd.), a single colony is selected for colony PCR verification, and plasmid DNAs are extracted for sequencing.

(2) Obtaining of miR 408-silenced cucumber

miR408 is transiently silenced in cucumber using Virus-based miRNA Silencing (VbMS) technique. The method comprises the following specific steps:

(1) the seeds of the cucumber with Xintai Mici are sown in a plastic flowerpot after accelerating germination and are placed in a plant growth incubator for growth.

(2) When the first true leaf growing point of cucumber seedling is exposed (about 5-7 days), lightly making a tiny wound by using a blade under dark condition, soaking cotton by using agrobacterium containing pTRV1 and pTRV2: STTM-miR408 vectors (mixed according to the proportion of 1; treatment was performed using pTRV1+ pTRV2 mixed bacterial suspension (mixed at a ratio of 1; agrobacterium transformed with pTRV1 and pTRV2: PDS (mixed in a ratio of 1. Wetting the cotton ball with corresponding bacterial liquid again every 2h, repeating for 3 times, removing the cotton ball with bacterial liquid after the wetting is finished, placing the cucumber seedling in a plant growth incubator, growing under 16h illumination and 8h dark conditions, and watering as required during the growth period.

2. Effect of silent miR408 on cucumber disease resistance

(1) The cucumber seedlings grow for about 10 days after treatment, and CGMMV is inoculated by friction when the first true leaves are unfolded. And (3) sampling the 2 nd and 3 rd leaves of the cucumber plant after the cucumber plant grows for 15-20 days, extracting total RNA, and respectively detecting the expression level of miR408 and the RNA accumulation condition of the CGMMV virus by adopting a real-time fluorescent quantitative PCR method.

(2) Respectively adopting specific primers of miR408 and CGMMV to carry out qRT-PCR detection, and adopting 2 ^-△△Ct The method calculates the relative expression quantity of miR408 and CGMMV coat protein genes and analyzes the expression condition. The upstream primer sequence of miR408 is 5 'and TGCACTGTCCTCCTTCCCTGG-3', and the downstream universal primer is provided by miRcute enhanced miRNA fluorescent quantitative detection kit (SYBR) (FP 411, purchased from Tiangen Biochemical technology (Beijing) Co., ltd.); the upstream primer sequence of the internal reference gene EF-1a is 5 'ACTGGTGGTTTTGAGGCTGGT-3', and the downstream primer sequence is 5 'CTTGGAGTTTTTGGGGTGTGGGT-3'; the upstream primer sequence of the internal reference gene Ubiquitin is 5; qPCR of CGMMV coat protein geneThe primer sequence is 5' upstream-.

The results show that: in cucumbers (TS-miR 408 in figures 2 and 3) transfected with Agrobacterium containing pTRV1 and Agrobacterium containing pTRV2: STTM-miR408, miR408 expression level is reduced to 0.01 (figure 2) and CGMMV RNA accumulation is reduced to 0.05 (figure 3) relative to the control (TRV: 00 in figures 2 and 3) of the transfer empty vector (pTRV 1+ pTRV 2). The chlorosis and etiolation spots on miR 408-silenced cucumber leaves were less than the empty vector control.

In conclusion, compared with the control group plants, the disease resistance of the miR 408-silencing transgenic plants is higher than that of the control group plants, and miR408 is micro RNA related to plant disease resistance and can be used for regulating and controlling the disease resistance of target plants.

Claims

1. A miRNA molecule is characterized in that the mature sequence of the miRNA molecule is SEQ ID No.1 in a sequence table.

2. A short tandem target mimetic sequence encoding a nucleic acid molecule that inhibits the miRNA molecule of claim 1, having the nucleotide sequence of SEQ ID No.2 of the sequence listing.

3. An expression cassette comprising the concatemeric target mimetic sequence of claim 2.

4. A recombinant vector comprising the concatemeric target mimetic sequence of claim 2 or the expression cassette of claim 3.

5. A recombinant microorganism comprising a nucleic acid molecule encoding the miRNA molecule of claim 1, or encoding a nucleic acid molecule inhibiting the miRNA molecule of claim 1, or the expression cassette of claim 2, or the recombinant vector of claim 3.

6. A transgenic plant cell line comprising the concatemeric target mimetic sequence of claim 2, or the expression cassette of claim 3, or the recombinant vector of claim 4, or the recombinant microorganism of claim 5.

7. Use of the miRNA molecule of claim 1, or the short tandem target mimetic sequence of claim 2, or the expression cassette of claim 3, or the recombinant vector of claim 4, or the recombinant microorganism of claim 5, or the transgenic plant cell line of claim 6 for modulating disease resistance in plants.

8. A method for breeding transgenic plants with enhanced disease resistance, which comprises silencing the miRNA molecule of claim 1 in a recipient plant to obtain a transgenic plant with enhanced disease resistance relative to the recipient plant;

preferably, the plant is a dicot.

9. The method of claim 8, wherein the miRNA molecule of claim 1 is transiently silenced in cucumber using a tobacco rattle virus-based miRNA silencing technique by using the short tandem target mimic sequence of claim 2.