CN113862270B

CN113862270B - dsRNA of prawn METTL3 gene and application thereof

Info

Publication number: CN113862270B
Application number: CN202111246186.5A
Authority: CN
Inventors: 王伟; 雷易果
Original assignee: Guangdong Ocean University
Current assignee: Guangdong Ocean University
Priority date: 2021-10-26
Filing date: 2021-10-26
Publication date: 2023-08-29
Anticipated expiration: 2041-10-26
Also published as: CN113862270A

Abstract

The invention belongs to the technical field of biology, and discloses a dsRNA of a prawn METTL3 gene and application thereof. The invention discloses an application of methyltransferase protein 3 in regulating and controlling molting of prawns for the first time, and an application of methyltransferase protein 3 inhibitor in promoting the molting of prawns; the double-stranded RNA consists of a nucleotide sequence shown in SEQ ID No.5 and a nucleotide sequence shown in a reverse complementary sequence thereof, and the double-stranded RNA is injected into a prawn body, so that the ecdysis rate of the prawn can be remarkably improved, and the ecdysis process can be accelerated.

Description

dsRNA of prawn METTL3 gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a dsRNA of a prawn METTL3 gene and application thereof.

Background

The crustacean including the prawn undergoes a plurality of molting processes in the whole life cycle, and the normal growth, development and reproduction of the prawn take the smooth completion of the molting process as preconditions, and the molecular regulation and control mechanism related to the molting is a focus problem at home and abroad. According to different growth and development stages, the molting behavior of prawns is mainly divided into three types: developmental metamorphosis molting occurring at larval to larval shrimp stage; the molting of the larvae in the stage from shrimp formation to shrimp formation; and reproductive molting that occurs in female individuals prior to mating. Regardless of the ecdysis process, a series of complex physiological changes can occur in the prawn body, and the dynamic regulation and control of a plurality of gene channels are involved, and are closely related to a plurality of biological processes, including cell differentiation, apoptosis, ecdysone signal transduction and the like. Litopenaeus vannamei (academic name Litopenaeus vannamei) is also known as white-leg shrimp and white-leg shrimp, belongs to Arthropoda, crustacean, octopus, prawn, and is a warm water crustacean and one of the most important aquaculture shrimps worldwide.

Studies have shown that there are hundreds of chemical modifications in messenger RNAs (mrnas) in organisms, with N6-adenine (m 6A) methylation modification being one of the most common post-transcriptional chemical modifications of mrnas in eukaryotes. In the middle of the 20 th century, m6A methylation of RNA was first observed, referring to methylation of adenine nucleotides at the N-6 position. Proteins involved in regulating m6A methylation in animals and plants are largely divided into three major classes: m6A methyltransferase, m6A demethylase and m6A binding protein function as methylation modification, demethylation and methylation site recognition, respectively. Methyltransferase protein 3 (METTL 3) is the most central component of the RNA methyltransferase complex and comprises an S-adenosylmethionine (SAM) binding region which recognizes the m6A modification site in RNA and transfers the methyl group of the SAM binding region to the site, thereby effecting methyl group transfer. Recent studies on the METTL3 gene have found that METTL3 plays an important role in the growth and development of animals. In plant, yeast and mammalian cells, gene silencing of METTL3 results in complete or near complete deletion of m6A in mRNA. In mice (Mus musculus), the deletion of the METTL3 gene deprives embryonic stem cells of differentiation and the embryo dies during early development. After deletion of the METTL3 gene, drosophila (Drosophila melanogaster) had been impaired by both neurodevelopmental disorders, flying ability and sexual differentiation. The related research on RNA methylation of the prawns is less, and the sequence and the expression characteristics of the prawn m6A methyltransferase METTL3 gene are not reported.

Disclosure of Invention

The object of the first aspect of the invention is to provide the use of methyltransferase protein 3 (METTL 3) for modulating molting of prawns.

It is an object of the second aspect of the present invention to provide the use of a methyltransferase protein 3 (METTL 3) inhibitor.

The object of the third aspect of the present invention is to provide a dsRNA.

The object of the fourth aspect of the invention is to provide a nucleic acid molecule encoding the dsRNA of the third aspect of the invention.

The object of the fifth aspect of the invention is to provide an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule of the fourth aspect of the invention.

The object of the sixth aspect of the present invention is to provide the use of the dsRNA of the third aspect of the present invention, the nucleic acid molecule of the fourth aspect of the present invention, the expression cassette, the vector or the transgenic cell line of the fifth aspect of the present invention.

A seventh aspect of the invention is directed to a product.

The eighth aspect of the invention aims at providing a method for promoting molting of prawns.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the invention, there is provided the use of methyltransferase protein 3 (METTL 3) for modulating molting of prawns.

Preferably, the methyltransferase protein 3 comprises a methyltransferase protein 3 protein and a methyltransferase protein 3 gene.

Preferably, the amino acid sequence of the methyltransferase protein 3 is shown in SEQ ID No. 1.

Preferably, the cDNA sequence of the methyltransferase protein 3 gene is shown in SEQ ID No. 2.

Preferably, the prawn is Litopenaeus vannamei.

