CN115029349A

CN115029349A - circRNA related to plant disease resistance, source gene and application thereof

Info

Publication number: CN115029349A
Application number: CN202210643275.1A
Authority: CN
Inventors: 梁超琼; 李健强; 罗来鑫; 任博文; 苗朔; 刘�文
Original assignee: China Agricultural University; Shaanxi Academy of Forestry
Current assignee: China Agricultural University; Shaanxi Academy of Forestry
Priority date: 2022-06-09
Filing date: 2022-06-09
Publication date: 2022-09-09

Abstract

The invention discloses circRNA related to plant disease resistance, a source gene and application thereof. The nucleotide sequence of the circRNA molecule is SEQ ID No.1 in a sequence table. The circRNA and the source gene thereof have the function of regulating and controlling the plant disease resistance way. The disease resistance function of the circRNA and the source gene thereof has great significance for the cultivation of disease-resistant cucumber varieties and is beneficial to the enrichment of vegetable breeding resources.

Description

circRNA related to plant disease resistance, source gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to circRNA (circulating ribonucleic acid) related to plant disease resistance, a source gene and application thereof.

Background

Cucumber (Cucumis sativus L.) plays a major role in vegetable production in China, however, various pathogens often cause the yield and quality of cucumber to be affected to different degrees and even cause serious economic loss. After Cucumber Green Mottle Mosaic Virus (CGMMV) infects a host, mosaic and mottle symptoms are usually generated on the leaf part and the fruit surface of a plant to form a green fading spot or a verrucous protuberance, the plant is dwarfed and blossoms are delayed when the plant is serious, and finally the serious yield reduction and even the loss of the plant are caused. In recent years, the spread of the CGMMV worldwide is intensified by the increasingly frequent round-trip of global plant propagation materials and seed trade, the green mottle mosaic virus disease caused by the CGMMV has become one of the main limiting factors of the yield and quality of cucurbits crops such as cucumbers, watermelons and melons, and many countries and regions have listed the CGMMV as epidemic pests. However, no effective field control method and disease-resistant variety for the virus disease exist at present. Therefore, the cultivation of new species with stable resistance and specific mechanism is the key for efficiently preventing and treating virus diseases such as green mottle mosaic disease, and the molecular biology technology for obtaining resistant species becomes a stable, long-term, economic and effective strategy.

Circular RNA (Circular RNA) is a newly discovered endogenous non-coding RNA in the form of a closed loop. The CircRNA is a source gene (Host gene) of the CircRNA, and 3 'ends and 5' ends are connected through exon cyclization or intron cyclization, so that a complete covalent closed ring structure is formed, the CircRNA is not influenced by RNA exonuclease, is more stable and conservative than linear RNA, and can be abundantly present in organisms in various types. There are three major classes of circrnas: the first is circRNA formed by exon circularization; the second is intron circRNA, also known as crna, formed by intron lassification (Intra-lariat); the third type is circRNA (Extron-intron circRNA) in which an intron and an exon are cyclized together, that is, EIciRNA. Bioinformatic analysis finds that the species of circRNA show diversity along with the degree of species evolution. Plant circRNA participates in multiple life processes such as flower development, fruit maturation, stress response and the like through cell type specific expression and tissue specific expression. In addition, the circRNA containing only exon sequences as endogenous competitive RNA (cerana) can be competitively bound to micro RNA (miRNA) (as miRNA "sponge" to trap miRNA), affecting the post-transcriptional regulatory function of miRNA, i.e. preventing its binding to target mRNA, thereby protecting its target mRNA from miRNA-mediated inhibition or degradation.

Since 2014, the first circRNA discovery by scholars on the root of Arabidopsis thaliana, the circRNA of various plants such as rice, corn, tomato, cucumber and the like is identified in succession. For example, it is found that the sequence of rice circR5g05160 contains potential target sites for binding osa-miR168-5p and osa-miR2103, the source gene encodes a putative plant immune regulatory factor MPK14, and overexpression of circR5g05160 enhances the resistance of rice to rice blast bacteria. Wang et al found that 83 and 32 circRNAs were specifically expressed in tomato leaves infected with a yellow leaf curl Virus and a control sample, respectively, and instantly silenced a gene from tomato Slcirc 108-Solyc07g043420.2.1 by Tobacco rattle Virus-induced gene silencing technology (TRV; Virus induced gene cloning, VIGS), and the results showed that the accumulation of the Virus in the treated tomato plant was reduced by 5 times, and the tomato leaf curl Virus shows a certain degree of resistance to infection by tomato yellow leaf curl Virus. Zhu et al identified 1934 and 44 circRNAs in cucumber root and leaf samples, respectively, that could respond to salt stress and differentially express, where the circRNAs Chr3:13041746|13044121 (derived from Csa6G008780) and Chr6:915006|915916 (derived from Csa3G185140) were associated with proline metabolism. He and other researches find that under the condition of high-temperature stress, 7 circRNAs in cucumber can be competitively combined with 114 miRNAs which are differentially expressed, so that the regulation of 359 downstream target mRNAs (participating in plant hormone signal transduction, plant-pathogen interaction and glutathione metabolic process) can be interfered, wherein 2 circRNAs (novel _ circ _001543 and novel _ circ _000876) can be used as Endogenous competitive RNAs (ceRNAs) to be competitively combined with miR9748, and the regulation effect of miR9748 on target genes Csa1M690240.1, Csa6M091930.1 and Csa7M405830.1 is influenced, and the cucumber response to the high-temperature stress is mediated in a plant hormone signal transduction pathway. However, the mechanism of studies of circRNA as a ceRNA inhibitory miRNA in cucumber infection in response to CGMMV is not clear.

