CN110791503B - Low-phosphorus inducible promoter and application thereof - Google Patents
Low-phosphorus inducible promoter and application thereof Download PDFInfo
- Publication number
- CN110791503B CN110791503B CN201910759506.3A CN201910759506A CN110791503B CN 110791503 B CN110791503 B CN 110791503B CN 201910759506 A CN201910759506 A CN 201910759506A CN 110791503 B CN110791503 B CN 110791503B
- Authority
- CN
- China
- Prior art keywords
- low
- phosphorus
- plant
- promoter
- inducible promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8225—Leaf-specific, e.g. including petioles, stomata
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a low-phosphorus inducible promoter and application thereof, and also provides an expression and plant expression vector containing the promoter, wherein the nucleotide sequence of the promoter is shown as SEQ ID No:1, and the sequence is 1862 bases in length. The promoter of the invention is mainly expressed in roots and is induced by low phosphorus. The promoter is applied to plant transgenic engineering. Specifically, the promoter provided by the invention can drive the expression of the exogenous gene in the plant, especially can drive the expression of the exogenous gene in the corn root, but not in other tissues of the plant, and can improve the root character of the corn. Meanwhile, the invention can be used for improving the survival and growth capacity of corn under the low-phosphorus condition, thereby cultivating an ideal corn variety.
Description
Technical Field
The invention relates to the technical fields of biotechnology and plant genetic engineering, in particular to a low-phosphorus inducible promoter and application thereof.
Background
Corn is one of the cereal crops with the widest planting area in the world, and the sowing area and the total yield of corn in China are the second most in the world. The corn can be used as feed and industrial raw materials, can also be used as food, is one of important resources for improving the living standard of people and export trade, and has very important significance for the development of agriculture and animal husbandry. Phosphorus is one of the major elements necessary for plant growth and development, and has important roles in photosynthesis, enzyme activity regulation, respiration, signal transduction, redox reaction, energy metabolism, carbon metabolism and the like as well as important constituent components of biological membranes and nucleic acids. Although the phosphorus element in the soil is rich, the phosphorus element can be directly absorbed and utilized by plants. Since most of the phosphorus in the soil exists in the form of organic phosphorus, and the phosphorus that plants can directly absorb and utilize is inorganic phosphate.
In the actual cultivation process of corn, especially in acidic and alkaline soil, a large amount of phosphate fertilizer needs to be manually applied to ensure the yield of corn. Low phosphorus is one of the important factors affecting corn production, and low phosphorus stress will have a great effect on corn seedling traits, root systems, physiological and biochemical characteristics, maturity traits and the like. In addition, the sources of phosphate fertilizer in nature are also less and less, and it is reported that the ore rich in phosphorus element in nature is consumed at the end of the century. Therefore, research on the low phosphorus tolerance mechanism of corn has an important pushing effect on improving the quality and yield of corn.
In the prior art, the inducible promoter has low or even no downstream transcription under the normal adaptive growth condition of the plant, but can efficiently start transcription under external stress, so that the inducible promoter is vital to the plant to better adapt to natural environment and keep normal growth. Therefore, development of low-phosphorus inducible promoters by genetic engineering and other methods, in order to cultivate low-phosphorus-resistant high-yield maize varieties by genetic engineering of plants, has become an urgent task to be solved at present.
Based on the problems, the invention provides the low-phosphorus inducible promoter, which can induce the phosphorus stress resistance related genes to be expressed in a large amount in a short time when the external phosphorus concentration is low, so that the low-phosphorus inducible promoter is suitable for a low-phosphorus environment, is used as an important regulatory element on the transcription level, and has important application value.
Disclosure of Invention
The invention provides a low-phosphorus-stress-resistant plant promoter, which aims to solve the technical problem of providing a low-phosphorus-inducible promoter by which exogenous genes can be driven to express under a low-phosphorus condition.
In order to solve the technical problems, the invention provides a low-phosphorus inducible promoter, which comprises SEQ ID No:1, or a nucleotide sequence complementary to the sequence shown in SEQ ID NO.1, or a DNA sequence having more than 75% homology with the nucleotide sequence shown in SEQ ID NO. 1.
On the other hand, the invention also provides a recombinant expression vector which is obtained by inserting the low-phosphorus inducible promoter into a multiple cloning site of a plant expression vector, and the nucleotide sequence is connected to the upstream of a gene sequence to be expressed in the vector.
In one implementation, the gene to be expressed is a GFP gene. The recombinant expression vector is prepared by combining SEQ ID No:1, namely the low-phosphorus inducible promoter is named as Pro-Zm-miR399j or Pro-Zm-miR399j promoter; the promoter is constructed in a plant binary expression vector pCAMBIA3301 to obtain a recombinant expression vector, which is named pCAMBIA3301-Pro-Zm-miR399j. In another implementation, a green fluorescent protein gene (GFP gene) is introduced at the multiple cloning site of the original plant expression vector and the nucleotide sequence of the low-phosphorus inducible promoter Pro-Zm-miR399j is inserted before the GFP gene to drive the expression of the GFP gene of the downstream gene and the nuclear localization signal NLS follows the GFP gene.
In another aspect, the invention also provides a plant genetically engineered transformed host cell containing the low phosphorus inducible promoter or containing the recombinant expression vector.
In another aspect, the invention provides the use of the low-phosphorous inducible promoter in the cultivation of transgenic plants, the use comprising: connecting the low-phosphorus inducible promoter to the upstream of a gene sequence to be expressed in a vector, thereby constructing a recombinant expression vector; the recombinant expression vector is transformed into a plant cell, tissue or organ for cultivation.
In another aspect, the invention provides the use of the recombinant expression vector in the cultivation of transgenic plants, the use comprising: the recombinant expression vector is transformed into a plant cell, tissue or organ for cultivation.