In a second aspect of the invention, there is provided the use of a methyltransferase protein 3 (METTL 3) inhibitor in any one of (1) to (2);

(1) Promoting the molting of prawns;

(2) And preparing a product for promoting the molting of the prawns.

Preferably, the methyltransferase protein 3 inhibitor is a substance that inhibits methyltransferase protein 3 activity, or a substance that degrades methyltransferase protein 3, or a substance that reduces methyltransferase protein 3 expression levels.

Preferably, the agent that reduces the expression level of methyltransferase protein 3 is siRNA, dsRNA, miRNA, a ribozyme or a shRNA that targets methyltransferase protein 3.

Preferably, the methyltransferase protein 3 inhibitor is a methyltransferase protein 3 targeting dsRNA, and the methyltransferase protein 3 targeting dsRNA is a double-stranded RNA consisting of a nucleotide sequence shown in SEQ id No.5 and a nucleotide sequence shown in the reverse complement thereof.

Preferably, the cDNA sequence of the gene of the methyltransferase protein 3 is shown in SEQ ID No. 2.

Preferably, the prawn is Litopenaeus vannamei.

In a third aspect of the present invention, there is provided a dsRNA which is a double stranded RNA consisting of a nucleotide sequence shown as SEQ id No.5 and a nucleotide sequence shown as its reverse complement.

In a fourth aspect of the invention there is provided a nucleic acid molecule encoding the dsRNA of the third aspect of the invention.

In a fifth aspect of the invention there is provided an expression cassette, vector or transgenic cell line comprising a nucleic acid molecule of the fourth aspect of the invention.

Preferably, the transgenic cell line does not comprise propagation material.

In a sixth aspect of the invention there is provided the use of the dsRNA of the third aspect of the invention, the nucleic acid molecule of the fourth aspect of the invention, the expression cassette, vector or transgenic cell line of the fifth aspect of the invention.

(1) The use of any one of (3) in any one of (4) to (7);

(1) The dsRNA of the third aspect of the invention;

(2) The nucleic acid molecule of the fourth aspect of the invention;

(3) The expression cassette, vector or transgenic cell line of the fifth aspect of the invention;

(4) Promoting the molting of prawns;

(5) Preparing a product for promoting molting of prawns;

(6) Inhibiting methyltransferase protein 3 expression;

(7) A product is prepared that inhibits the expression of methyltransferase protein 3.

Preferably, the prawn is Litopenaeus vannamei.

In a seventh aspect of the invention, there is provided a product comprising: at least one of (1) to (3);

(1) The dsRNA of the third aspect of the invention;

(2) The nucleic acid molecule of the fourth aspect of the invention;

(3) The expression cassette, vector or transgenic cell line of the fifth aspect of the invention.

In an eighth aspect, the invention provides a method for promoting molting of prawns, and the product of the seventh aspect is introduced into prawns.

Preferably, the introduction is by injection.

Preferably, the prawn is Litopenaeus vannamei.

The beneficial effects of the invention are as follows:

the invention discloses an application of methyltransferase protein 3 (METTL 3) in regulating and controlling molting of prawns for the first time and an application of methyltransferase protein 3 (METTL 3) inhibitor in promoting the molting of the prawns.

The invention also provides double-stranded RNA composed of the nucleotide sequence shown in SEQ ID No.5 and the nucleotide sequence shown in the reverse complementary sequence thereof, and the double-stranded RNA is injected into the prawn body, so that the ecdysis rate of the prawn can be remarkably improved, and the ecdysis process can be accelerated.

Drawings

FIG. 1 is a graph showing the results of the expression level of METTL3 in prawns after dsRNA injection.

FIG. 2 is a graph showing the results of the molting rate of prawns after dsRNA injection.

Detailed Description

The present invention will be described in further detail with reference to specific examples.

It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. The materials, reagents and the like used in this example are commercially available ones unless otherwise specified.

EXAMPLE 1 preparation of MetTL3 Gene dsRNA of Litopenaeus vannamei

1. Primer design

According to NCBI website sequence comparison, the amino acid sequence of the obtained litopenaeus vannamei METTL3 gene is shown as SEQ ID No.1, the cDNA sequence is shown as SEQ ID No.2, and Primer design software Primer Premier 6 is used for selecting the protein functional domain to carry out Primer design: forward primer P1:5'GTTGACAGTAGTAGCCGTTGAA 3' (SEQ ID NO. 3), reverse primer P2:5'CATCTGACATGGTGCCGTA 3' (SEQ ID NO. 4).