The cultivation of new species with strong disease resistance and stable resistance is a fundamental measure for preventing and treating cucumber green mottle mosaic virus, and the acquisition of resistant species by using molecular biology technology has become a stable, long-term, economic and effective strategy. Based on the method, the cucumber antiviral key genes regulated and controlled by the endogenous miRNA are identified and screened, the circRNA capable of being competitively combined with the miRNA is excavated, so that the regulation and control function of the miRNA after transcription is influenced, the cucumber circRNA and miRNA-mediated antiviral molecular mechanism is systematically explored, and theoretical basis and technical support can be provided for the cultivation of safe and stable disease-resistant varieties.

Disclosure of Invention

The invention aims to provide a circRNA related to plant disease resistance, a source gene and application thereof.

The circRNA molecule of the exon type provided by the invention is named as circRNA319, and the nucleotide sequence of the circRNA molecule is SEQ ID No. 1. Wherein SEQ ID No.1 consists of 458 nucleotides.

The source gene of the circRNA provided by the invention is named CsAV3_4G030800, and the nucleotide sequence of the source gene is SEQ ID No. 2. Wherein SEQ ID No.2 consists of 1620 nucleotides.

The biological material related to the circRNA319 and the source gene CsAV3_4G030800 also belongs to the protection scope of the invention.

The biological material related to the circRNA319 and the source gene CsaV3_4G030800 thereof is an expression cassette comprising a nucleic acid molecule encoding said circRNA molecule, or said source gene, or a nucleic acid molecule encoding a nucleic acid molecule inhibiting the expression of said circRNA molecule or said source gene.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In one embodiment of the invention the nucleic acid molecule encoding said circRNA molecule is as SEQ ID No.3 or SEQ ID No. 4.

The biological material related to the circRNA319 and the source gene CsaV3_4G030800 thereof is a recombinant vector comprising a nucleic acid molecule encoding said circRNA molecule, or said source gene, or a nucleic acid molecule encoding a gene inhibiting the expression of said circRNA molecule or said source gene, or said expression cassette.

The biological material related to circRNA319 and its source gene CsaV3_4G030800 is a recombinant microorganism comprising a nucleic acid molecule encoding said circRNA molecule, or said source gene, or a nucleic acid molecule encoding a gene inhibiting the expression of said circRNA molecule or said source gene, or said expression cassette, or said recombinant vector.

The biological material related to the circRNA319 and the source gene CsaV3_4G030800 thereof is a transgenic plant cell line comprising a nucleic acid molecule encoding said circRNA molecule or said source gene or said expression cassette or said recombinant vector or said recombinant microorganism.

The circRNA molecule, the source gene, the expression cassette or the recombinant vector or the recombinant microorganism or the transgenic plant cell line can be used for regulating and controlling plant disease resistance.

In a specific embodiment of the present invention, the expression cassette is a DNA capable of forming a circRNA molecule after transcriptional processing in a host cell, and the DNA may include not only a promoter for initiating transcription of a nucleic acid molecule encoding the circRNA molecule, but also a terminator for terminating transcription of a nucleic acid molecule encoding the circRNA molecule. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator.

In an embodiment of the invention, the promoter for initiating transcription of the nucleic acid molecule encoding the circRNA molecule in the expression cassette is CaMV35S promoter and the terminator for terminating transcription of the nucleic acid molecule encoding the circRNA molecule is agrobacterium nopaline synthase terminator (NOS terminator).

In embodiments of the invention, the vector may be a plasmid, a phage, or a viral vector.

The recombinant vector can be an expression vector for expressing the circRNA molecule, in particular to a recombinant expression vector containing SEQ ID No.3 or SEQ ID No.4, and the starting vector can be pCAMBIA 1304.

In a specific embodiment of the invention, the recombinant vector is pCAMBIA1304-circRNA 319; the pCAMBIA1304-circRNA319 is a recombinant vector obtained by integrating a DNA fragment of 858bp (a DNA fragment shown in SEQ ID No. 4) into a pCAMBIA1304 vector through homologous recombination. The DNA molecule shown in SEQ ID No.4 is a sequence obtained by adding 200bp flanking introns to the upstream and downstream of the coding sequence (shown in SEQ ID No.3) of the circRNA molecule.

The recombinant vector can be an expression vector for expressing a nucleic acid molecule for inhibiting the expression of the source gene CsaV3_4G030800 of the circRNA 319. Specifically, the recombinant vector can be SEQ ID No.5, and the sequence shown in SEQ ID No.5 is a reverse complementary sequence from 15016 th position to 15315 th position on a CsAV3_4G030800 nucleic acid sequence and is used for silencing a circRNA319 derived gene CsAV3_4G 030800.

The CsaV3_4G030800, a source gene of circRNA319, can be transiently silenced in cucumber by employing Virus-induced gene silencing (VIGS) technology. The recombinant vector is pTRV2 circRNA319CsaV3_4G030800 vector, and the pTRV2 circRNA319CsaV3_4G030800 vector is a recombinant vector obtained by introducing a fragment shown in SEQ ID No.5 into pTRV2 vector.

The invention provides a method for breeding transgenic plants with reduced resistance, which comprises the step of introducing the circRNA molecule, or the nucleic acid molecule for coding the circRNA molecule, or the expression cassette containing the nucleic acid molecule for coding the circRNA molecule, or the recombinant vector containing the nucleic acid molecule for coding the circRNA molecule into a receptor plant to obtain transgenic plants with lower disease resistance than the receptor plant.

In the method for breeding transgenic plants with reduced resistance, specifically, the method is characterized in that a nucleic acid molecule which encodes the circRNA molecule is introduced into a receptor plant, and a transgenic plant which overexpresses the circRNA molecule is screened to obtain a transgenic plant with lower disease resistance than the receptor plant.

In a specific embodiment of the invention, the nucleic acid molecule encoding said circRNA molecule is introduced into the recipient plant via the recombinant vector pCAMBIA1304-circRNA 319.

The invention also provides a method for cultivating transgenic plants with enhanced disease resistance, which comprises the step of silencing the source gene of the circRNA molecule in a receptor plant to obtain the transgenic plants with higher disease resistance than the receptor plant.

Specifically, the CsaV3_4G030800, a source gene of circRNA319, can be transiently silenced in cucumber by using Virus-induced gene silencing (VIGS) technology. In the examples of the present invention, it is obtained by co-transfecting the recipient plant with a recombinant microorganism containing pTRV1 and a recombinant microorganism containing pTRV2: circRNA319CsAV3_4G030800 vector;

in the method for breeding a transgenic plant having reduced resistance or a transgenic plant having enhanced disease resistance, the nucleic acid molecule for expressing a circRNA molecule, the gene derived from the circRNA, the expression cassette or the recombinant vector is introduced into the recipient plant by using the recombinant microorganism.

In an embodiment of the present invention, the recombinant microorganism may be yeast, bacteria, algae, or fungi. The bacteria may be agrobacterium; the agrobacterium may specifically be EHA105 agrobacterium.

In a specific embodiment of the present invention, in the method for breeding a transgenic plant with reduced resistance, the recombinant microorganism is EHA105 agrobacterium containing the recombinant vector pCAMBIA1304-circRNA 319.

In the method for breeding transgenic plants with enhanced disease resistance, the recombinant microorganisms are GV3101 Agrobacterium containing pTRV1 and GV3101 Agrobacterium containing vector pTRV2: circRNA319CsAV3_4G 030800.

In the above method, the transgenic plant exhibits a lower disease resistance than the recipient plant exhibited in all or part of the following A1) -A3):

A1) the accumulation amount of the CGMMV RNA in the transgenic plant is higher than that of the receptor plant;

A2) the accumulation amount of the CGMMV coat protein in the transgenic plant is higher than that in the receptor plant;

A3) the transgenic plant leaves have more chlorosis and yellowness spots than the recipient plant.

In the above method, the transgenic plant exhibits a disease resistance higher than that of the recipient plant in all or a part of A4) -A5) as follows:

A4) the accumulated amount of CGMMV RNA in the transgenic plant is lower than that in the receptor plant;

A5) the transgenic plant leaves have fewer chlorosis and yellowing spots than the recipient plant leaves.

In embodiments of the invention, the transgenic plant cell line does not include propagation material of the plant.

In the embodiment of the invention, the regulation of plant disease resistance is the reduction of plant disease resistance, and is embodied in all or part of the following B1) -B3):

B1) when the expression level of circRNA319 in the plant protoplast is increased, the accumulation amount of CGMMV RNA in the plant is increased;

B2) when the expression level of circRNA319 in the plant protoplast is increased, the accumulation amount of CGMMV coat protein in the plant is increased;

B3) when the expression level of circRNA319 in the plant is increased, the number of chloroses and yellowing spots on the leaves of the plant is increased.

In another embodiment of the present invention, the modulating plant disease resistance is improving plant disease resistance, and is embodied in all or part of B4) -B5) as follows:

B4) when the expression level of the source gene CsaV3_4G030800 of the circRNA319 in cucumber seedlings is reduced, the accumulation level of CGMMV RNA in the plants is reduced;

B5) when the expression level of the source gene CsaV3_4G030800 of circRNA319 in the plant is reduced, the chlorosis and yellowing spots on the leaves of the plant are reduced.

In the above method, the plant is a dicotyledonous plant; the dicotyledonous plant can be cucumber; the cucumber can be specifically a Xintai Mici cucumber.

In the above method, the transgenic plant is understood to include not only the first generation transgenic plant obtained by transforming the target plant with the gene, but also the progeny thereof. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include protoplasts, seeds, whole plants, and cells.

The invention adopts bioinformatics prediction, molecular cloning technology, agrobacterium-mediated transformation, Virus-induced gene silencing technology (VIGS), real-time fluorescence quantitative PCR, Western blot and other biological means, takes cucumbers over-expressing circRNA319 or silencing circRNA319 source gene CsAV3_4G030800 as research objects, and cucumbers transferred into empty vectors pCAMBIA1304 or pTRV1+ pTRV2 as contrast, firstly over-expressing circRNA319 or silencing RNA319 source gene CsAV3_4G030800, observes the green and yellow spots on leaves after diseases occur by measuring the Virus RNA accumulation amount and the coat protein accumulation amount after CGMMV inoculation, and researches the influence of the circRNA319 on the damage degree of the infected plants from the aspect of molecular biology. Compared with the control group plants, the disease resistance of the transgenic plants over-expressing the circRNA319 is lower than that of the control group plants, the disease resistance of the transgenic plants silencing the circRNA319 source gene CsAV3_4G030800 is higher than that of the control group plants, the circRNA319 is RNA related to the plant disease resistance, and the circRNA319 source gene CsAV3_4G030800 is DNA related to the plant disease resistance and can be used for regulating and controlling the disease resistance of the target plants.