The METTL3 amino acid sequence is specifically as follows:

MGDETWANIQLVKSKRERFREKFKRRKAERETILNYAGGGGANATSLQLCNIATSSSATSSSSDIDAGKSPIPVGVVPTTSSSQDDPSLECALLECLNEALPPVQAIQLSETLSTKLRRTLPSKAINNLLEKFAYKELISITQGTSEGRTSLTVVAVEHSKVTAVLDAEHREKKVPPTAVAVEDENHSPEKSDDTISEPPTKILREEKETKVDKEKRKDRREDDVMSLLSAQSIRERETKKVGEEIMELLSKPTAKEQSLAQRFRSQGGAKVQEFCPHGTKEECERATKKGGPQCGRLHFRKIIQKHTDESLGDCSFLNTCFHMDTCRYVHYEVDYTGVSGQQQQEQESSMLMTIPRARPEERTILFPPQWIQCDLRFLDMSLLGKFAVIMADPPWDIHMELPYGTMSDDEMRQLNIPMMQEEGLIFLWVTGRAMELGRECLKLWGYERVDEIIWVKTNQLQRIIRTGRTGHWLNHGKEHCLVGMKGNPKVNRGLDGDVIVAEVRATSHKPDEIYGIIERLSPGTRKLELFGRPHNVQPNWVTLGNQLEGVNLLEEDLVKAFKERYPDGICCKQTPQ(SEQ ID No.1)。

the METTL3 gene cDNA sequence is specifically as follows:

ATGGGTGACGAGACCTGGGCGAATATCCAGCTAGTGAAGAGCAAGAGGGAGAGATTCAGGGAGAAGTTCAAAAGGCGAAAAGCAGAGCGAGAGACGATCCTGAACTATGCTGGAGGAGGCGGCGCCAATGCAACCTCACTGCAACTCTGCAATATTGCAACCTCTTCTTCTGCTACGTCTTCTTCCTCGGATATTGACGCGGGCAAGAGTCCTATTCCCGTCGGCGTTGTGCCAACCACAAGCAGTAGCCAAGATGACCCTAGTCTTGAATGTGCCTTGTTAGAGTGTCTGAATGAGGCCTTACCACCAGTTCAGGCGATACAATTGTCAGAAACACTCTCAACTAAACTAAGAAGAACACTGCCTTCAAAAGCAATTAATAACTTGTTGGAGAAATTTGCATATAAAGAACTAATTAGCATTACTCAGGGTACCAGTGAAGGGAGAACTTCGTTGACAGTAGTAGCCGTTGAACACAGCAAAGTAACAGCTGTTTTAGATGCAGAACACCGAGAGAAGAAAGTTCCGCCCACTGCAGTTGCTGTTGAAGATGAAAACCATTCTCCAGAGAAATCTGATGATACTATCTCAGAGCCTCCTACAAAGATTCTTCGTGAAGAGAAGGAGACAAAAGTGGACAAAGAGAAGAGAAAAGACAGGAGAGAAGATGACGTTATGAGTCTGTTGTCAGCGCAGAGCATAAGAGAAAGGGAAACAAAGAAAGTGGGAGAAGAAATCATGGAATTACTCAGTAAACCAACTGCGAAAGAGCAAAGCTTGGCGCAGAGATTCAGGTCTCAGGGAGGTGCAAAGGTCCAGGAATTCTGTCCACATGGCACCAAAGAAGAGTGTGAGAGAGCGACAAAGAAGGGAGGGCCACAGTGTGGACGCCTCCACTTCCGCAAGATCATCCAGAAACACACAGATGAGTCGCTGGGAGACTGCTCCTTCTTGAACACTTGCTTCCATATGGATACTTGCAGATACGTCCACTATGAGGTAGACTATACTGGGGTGTCGGGGCAGCAGCAACAGGAGCAAGAGTCATCCATGTTGATGACTATCCCCCGTGCCCGTCCTGAGGAGCGCACCATCCTTTTCCCCCCACAGTGGATACAGTGCGACCTGCGCTTCCTCGACATGTCCTTGTTAGGCAAATTTGCAGTGATTATGGCTGACCCCCCCTGGGACATCCACATGGAACTTCCATACGGCACCATGTCAGATGATGAGATGCGGCAGCTGAATATCCCCATGATGCAGGAGGAAGGACTCATATTCCTTTGGGTGACTGGCAGAGCCATGGAACTAGGTAGAGAGTGCCTTAAGCTCTGGGGCTATGAACGTGTTGACGAAATCATTTGGGTGAAAACCAATCAGCTTCAGCGCATTATTCGCACAGGCAGAACAGGCCATTGGTTGAATCATGGCAAGGAACATTGTTTGGTGGGAATGAAAGGGAACCCAAAGGTAAATAGAGGCCTAGATGGTGATGTCATTGTAGCTGAGGTCCGCGCCACGAGTCACAAACCAGATGAAATCTATGGCATCATTGAGCGTCTCTCCCCCGGCACGCGCAAGCTGGAACTCTTCGGGCGGCCTCACAATGTGCAGCCAAATTGGGTGACTCTCGGCAACCAGCTGGAAGGTGTAAATCTCCTGGAGGAAGACCTGGTCAAAGCATTTAAAGAGCGATATCCAGATGGTATATGTTGCAAGCAGACGCCCCAGTAG(SEQ ID No.2)。

2. cloning of the Gene of interest and construction of the vector

Extracting total RNA of the Litopenaeus vannamei by using an RNA extraction kit (TransZol Up Plus RNA Kit, purchased from full-scale gold China company) and adopting an experimental method of Trizol extraction; then reverse transcription kit (5×all-In-One RT Master Mix, purchased from Cuben Bio (China)) is used to reverse transcribe the total RNA of Litopenaeus vannamei to synthesize a first cDNA strand; the cDNA strand was used as a template to bind specific primers P1 and P2, and the following system and conditions were used, the reaction system being shown in Table 1, and the reaction conditions being: 95 ℃ for 5min;95 ℃,30s,55 ℃,30s,72 ℃ and 45s, and 32 cycles in total; 72 ℃,10min,4 ℃ and 10min. The product was confirmed by 1.0% agarose gel electrophoresis to determine whether it was the band of interest. If yes, the reaction system is expanded to 100 mu L, and the target fragment is purified and recovered to obtain a PCR purified product. The fragment of interest was then ligated to the pMD-19T vector (see pMD-19T cloning Kit instructions for procedures) under the reaction conditions of 16℃for 4h as shown in Table 2.

TABLE 1PCR amplification System

Composition of the components	Volume of
		2×Taq PCR Mix	10μL
cDNA(1135μg/mL)	1μL
		Primer P1 (10 mM)	1μL
Primer P2 (10 mM)	1μL
		dd H ₂ 0	7μL

TABLE 2 ligation reaction System

Composition of the components	Volume of
		PCR purification product (223 μg/mL)	3μL
Solution I	3.5μL
		M5 HiPer Ptopo-TA Vector	1μL
pMD-19T Vector	0.5μL

3. Transformation of recombinant vectors

And (3) adding the connection product of the step (2) into DH5 alpha competent cells to convert the recombinant vector, adding liquid LB culture solution, and shaking at 37 ℃ and 200rpm for 2 hours. After shaking, the bacterial solution was aspirated into LB solid medium containing AMP+ (100 mg/mL), and cultured overnight at 37 ℃.

4. Identification and sequencing of positive clone bacterial liquid

(1) LA liquid medium (LB liquid medium with advanced ampicillin AMP+ (100 mg/mL) was added to 800. Mu.L to 1.5mL centrifuge tube (sterile);

(2) Using a small gun head (sterile), picking a single colony on a flat plate, and placing the colony into a centrifuge tube filled with LA liquid culture medium;

(3) Culturing for 4h (37 ℃ C., 200 rpm) on a shaker;

(4) Using the bacterial liquid obtained in the step (3) as a template, and selecting general primers M13 (-47) and M13 (-48) as general primers to perform bacterial liquid PCR amplification, wherein the reaction system is shown in Table 3, and the reaction conditions are as follows: 95 ℃ for 5min;95 ℃,30s,58 ℃,30s,72 ℃ and 90s for 32 cycles; 72 ℃ for 10min;

TABLE 3 bacterial liquid amplification reaction System

Composition of the components	Volume of
		2×Mix	10μL
Bacterial liquid	1μL
		M13(-47)(10mM)	1μL
M13(-48)(10mM)	1μL
		Double distilled water	7μL

(5) Detecting the reaction product in the step (4) through agarose gel electrophoresis with the concentration of 1.0%, sequencing 200 mu L of positive bacterial liquid with cloning plasmids to obtain correct cloned positive bacterial liquid, and storing the rest positive bacterial liquid serving as a copy in a low-temperature refrigerator with the temperature of-80 ℃.

5. Plasmid extraction

Plasmid extraction was performed using a plasmid extraction kit (FastPure Plasmid Mini Kit, purchased from nuezan biology (china)).

6. Kit for synthesis by dsRNA (T7 riboMAX) ^TM Express RNAi System dsRNA (double-stranded ribonucleic acid) purchased from North-African (China) and synthesized into MetTL3 gene of Litopenaeus vannamei

(1) Adding a T7 promoter sequence before the sequences of the primers P1 and P2 to synthesize a forward primer P3:5'TAATACGACTCACTATAGGG GTTGACAGTAGTAGCCGTTGAA3' (SEQ ID NO. 6), reverse primer P4:5'TAATACGACTCACTATAGGG CATCTGACATGGTGCCGTA 3' (SEQ ID NO. 7). And (3) carrying out PCR amplification by taking a forward primer P3 containing a T7 promoter and a common reverse primer P2 as primers, wherein the plasmid obtained in the step (5) is taken as a template, and the reaction system is shown in the table 4.

TABLE 4PCR amplification System

Composition of the components	Volume of
		2×Taq PCR Mix	10μL
Plasmid (95 mug/mL)	1μL
		Primer P1/P2 (10 mM)	1μL
Primer P3/P4 (10 mM)	1μL
		dd H ₂ 0	7μL

The reaction procedure is: 95 ℃ for 5min;95 ℃,30s,55 ℃,30s,72 ℃ and 45s, and 32 cycles in total; 72 ℃,10min,4 ℃ and 10min, and the purified product is the DNA template 1.

And (3) taking a common forward primer P1 and a reverse primer P4 with a T7 promoter as primers, carrying out PCR amplification by taking the plasmid obtained in the step (5) as a template, wherein a reaction system is shown in a table 4, and the purified product is the DNA template 2, and the reaction procedure is as follows: 95 ℃ for 5min;95 ℃,30s,55 ℃,30s,72 ℃ and 45s, and 32 cycles in total; 72 ℃,10min,4 ℃ and 10min.