Drawings

Fig. 1 is a quantitative analysis of circRNA319 in cucumber protoplasts overexpressing circRNA 319.

Fig. 2 is an analysis of CGMMV RNA accumulation in cucumber protoplasts overexpressing circRNA 319.

Fig. 3 is an analysis of CGMMV Coat Protein (CP) accumulation in cucumber protoplasts overexpressing circRNA 319.

FIG. 4 is a quantitative analysis of CsaV3_4G030800 in Cucumis sativus in which the circRNA319 derived gene CsaV3_4G030800 is silenced.

FIG. 5 is an analysis of CGMMV RNA accumulation in cucumber silencing CsaV3_4G030800, a circRNA319 derived gene.

EV in FIGS. 1-3 represents an Empty vector (Empty vector).

OE in FIGS. 1-3 represents overexpression (Over expression).

TRV:00 in FIGS. 4-5 represents a blank control group (cucumber seedlings were infiltrated with a mixture of pTRV1+ pTRV2 in a ratio of 1: 1).

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Agrobacterium tumefaciens EHA105 in the examples described below was purchased from Shanghai Diego Biotechnology, Inc.

Agrobacterium-competent cells GV3101 in the examples described below were purchased from Shanghai-Weidi Biotech Ltd.

The inbred line "Xintai Mici" of cucumber in the following examples was purchased from Xintai Mici cucumber stock farm, Xintai Mici, Shandong province.

The overexpression vector pCAMBIA1304 in the following examples was purchased from Hunan Fenghui Biotech Co., Ltd.

The vectors pTRV1 and pTRV2 in the following examples were purchased from Hunan Fenghui Biotech Co., Ltd.

The sequence of the circRNA319 in the invention is an RNA molecule shown in SEQ ID No.1 in a sequence table.

The sequence of the circRNA319 origin gene CsaV3_4G030800 in the invention is a DNA molecule shown as SEQ ID No.2 in the sequence table.

The circRNA319 coding gene sequence in the invention is a DNA molecule shown as SEQ ID No.3 in a sequence table.

The nucleic acid sequence used for constructing the vector for over-expressing the circRNA319 is a DNA molecule shown as SEQ ID No.4 in a sequence table. The sequence is specifically a sequence obtained by adding 200bp flanking introns on the upstream and downstream of the sequence shown in SEQ ID No. 3.

The nucleic acid sequence of the circRNA319 origin gene CsAV3_4G030800 used for silencing is a DNA molecule shown as SEQ ID No.5 in a sequence table. The sequence is specifically the reverse complement of CsaV3_4G030800 from position 15016 to position 15315.

The invention takes the cucumber of the circRNA319 or the source gene CsAV3_4G030800 thereof as a research object, takes the wild type Xintai Mici cucumber as a contrast, researches the influence of the circRNA319 and the source gene CsAV3_4G030800 thereof on the damage degree of the infected plant from the perspective of molecular biology by detecting the accumulation amount of the virus RNA and the content of virus protein in the receptor plant challenging the cucumber green mottle mosaic virus, and proves that the circRNA319 and the source gene CsAV3_4G030800 thereof regulate and control the plant disease resistance pathway. The invention has great significance for revealing the disease resistance function of the circRNA319 and the source gene CsAV3_4G030800 and the cultivation of disease-resistant cucumber varieties, and is beneficial to enriching vegetable breeding resources.

Example 1 application of circRNA319 in regulation and control of cucumber disease resistance

Construction and identification of cucumber overexpressing circRNA319

An overexpression vector pCAMBIA1304-circRNA319 is constructed by adopting the Gateway technology, genetic transformation of cucumber is carried out by adopting an agrobacterium tumefaciens mediated protoplast method, and the cucumber with the circRNA319 is obtained by quantitative PCR and Western blot detection. The method comprises the following specific steps:

1. construction of cucumber overexpressing circRNA319

(1) Construction of overexpression vectors

The length of the artificially synthesized gene fragment for expressing the circRNA319 is 858bp (the DNA fragment shown in SEQ ID No. 4), and the gene fragment is formed by adding an upstream 200bp flanking intron sequence to the 5 'end of the DNA coding sequence (SEQ ID No.3) of the circRNA319 and adding a downstream 200bp flanking intron sequence to the 3' end of the DNA coding sequence.

A DNA fragment (DNA fragment shown in SEQ ID No. 4) of 858bp size containing a sequence for expressing circRNA319 was constructed into an entry vector pENTR (purchased from Invitrogen) by the Gateway technique, followed by use of Gateway LR clone ^TM II enzyme Mix (from Invitrogen) DNA fragments of 858bp size were integrated by LR reaction by homologous recombination into the overexpression vector pCAMBIA1304, yielding the overexpression vector pCAMBIA1304-circRNA 319.