(2) Adding the components according to the reaction system shown in Table 5, uniformly mixing, and placing in a PCR instrument to react for 2 hours at 37 ℃ to form dsRNA;

TABLE 5 dsRNA reaction System 1

Composition of the components	Volume of
		NTP Mix	8μL
10×Transcription Buffer	2μL
		T7 Enzyme Mix	2μL
DNA template 1 (168 mug/mL)	2.9μL
		DNA template 2 (215 mug/mL)	2.3μL
RNase-Free H ₂ O	2.8μL

(3) Diluting 100U/. Mu.L of RNase T1 to 10U/. Mu.L with RNase T1 Dilution Buffer;

(4) Adding each component according to a reaction system shown in Table 6, uniformly mixing, and incubating at 37 ℃ for 30min to obtain dsRNA;

TABLE 6 dsRNA reaction System 2

Composition of the components	Volume of
		Transcription Product (product of step (2))	20μL
RNase-Free H ₂ O	17μL
		DNase I	1μL
RNase T1(10U/μL)	2μL
		Total	40μL

(5) Quality detection and concentration determination of dsRNA: taking 1 mu L of the prepared dsRNA stock solution, and using RNase-Free H ₂ After 10-fold dilution of O, the integrity was checked by agarose gel electrophoresis at 1%, and the concentration was determined on an ultra-micro spectrophotometer to obtain a complete dsRNA with a concentration of 9.5ug/uL, the sequence of dsRNA was: GTTGACAGTAGTAGCCGTTGAACACAGCAAAGTAACAGCTGTTTTAGATGCAGAACACCGAGAGAAGAAAGTTCCGCCCACTGCAGTTGCTGTTGAAGATGAAAACCATTCTCCAGAGAAATCTGATGATACTATCTCAGAGCCTCCTACAAAGATTCTTCGTGAAGAGAAGGAGACAAAAGTGGACAAAGAGAAGAGAAAAGACAGGAGAGAAGATGACGTTATGAGTCTGTTGTCAGCGCAGAGCATAAGAGAAAGGGAAACAAAGAAAGTGGGAGAAGAAATCATGGAATTACTCAGTAAACCAACTGCGAAAGAGCAAAGCTTGGCGCAGAGATTCAGGTCTCAGGGAGGTGCAAAGGTCCAGGAATTCTGTCCACATGGCACCAAAGAAGAGTGTGAGAGAGCGACAAAGAAGGGAGGGCCACAGTGTGGACGCCTCCACTTCCGCAAGATCATCCAGAAACACACAGATGAGTCGCTGGGAGACTGCTCCTTCTTGAACACTTGCTTCCATATGGATACTTGCAGATACGTCCACTATGAGGTAGACTATACTGGGGTGTCGGGGCAGCAGCAACAGGAGCAAGAGTCATCCATGTTGATGACTATCCCCCGTGCCCGTCCTGAGGAGCGCACCATCCTTTTCCCCCCACAGTGGATACAGTGCGACCTGCGCTTCCTCGACATGTCCTTGTTAGGCAAATTTGCAGTGATTATGGCTGACCCCCCCTGGGACATCCACATGGAACTTCCATACGGCACCATGTCAGATG (SEQ ID No. 5), in which "T" is identical to "U".

Example 2 in vivo injection experiments of METTL3 Gene dsRNA

1. Healthy and active litopenaeus vannamei with similar body length and weight and in the molting period at the molting period is selected as an experimental object, the experiment is divided into an injection group and a control group, 3 parallel groups are arranged in each group, 20 parallel shrimps are temporarily cultured in a plastic barrel, the continuous aeration is carried out, the room temperature is about 28 ℃, and the litopenaeus vannamei compound feed is fed for three times at regular time and fixed points in the morning, in the evening every day. Injection dose was 2 μg dsRNA/g prawn body mass (i.e. 2 μg dsRNA per g body weight) using microinjector, and METTL3 gene dsRNA and dsRNA-EGFP were injected into the 5 th footbed of prawn, respectively, in experimental and control groups.

The sequence of dsRNA-EGFP is: GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC (SEQ ID No. 12), in which "T" is identical to "U".

Selecting prawn tissues injected with double-stranded RNA for 0h, 24h, 48h and 72h, and detecting the gene interference effect of the dsRNA by using a fluorescent quantitative PCR (qPCR) method: primer was designed using Primer Premier 6, forward Primer P5:5 'GCAGCAGCAACAGGAGCAAGAG 3' (SEQ ID NO. 8), reverse primer P6:5 'GCAGGTCGCACTGTACACTG3' (SEQ ID NO. 9), performing fluorescent quantitative PCR and analyzing the result, wherein the internal reference primers are as follows: forward primer P7:5 'TATGCTTTTGGACGTTTTGC3' (SEQ ID NO. 10), reverse primer P8:5 'CCTTTCTGCGGCCTTGGTAG3' (SEQ ID NO. 11). The reaction system is shown in Table 7.

TABLE 7qPCR amplification System

Composition of the components	Volume of
		SYBR	10μL
cDNA(154μg/mL)	1μL
		Primer P5/P7 (10 mM)	1μL
Primer P6/P8 (10 mM)	1μL
		dd H ₂ 0	7μL

The reaction procedure is: 95 ℃ for 30s;95 ℃ for 5s,58 ℃ for 30s,39 cycles; 95 ℃ for 10s;55 ℃ for 5s. The significance of the data difference among different prawn eye handle tissue samples is counted, and the interference effect of dsRNA on target genes is detected, wherein the result is shown in figure 1: in the eye handle tissue, after the METTL3 genes are knocked out for 24h, 48h and 72h, the expression level of the METTL3 genes in the eye handle tissue is significantly reduced compared with that of a control group, which indicates that RNA double chains play a role, and the expression level of the METTL3 genes is minimized after 24h injection.

2. Healthy and active litopenaeus vannamei with similar body length and weight and in the molting period at the molting period is selected as an experimental object, the experiment is divided into an injection group and a control group, 3 parallel groups are arranged in each group, 20 parallel shrimps are temporarily cultured in a plastic barrel, the continuous aeration is carried out, the room temperature is about 28 ℃, and the litopenaeus vannamei compound feed is fed for three times at regular time and fixed points in the morning, in the evening every day. Injection dose is 2 mug dsRNA/g prawn body mass (i.e. 2 mug dsRNA is injected per g body weight) by using a microinjector, and the injection dose is injected at the 5 th foot base part of prawn, and the experimental group and the control group are respectively injected with METTL3 gene dsRNA and dsRNA-EGFP; the METTL3 gene was re-injected every 3 days, the interference was continued for 15 days, 5 times per shrimp were injected every 15 days, and the ecdysis of each group of shrimps was counted at regular intervals every day. After 15 days of continuous observation, the results are shown in fig. 2: the cumulative molting rate (quotient of the number of the molts and the total number of the shrimps) of the control group and the experimental group is 51.67% and 70% respectively, and the cumulative molting rate of the experimental group is obviously higher than that of the control group, which indicates that METTL3 participates in the regulation of the molting period of the litopenaeus vannamei, and the molting process can be accelerated by inhibiting the expression of METTL 3.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