(2) Construction of recombinant bacterium

And (2) introducing the overexpression vector pCAMBIA1304-circRNA319 constructed in the step (1) into the Agrobacterium tumefaciens EHA105 to obtain a recombinant strain EHA105/pCAMBIA1304-circRNA319 containing the overexpression vector pCAMBIA1304-circRNA 319.

(3) Obtaining of cucumber overexpressing circRNA319

Cucumber protoplasts were prepared according to established methods and incubated with plasmid DNA containing the overexpression vector pCAMBIA1304-circRNA319, respectively (protoplast PEG-mediated genetic transformation), specifically as follows:

accelerating germination of cucumber seeds: selecting a proper amount of Xintai honey thorn cucumber seeds, sterilizing for 20s by using 75% ethanol, removing the ethanol, washing for 4-5 times by using sterilized water, removing residual ethanol, pouring out the sterilized water after washing, adding 2% -3% sodium hypochlorite to sterilize the cucumber seeds, putting the cucumber seeds into a shaking table at 150rpm for 6min to sterilize, removing the sodium hypochlorite, washing for 4-5 times by using the sterilized water, removing the residual sodium hypochlorite, pouring out the sterilized water after washing, putting the sterilized seeds on a moist sterile filter paper sheet, and accelerating germination for 24h under dark conditions.

Secondly, carrying out sub-detoxification treatment on cucumber seeds: cucumber Green Mottle Mosaic Virus (CGMMV) infectious clone is used as a poison source, infiltration liquid is used for resuscitation and heavy suspension, and the seed for germination acceleration is detoxified by a negative pressure method. Sowing seeds with poison in a plastic flowerpot, culturing in a plant growth incubator in a laboratory, controlling the temperature at 25 ℃, the photoperiod at 16h/8h day/night and the humidity at 40-60%, and watering as required during the growth of plants.

Material selection and enzymolysis: taking out flat and healthy cucumber cotyledons with the growth cycle of 7-12 days. Cutting cucumber cotyledon into 0.5-1.0mm strips with sharp surgical blade, placing in prepared cellulose enzymolysis solution (20mL), cutting about 40 pieces of cucumber cotyledon per sample, and performing enzymolysis for 4-5h on a shaker at 40 rpm.

TABLE 1 preparation of cellulase hydrolysate

Obtaining protoplasts: after the enzymolysis is finished, adding the equal volume of W5 solution pre-cooled in advance into the enzymolysis liquid for enzymolysis of the cucumber cotyledon, mixing uniformly to stop the reaction, and filtering the enzymolysis product by using a nylon membrane pre-wetted by W5. Centrifuging for 2min at 4 ℃ for 200g, discarding the supernatant, adding 10mL of W5 solution for resuspension (precooling), centrifuging for 2min at 4 ℃ for 200g, discarding the supernatant, repeatedly retaining a little supernatant for resuspension, placing on ice, and standing for 30 min.

TABLE 2 preparation of W5 solution

Converting:

a. according to the experimental requirements, the protoplast after ice bath in a 50mL round-bottom centrifuge tube is subpackaged into 2mL centrifuge tubes, 150g is centrifuged for 2min, the supernatant is discarded, and an appropriate amount of MMG solution is used for resuspending the protoplast to make the concentration of the protoplast be about 2 multiplied by 10 per milliliter ⁶ And (4) respectively.

TABLE 3 preparation of MMG solution

b. Add 20. mu.g of plasmid containing the overexpression vector pCAMBIA1304-circRNA319 at a concentration of 1. mu.g/. mu.L to a new 2mL centrifuge tube and add 100. mu.L of protoplasts (ca. 2X 10) ⁵ One) gently mixed.

c. Adding 120 μ L of 20% PEG 4000 solution, gently mixing until no layering occurs, placing horizontally, and inducing the mixture to transform for about 15 min.

d. To the induction sample was added 600. mu.L of W5 solution at room temperature and gently mixed to terminate the conversion reaction. Centrifuge at 150g for 2min at 25 ℃ and discard the supernatant. Adding 500 mu L of WI solution to suspend the cucumber protoplast again, culturing at room temperature in the dark for about 24h, and collecting the transformed cucumber protoplast.

TABLE 4 preparation of WI solution

Secondly, disease resistance analysis of cucumber overexpressing circRNA319

And detecting the expression level of circRNA319 and the accumulation amount of CGMMV RNA in the transformed cucumber protoplast by adopting a qRT-PCR method, and detecting the accumulation amount of CGMMV CP in the cucumber protoplast by adopting Western blot.

qRT-PCR detection is carried out by respectively adopting specific primers Divergent primers of circRNA319 and specific primers of CGMMV, and adopting

Method for preparing circRNA3And calculating the relative expression quantity of the 19 and CGMMV coat protein genes, and then analyzing the expression condition. The forward primer sequence of circRNA319 is 5'-CCACTGTTGCACACTCAGGA-3', and the downstream primer sequence is 5'-CTGAAGGGTCGGGTACATCG-3'; the upstream primer sequence of the reference gene EF-1a is 5'-ACTGGTGGTTTTGAGGCTGGT-3', and the downstream primer sequence is 5'-CTTGGAGTATTTGGGTGTGGT-3'; the upstream primer sequence of the internal reference gene Ubiquitin is 5'-CTAATGGGGAGTGGGGAAGTA-3', and the downstream primer sequence is 5'-GTCTGGATGGACAATGTTGAT-3'; the qPCR primer sequence of the CGMMV coat protein gene is upstream 5'-ACAGCCGCTAGGGCTGAGATA-3' and downstream 5'-CCAATGAGCAAACCGTTCGAT-3'.

The results show that: in cucumber overexpressing circRNA319 (OE-circRNA319), the expression level of circRNA319 increased 2.7-fold (fig. 1), the accumulation of CGMMV RNA increased 7.5-fold (fig. 2), and the accumulation of CGMMV CP increased 1.5-fold (fig. 3) compared to the empty vector control (EV). The chlorosis, yellowing spots on cucumber leaves overexpressing circRNA319 were more than the empty vector control.

In conclusion, compared with the control group plants, the disease resistance of the transgenic plants over-expressing the circRNA319 is lower than that of the control group plants, which indicates that the circRNA319 is RNA related to the plant disease resistance and can be used for regulating and controlling the disease resistance of the target plants.

Example 2 application of circRNA319 derived gene CsaV3_4G030800 in cucumber disease resistance regulation

First, obtaining cucumber with silent circRNA319 origin gene CsAV3_4G030800

1. Construction of silencing vector pTRV2 circRNA319CsAV3_4G030800 and transformation of Agrobacterium

Artificially synthesizing a target fragment (SEQ ID No.5) of a source gene CsaV3_4G030800 of the circRNA 319; cloning the above-mentioned target fragment into pTRV2 vector (available from Takara Biotech Co., Ltd.) using Infusion HD Cloning Kit (available from Takara Co., Ltd.) to obtain pTRV2: circRNA319CsAV3_4G030800 vector, transforming pTRV2: circRNA319CsAV3_4G030800 vector into E.coli competent cell Stellar (available from Beijing Quanjin Biotechnology Co., Ltd.) using 2.5. mu.L of In-Fusion reaction solution; plasmid DNAs of pTRV1 (purchased from Nanfeng Hui biological technology Co., Ltd.) and pTRV2: circRNA319CsAV3_4G030800 identified as positive by sequencing analysis are respectively transferred into Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), single colonies are selected for colony PCR verification, and plasmid DNAs are extracted for sequencing.

2. Obtaining of cucumber silencing CircRNA 319-derived Gene CsAV3_4G030800

The CsaV3_4G030800, a source gene of circRNA319, was transiently silenced in Cucumis sativus using Virus-mediated gene silencing (VIGS) technology. The method comprises the following specific steps:

(1) the seeds of the cucumber with Xintai Mici are sown in a plastic flowerpot after accelerating germination and are placed in a plant growth incubator for growth.

(2) When the first true leaf growing point of cucumber seedling is exposed (about 5-7d), lightly making a tiny wound by using a blade under dark condition, soaking cotton by using the agrobacterium containing pTRV1 and the agrobacterium containing pTRV2: circRNA319CsAV3_4G030800 vector (mixed according to the proportion of 1: 1) revived by using an infiltration solution, and placing the cotton at the tiny wound; a blank control was prepared by treating the pTRV1+ pTRV2 mixed bacterial suspension (mixed at a ratio of 1: 1); a silencing indication control group was prepared by treating Agrobacterium (mixed at a ratio of 1: 1) transformed with pTRV1 and pTRV2: PDS, in which pTRV2: PDS (PDS, Phytoene desaturase, accession number ABE99707) was used to insert a fragment of PDS between CP and Rz of pTRV2 vector, replacing the original MCS, and pTRV2: PDS was obtained. Wetting the cotton ball with corresponding bacterial liquid again every 2h, repeating for 3 times, removing the cotton ball with bacterial liquid after the wetting is finished, placing the cucumber seedling in a plant growth incubator, growing under the conditions of 16h light and 8h dark, and watering according to needs during the growth period.

Disease resistance analysis of cucumber silent on circRNA319 origin gene CsaV3_4G030800

The cucumber seedlings grow for about 10 days after being treated, and CGMMV is inoculated by friction when the first true leaves are unfolded. And (3) sampling the 2 nd and 3 rd leaves of the cucumber plant after the cucumber plant grows for 15-20 days, extracting total RNA, and respectively detecting the expression level of the circRNA319 derived gene CsaV3_4G030800 and the accumulation condition of the CGMMV virus RNA by adopting a real-time fluorescent quantitative PCR method.

Respectively adopting specific primers of a source gene CsaV3_4G030800 of circRNA319 and CGMMV to carry out qRT-PCR detection, and adopting

The method calculates the relative expression of the source gene CsaV3_4G030800 of the circRNA319 and the CGMMV coat protein gene, and then analyzes the expression condition. qPCR primer sequence for CsaV3 — 4G030800, a gene derived from circRNA 319: an upstream primer TGCAACAGTGGAGACGACAA and a downstream primer GTCCCTTCCGAAGCCATGAA.

The results show that: in cucumbers (TRV 2: circRNA319-CsaV3_4G030800 in the figure) transfected with agrobacterium containing pTRV1 and agrobacterium containing pTRV2: circRNA319CsaV3_4G030800, which silences circRNA 319-derived gene CsaV3_4G030800, the expression level of CsaV3_4G030800 is reduced to 0.12 (relative to the relative expression level of the wild type, fig. 4) and the accumulation amount of CGMMV RNA is reduced to 0.04 (relative to the relative expression level of the wild type, fig. 5) relative to the control (TRV: 00 in the figure) of the transempty vector (pTRV1+ pTRV 2). The chlorosis and yellows spots on cucumber leaves of the cucumber leaf silencing the circRNA319 derived gene CsaV3_4G030800 are less than those of the empty vector control.