SEQUENCE LISTING

<110> university of Guangdong ocean

<120> dsRNA of prawn METTL3 gene and application thereof

<130>

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 577

<212> PRT

<213> Litopenaeus vannamei

<400> 1

Met Gly Asp Glu Thr Trp Ala Asn Ile Gln Leu Val Lys Ser Lys Arg

1 5 10 15

Glu Arg Phe Arg Glu Lys Phe Lys Arg Arg Lys Ala Glu Arg Glu Thr

20 25 30

Ile Leu Asn Tyr Ala Gly Gly Gly Gly Ala Asn Ala Thr Ser Leu Gln

35 40 45

Leu Cys Asn Ile Ala Thr Ser Ser Ser Ala Thr Ser Ser Ser Ser Asp

50 55 60

Ile Asp Ala Gly Lys Ser Pro Ile Pro Val Gly Val Val Pro Thr Thr

65 70 75 80

Ser Ser Ser Gln Asp Asp Pro Ser Leu Glu Cys Ala Leu Leu Glu Cys

85 90 95

Leu Asn Glu Ala Leu Pro Pro Val Gln Ala Ile Gln Leu Ser Glu Thr

100 105 110

Leu Ser Thr Lys Leu Arg Arg Thr Leu Pro Ser Lys Ala Ile Asn Asn

115 120 125

Leu Leu Glu Lys Phe Ala Tyr Lys Glu Leu Ile Ser Ile Thr Gln Gly

130 135 140

Thr Ser Glu Gly Arg Thr Ser Leu Thr Val Val Ala Val Glu His Ser

145 150 155 160

Lys Val Thr Ala Val Leu Asp Ala Glu His Arg Glu Lys Lys Val Pro

165 170 175

Pro Thr Ala Val Ala Val Glu Asp Glu Asn His Ser Pro Glu Lys Ser

180 185 190

Asp Asp Thr Ile Ser Glu Pro Pro Thr Lys Ile Leu Arg Glu Glu Lys

195 200 205

Glu Thr Lys Val Asp Lys Glu Lys Arg Lys Asp Arg Arg Glu Asp Asp

210 215 220

Val Met Ser Leu Leu Ser Ala Gln Ser Ile Arg Glu Arg Glu Thr Lys

225 230 235 240

Lys Val Gly Glu Glu Ile Met Glu Leu Leu Ser Lys Pro Thr Ala Lys

245 250 255

Glu Gln Ser Leu Ala Gln Arg Phe Arg Ser Gln Gly Gly Ala Lys Val

260 265 270

Gln Glu Phe Cys Pro His Gly Thr Lys Glu Glu Cys Glu Arg Ala Thr

275 280 285

Lys Lys Gly Gly Pro Gln Cys Gly Arg Leu His Phe Arg Lys Ile Ile

290 295 300

Gln Lys His Thr Asp Glu Ser Leu Gly Asp Cys Ser Phe Leu Asn Thr

305 310 315 320

Cys Phe His Met Asp Thr Cys Arg Tyr Val His Tyr Glu Val Asp Tyr

325 330 335

Thr Gly Val Ser Gly Gln Gln Gln Gln Glu Gln Glu Ser Ser Met Leu

340 345 350

Met Thr Ile Pro Arg Ala Arg Pro Glu Glu Arg Thr Ile Leu Phe Pro

355 360 365

Pro Gln Trp Ile Gln Cys Asp Leu Arg Phe Leu Asp Met Ser Leu Leu

370 375 380

Gly Lys Phe Ala Val Ile Met Ala Asp Pro Pro Trp Asp Ile His Met

385 390 395 400

Glu Leu Pro Tyr Gly Thr Met Ser Asp Asp Glu Met Arg Gln Leu Asn

405 410 415

Ile Pro Met Met Gln Glu Glu Gly Leu Ile Phe Leu Trp Val Thr Gly

420 425 430

Arg Ala Met Glu Leu Gly Arg Glu Cys Leu Lys Leu Trp Gly Tyr Glu

435 440 445

Arg Val Asp Glu Ile Ile Trp Val Lys Thr Asn Gln Leu Gln Arg Ile

450 455 460

Ile Arg Thr Gly Arg Thr Gly His Trp Leu Asn His Gly Lys Glu His

465 470 475 480

Cys Leu Val Gly Met Lys Gly Asn Pro Lys Val Asn Arg Gly Leu Asp

485 490 495

Gly Asp Val Ile Val Ala Glu Val Arg Ala Thr Ser His Lys Pro Asp

500 505 510

Glu Ile Tyr Gly Ile Ile Glu Arg Leu Ser Pro Gly Thr Arg Lys Leu

515 520 525

Glu Leu Phe Gly Arg Pro His Asn Val Gln Pro Asn Trp Val Thr Leu

530 535 540

Gly Asn Gln Leu Glu Gly Val Asn Leu Leu Glu Glu Asp Leu Val Lys

545 550 555 560

Ala Phe Lys Glu Arg Tyr Pro Asp Gly Ile Cys Cys Lys Gln Thr Pro

565 570 575

Gln

<210> 2

<211> 1734

<212> DNA

<213> Litopenaeus vannamei

<400> 2

atgggtgacg agacctgggc gaatatccag ctagtgaaga gcaagaggga gagattcagg 60

gagaagttca aaaggcgaaa agcagagcga gagacgatcc tgaactatgc tggaggaggc 120

ggcgccaatg caacctcact gcaactctgc aatattgcaa cctcttcttc tgctacgtct 180

tcttcctcgg atattgacgc gggcaagagt cctattcccg tcggcgttgt gccaaccaca 240

agcagtagcc aagatgaccc tagtcttgaa tgtgccttgt tagagtgtct gaatgaggcc 300

ttaccaccag ttcaggcgat acaattgtca gaaacactct caactaaact aagaagaaca 360

ctgccttcaa aagcaattaa taacttgttg gagaaatttg catataaaga actaattagc 420

attactcagg gtaccagtga agggagaact tcgttgacag tagtagccgt tgaacacagc 480

aaagtaacag ctgttttaga tgcagaacac cgagagaaga aagttccgcc cactgcagtt 540

gctgttgaag atgaaaacca ttctccagag aaatctgatg atactatctc agagcctcct 600

acaaagattc ttcgtgaaga gaaggagaca aaagtggaca aagagaagag aaaagacagg 660

agagaagatg acgttatgag tctgttgtca gcgcagagca taagagaaag ggaaacaaag 720

aaagtgggag aagaaatcat ggaattactc agtaaaccaa ctgcgaaaga gcaaagcttg 780

gcgcagagat tcaggtctca gggaggtgca aaggtccagg aattctgtcc acatggcacc 840

aaagaagagt gtgagagagc gacaaagaag ggagggccac agtgtggacg cctccacttc 900

cgcaagatca tccagaaaca cacagatgag tcgctgggag actgctcctt cttgaacact 960

tgcttccata tggatacttg cagatacgtc cactatgagg tagactatac tggggtgtcg 1020

gggcagcagc aacaggagca agagtcatcc atgttgatga ctatcccccg tgcccgtcct 1080

gaggagcgca ccatcctttt ccccccacag tggatacagt gcgacctgcg cttcctcgac 1140

atgtccttgt taggcaaatt tgcagtgatt atggctgacc ccccctggga catccacatg 1200

gaacttccat acggcaccat gtcagatgat gagatgcggc agctgaatat ccccatgatg 1260

caggaggaag gactcatatt cctttgggtg actggcagag ccatggaact aggtagagag 1320

tgccttaagc tctggggcta tgaacgtgtt gacgaaatca tttgggtgaa aaccaatcag 1380

cttcagcgca ttattcgcac aggcagaaca ggccattggt tgaatcatgg caaggaacat 1440

tgtttggtgg gaatgaaagg gaacccaaag gtaaatagag gcctagatgg tgatgtcatt 1500

gtagctgagg tccgcgccac gagtcacaaa ccagatgaaa tctatggcat cattgagcgt 1560

ctctcccccg gcacgcgcaa gctggaactc ttcgggcggc ctcacaatgt gcagccaaat 1620

tgggtgactc tcggcaacca gctggaaggt gtaaatctcc tggaggaaga cctggtcaaa 1680

gcatttaaag agcgatatcc agatggtata tgttgcaagc agacgcccca gtag 1734

<210> 3

<211> 22

<212> DNA

<213> artificial sequence

<400> 3

gttgacagta gtagccgttg aa 22

<210> 4

<211> 19

<212> DNA

<213> artificial sequence

<400> 4

catctgacat ggtgccgta 19

<210> 5

<211> 776

<212> DNA

<213> artificial sequence

<400> 5

gttgacagta gtagccgttg aacacagcaa agtaacagct gttttagatg cagaacaccg 60

agagaagaaa gttccgccca ctgcagttgc tgttgaagat gaaaaccatt ctccagagaa 120

atctgatgat actatctcag agcctcctac aaagattctt cgtgaagaga aggagacaaa 180

agtggacaaa gagaagagaa aagacaggag agaagatgac gttatgagtc tgttgtcagc 240

gcagagcata agagaaaggg aaacaaagaa agtgggagaa gaaatcatgg aattactcag 300

taaaccaact gcgaaagagc aaagcttggc gcagagattc aggtctcagg gaggtgcaaa 360

ggtccaggaa ttctgtccac atggcaccaa agaagagtgt gagagagcga caaagaaggg 420

agggccacag tgtggacgcc tccacttccg caagatcatc cagaaacaca cagatgagtc 480

gctgggagac tgctccttct tgaacacttg cttccatatg gatacttgca gatacgtcca 540

ctatgaggta gactatactg gggtgtcggg gcagcagcaa caggagcaag agtcatccat 600

gttgatgact atcccccgtg cccgtcctga ggagcgcacc atccttttcc ccccacagtg 660

gatacagtgc gacctgcgct tcctcgacat gtccttgtta ggcaaatttg cagtgattat 720

ggctgacccc ccctgggaca tccacatgga acttccatac ggcaccatgt cagatg 776

<210> 6

<211> 42

<212> DNA

<213> artificial sequence

<400> 6

taatacgact cactataggg gttgacagta gtagccgttg aa 42

<210> 7

<211> 39

<212> DNA

<213> artificial sequence

<400> 7

taatacgact cactataggg catctgacat ggtgccgta 39

<210> 8

<211> 21

<212> DNA

<213> artificial sequence

<400> 8

gcagcagcaa caggagcaag a 21

<210> 9

<211> 22

<212> DNA

<213> artificial sequence

<400> 9

gcaggtcgca ctgtatccac tg 22

<210> 10

<211> 23

<212> DNA

<213> artificial sequence

<400> 10

tatgctcctt ttggacgttt tgc 23

<210> 11

<211> 21

<212> DNA

<213> artificial sequence

<400> 11

ccttttctgc ggccttggta g 21

<210> 12

<211> 400

<212> DNA

<213> artificial sequence

<400> 12

gttcagcgtg tccggcgagg gcgagggcga tgccacctac ggcaagctga ccctgaagtt 60

catctgcacc accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca ccctgaccta 120

cggcgtgcag tgcttcagcc gctaccccga ccacatgaag cagcacgact tcttcaagtc 180

cgccatgccc gaaggctacg tccaggagcg caccatcttc ttcaaggacg acggcaacta 240

caagacccgc gccgaggtga agttcgaggg cgacaccctg gtgaaccgca tcgagctgaa 300

gggcatcgac ttcaaggagg acggcaacat cctggggcac aagctggagt acaactacaa 360

cagccacaac gtctatatca tggccgacaa gcagaagaac 400

Claims

1. Use of a methyltransferase protein 3 inhibitor in any one of (1) to (2);

(1) Promoting the molting of prawns;

(2) Preparing a product for promoting molting of prawns;

the methyltransferase protein 3 inhibitor is siRNA, dsRNA or shRNA targeting methyltransferase protein 3;

the amino acid sequence of the methyltransferase protein 3 is shown in SEQ ID No. 1.

2. The use according to claim 1, characterized in that:

the methyltransferase protein 3 inhibitor is a methyltransferase protein 3 targeting dsRNA, and the methyltransferase protein 3 targeting dsRNA is a double-stranded RNA composed of a nucleotide sequence shown in SEQ ID No.5 and a nucleotide sequence shown in the reverse complement sequence thereof.

3. The use according to claim 2, characterized in that:

the methyltransferase protein 3 inhibitor is a nucleic acid molecule encoding the dsRNA of claim 2.

4. A use according to claim 3, characterized in that:

the methyltransferase protein 3 inhibitor is an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule of claim 3.

5. A method for promoting molting of prawn comprises introducing the product into prawn body;

the product comprises: at least one of (1) to (3);

(1) The dsRNA of claim 2;

(2) A nucleic acid molecule as claimed in claim 3;

(3) The expression cassette, vector or transgenic cell line of claim 4.