In conclusion, compared with the control group plants, the disease resistance of the transgenic plants for silencing the circRNA319 origin gene CsaV3_4G030800 is higher than that of the control group plants, and the circRNA319 origin gene CsaV3_4G030800 is DNA related to plant disease resistance and can be used for regulating and controlling the disease resistance of target plants.

<110> university of agriculture in China

<120> circRNA related to plant disease resistance, source gene and application thereof

<130>WHOI220033

<160> 5

<170> Patent-In 3.5

<210> 1

<211> 458

<212> RNA

<213> cucumber (Cucumis sativus L.)

<400> 1

uucaaaggau auucucaugc guguaguggc acauaaccuu ucuccugagu ugacucuggu 60

ggaaaaggua augaccccaa auccugagug ugcaacagug gagacgacaa uccuugaugc 120

auugcacaua augcacgaug ggaaguucuu gcaucuuccg guuuuagauc gugagggauu 180

gguuguugcu uguguagaug uucuacagau cacacacgcu gcaaucucca ugguugagag 240

ugguucgagu ucuguuaaug auguggcaag cacaaugaug caaaaguuuu gggauucagc 300

ccuugcuuua gaaccaccug augauauuga uacucauagu gaaaugucug cauucauggc 360

uucggaaggg acucuaaauu auccaucucu aggucuugga aacucauuug cuuuuaaauu 420

ugaggaucug aagggucggg uacaucgcgu aaauugug 458

<210> 2

<211> 1620

<212> DNA

<213> cucumber (Cucumis sativus L.)

<400> 2

atgactactc aactcgctcc tcctcggagg agctctctcg ctcagaaacg cacctcttcc 60

acatcttcca ggaagtcggt gtccggcgat aatggcatct ctagtaatgg caatgttccc 120

aaaccgggtt ctcctactca gctgccatct gctgctgttg gggaaaggac ggtgaagaaa 180

ctgaggttgt cgaaggcgct tacgattcct gaaggcacta cggtttctga agcgtgtaga 240

aggatggctg ctcgtcgtgt tgatgctgta ctattaacgg atgcgaatgc tttactttcg 300

ggtattctca ccgacaagga cgtcgctacc agggttatag cagaggggct gaggccagag 360

cagaccgttg tatccaaaat tatgacacgg aatcccattt ttgttacttc ggattcactt 420

gctatggaag cccttcagaa aatggttcag ggaaaattta ggcatcttcc agttgttgaa 480

aatggcgaag ttattgcttt gttggatatt acaaagtgcc tctatgatgc catatcgaga 540

atggagaagg ccgcagaaca gggtagtgcc attgctgctg ctgttgaagg agtggaacgc 600

cagtggggaa gtgacttttc tgctccgtat gcttttatag agacgttgag ggagcggatg 660

tttaaacctt ccttatcaac catcctttct gaaaatacaa aagctgcaat tgtctcggca 720

tcagatccta tatatgttgc tgccaaaaaa atgcgggagt tacgagttaa ttcagttgtt 780

atcacaatgg gaaccaagat tcaggggatc ctcacttcaa aggatattct catgcgtgta 840

gtggcacata acctttctcc tgagttgact ctggtggaaa aggtaatgac cccaaatcct 900

gagtgtgcaa cagtggagac gacaatcctt gatgcattgc acataatgca cgatgggaag 960

ttcttgcatc ttccggtttt agatcgtgag ggattggttg ttgcttgtgt agatgttcta 1020

cagatcacac acgctgcaat ctccatggtt gagagtggtt cgagttctgt taatgatgtg 1080

gcaagcacaa tgatgcaaaa gttttgggat tcagcccttg ctttagaacc acctgatgat 1140

attgatactc atagtgaaat gtctgcattc atggcttcgg aagggactct aaattatcca 1200

tctctaggtc ttggaaactc atttgctttt aaatttgagg atctgaaggg tcgggtacat 1260

cgcgtaaatt gtggcactga gaccttggat gagttggtat ctgttgtgat gcaaaggatt 1320

ggtgctactg atagtgctaa tcggcctctg cttttgtatg aagacgatga aggggataaa 1380

gtagttcttg ctactgatgg tgatctctct ggtgctgtaa accatgccag gtccatagga 1440

ctaaaggttt taagattgca tttggatttt cccgaatcaa tccagcaaac agaagctcaa 1500

aatgatgcaa tgttagacca gaagcgtgga tcgttgcatt tgtattctgg tgcatttgct 1560

gctgccattg ctctaacaag cattggtgta ttgttttatt tgaagcgttc taaggtgtaa 1620

<210> 3

<211> 458

<212> DNA

<213> cucumber (Cucumis sativus L.)

<400> 3

ttcaaaggatattctcatgcgtgtagtggcacataacctttctcctgagttgactctggtggaaaaggtaatgaccccaaatcctgagtgtgcaacagtggagacgacaatccttgatgcattgcacataatgcacgatgggaagttcttgcatcttccggttttagatcgtgagggattggttgttgcttgtgtagatgttctacagatcacacacgctgcaatctccatggttgagagtggttcgagttctgttaatgatgtggcaagcacaatgatgcaaaagttttgggattcagcccttgctttagaaccacctgatgatattgatactcatagtgaaatgtctgcattcatggcttcggaagggactctaaattatccatctctaggtcttggaaactcatttgcttttaaatttgaggatctgaagggtcgggtacatcgcgtaaattgtg

<210> 4

<211> 858

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acagtatttg tgttggttgt ttagttcttg atctaatgtg catgttggtc cagagctttc 60

ccatttgtgt taatccaaca tgattcagaa ggttttttat tattaatatt attttttaaa 120

ctcctgtata tttatttact ttgtttgtta tgttactgtg gtttacttat gttatggctg 180

tttctgaaaa tgtactacag ttcaaaggat attctcatgc gtgtagtggc acataacctt 240

tctcctgagt tgactctggt ggaaaaggta atgaccccaa atcctgagtg tgcaacagtg 300

gagacgacaa tccttgatgc attgcacata atgcacgatg ggaagttctt gcatcttccg 360

gttttagatc gtgagggatt ggttgttgct tgtgtagatg ttctacagat cacacacgct 420

gcaatctcca tggttgagag tggttcgagt tctgttaatg atgtggcaag cacaatgatg 480

caaaagtttt gggattcagc ccttgcttta gaaccacctg atgatattga tactcatagt 540

gaaatgtctg cattcatggc ttcggaaggg actctaaatt atccatctct aggtcttgga 600

aactcatttg cttttaaatt tgaggatctg aagggtcggg tacatcgcgt aaattgtggt 660

gagtgttgat ggttttctag agctatgatt ttgaagaact tttatgtgta tgaatatatg 720

tgtgtgtgat ttattattaa caagatgtaa accaagtgtg gtggtggttg taggcgtttt 780

ctctaggaaa ctatttcatt aagaaagtga gatatacaaa gtcgggaagc cccgagtcta 840

aactagtcta aacttctg 858

<210> 5

<211> 300

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tggtgttgca accttttccc aattatatat ctcagtttct ttgagaattt gggcattgca 60

atgtatcccg ctgccaaaat ttgcgagcat gcattttctt tttcaataat tctgtcgttt 120

gactttacac cttagaacgc ttcaaataaa acaatacacc aatgcttgtt agagcaatgg 180

cagcagcaaa tgcaccagaa tacaaatgca acgatccacg cttctggtct aacattgcat 240

cattttgagc ttctgtttgc tggattgatt cgggaaaatc caaatgcaat cttaaaacct 300

Claims

1. A circRNA molecule is characterized in that the nucleotide sequence of the circRNA molecule is SEQ ID No.1 in a sequence table.

2. Nucleic acid molecule encoding the circRNA molecule of claim 1, preferably the sequence of the encoding gene is SEQ ID No.3 of the sequence list or SEQ ID No.4 of the sequence list.

3. A source gene of a circRNA molecule is characterized in that the nucleotide sequence of the source gene of the circRNA is SEQ ID No.2 in a sequence table.

4. An expression cassette comprising a nucleic acid molecule encoding the circRNA molecule of claim 1, or the source gene of claim 3, or a nucleic acid molecule that inhibits expression of the circRNA molecule of claim 1 or the source gene of claim 2.

5. A recombinant vector comprising a nucleic acid molecule encoding the circRNA molecule of claim 1, or the source gene of claim 3, or a nucleic acid molecule inhibiting the expression of the circRNA molecule of claim 1 or the source gene of claim 2, or an expression cassette of claim 3.

6. A recombinant microorganism comprising a nucleic acid molecule encoding the circRNA molecule of claim 1, or the source gene of claim 3, or a nucleic acid molecule inhibiting the expression of the circRNA molecule of claim 1 or the source gene of claim 2, or the expression cassette of claim 3, or the recombinant vector of claim 4.

7. A transgenic plant cell line comprising a nucleic acid molecule encoding the circRNA molecule of claim 1, or the source gene of claim 3, or a nucleic acid molecule inhibiting the expression of the circRNA molecule of claim 1 or the source gene of claim 2, or the expression cassette of claim 3, or the recombinant vector of claim 4, or the recombinant microorganism of claim 6.

8. Use of the circRNA molecule of claim 1, or a nucleic acid molecule encoding the circRNA molecule of claim 1, or the gene of origin of claim 3, or the expression cassette of claim 4, or the recombinant vector of claim 5, or the recombinant microorganism of claim 6, or the transgenic plant cell line of claim 7 for modulating disease resistance in a plant.

9. A method for breeding a transgenic plant with reduced resistance, comprising introducing into a recipient plant the circRNA molecule of claim 1, or a nucleic acid molecule encoding the circRNA molecule of claim 1, an expression cassette comprising a nucleic acid molecule encoding the circRNA molecule of claim 1, or a recombinant vector comprising a nucleic acid molecule encoding the circRNA of claim 1, or a recombinant microorganism comprising a nucleic acid molecule encoding the circRNA of claim 1, to obtain a transgenic plant with lower disease resistance than the recipient plant;

preferably, the plant is a dicot.

10. A method for breeding a transgenic plant with enhanced disease resistance, characterized in that a transgenic plant with higher disease resistance than a recipient plant is obtained by silencing the source gene of the circRNA of claim 2 in the recipient plant;

preferably, the plant is a dicot.