In another aspect, the invention provides a use of the host cell in the cultivation of a transgenic plant, the use comprising: the host cells are transformed into tissues or organs for cultivation.
On the other hand, the invention provides an application of the low-phosphorus inducible promoter in genetic engineering for improving low-phosphorus resistance of plants.
On the other hand, the invention provides an application of the recombinant expression vector in genetic engineering for improving low phosphorus tolerance of plants.
In another aspect, the invention provides the use of said host cell in genetic engineering to improve plant tolerance to low phosphorus.
Further, the above-described application of the present invention is used to enhance the growth viability of plants under low-phosphorus conditions, thereby breeding desirable plant varieties. The plant is a monocot plant: wheat, corn, barley, sorghum, or oats.
The Pro-Zm-miR399j promoter is used for driving GFP gene expression in corn, and the promoter can induce GFP gene under the condition of low phosphorus, so that the Pro-Zm-miR399j promoter is a low phosphorus-induced promoter.
The skilled person will understand that according to SEQ ID No: 1-1899, and substituting, deleting or adding one or more nucleotides to the nucleotide sequence to obtain a nucleotide sequence with the same function; a DNA sequence having at least 75% homology to the DNA sequence of the low-phosphorous inducible promoter; alternatively, the promoter further comprises a sequence that hybridizes under high stringency conditions to SEQ ID No:1 and has a promoter function, and all belong to the present invention.
The low-phosphorus inducible promoter Pro-Zm-miR399j has no adverse effect on growth and development at normal phosphorus concentration, can drive exogenous gene expression under a low-phosphorus condition, can drive genes for promoting root and leaf growth, or drive hormone regulating genes, or related genes in metabolic pathways, promote root and leaf growth and development, can promote corn root and leaf elongation growth under a low-phosphorus condition, improves low-phosphorus tolerance of corn, and has very important application potential.
Drawings
Embodiments of the present invention are described in detail below with reference to the attached drawing figures, wherein:
FIG. 1 is a schematic diagram of the construction of the promoter Pro-Zm-miR399j in the pCBIA3301 vector plasmid;
FIG. 2 is a schematic diagram showing the results of performing enzyme digestion PCR verification on the pCBIA3301-Pro-Zm-miR399j promoter of the invention;
FIG. 3 shows the GFP fluorescence detection results of the obtained Pro-Zm-miR399j-GFP-NLS transgenic positive maize seedling cell level;
FIG. 4 shows the quantitative PCR method for detecting the GFP gene expression level driven by Pro-Zm-miR399j promoter;
FIG. 5 is a graph of the relative expression values of miR399j precursor genes induced by low phosphorus in the roots and leaves of maize, respectively.
Detailed Description
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The following examples are further illustrative of the invention and are not intended to be limiting thereof. Modifications and substitutions to methods, procedures, or conditions of the present invention are within the scope of the present invention without departing from the spirit and nature of the invention.
Example 1 acquisition of promoter Pro-Zm-miR399j and construction of expression vector
Genomic DNA of maize B73 variety was extracted according to conventional methods. According to the whole genome sequence of the maize B73 variety provided in NCBI, searching to obtain a MIR399j gene sequence, taking the 5' -end of the MIR399j gene sequence as the upstream 1899bp of the initial site as the sequence of a low-phosphorus inducible promoter (SEQ ID No: 1), and naming the sequence as Pro-Zm-miR399j.
A green fluorescent protein gene (i.e., GFP gene) was introduced at the multiple cloning site of the expression vector, and the nucleotide sequence of the low-phosphorus inducible promoter Pro-Zm-miR399j (SEQ ID No: 1) was inserted in front of the GFP gene, followed by nuclear localization signal NLS. Taking a corn binary expression vector pCAMBIA3301 as an example, the invention obtains the sequence of GFP-NLS from the corn binary expression vector pCAMBIA3301 containing the GFP-NLS sequence, designs the enzyme cutting site of the primer according to the characteristics of the selected vector, and adds a 15bp vector homologous sequence.
Specifically, primer5 primer design software is utilized to design amplification primers according to the sequence of the corn Pro-Zm-miR399j promoter, and enzyme cutting sites of the primers are designed according to the characteristics of the selected carrier and target genes. The specific sequence is designed as follows: the forward primer has a sequence of 15bp overlapped with the selected carrier at the 5 'end, the reverse primer has a sequence of 15bp overlapped with the selected carrier at the 5' end, and the primer sequences are as follows:
forward primer: TACGAATTCGAGCTCTTACTTTCACAAAGGAAGAGCA
Reverse primer: GCTCACCATTCTAGATGGACGATGGATCTAGCTAGC
The invention uses corn B73 variety genome DNA as a template, utilizes a forward primer and a reverse primer to amplify Pro-Zm-miR399j sequence, and adopts the following amplification procedures according to a conventional PCR system: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, and circulation for 35 times; finally, the extension is carried out for 10min at 72 ℃. The target fragment amplified by PCR was recovered, and the target fragment was 972bp in length.
The PCR product was sent to Guangzhou Ai Ji Biotechnology Co.Ltd for sequencing and alignment with the promoter sequence in NCBI. Sequencing results show that the PCR product has the DNA fragment shown by the 1 st to 1899 th nucleotides at the tail end of the sequence table, and the DNA fragment shown by the 1 st to 1899 th nucleotides at the tail end of the sequence table is named Pro-Zm-miR399j.
The plant expression vector pCAMBIA3301 was digested with the restriction enzymes XbaI and PvuI, and the linearized vector backbone was recovered. And recovering Pro-Zm-miR399j fragment. GFP-NLS is connected to the pCAMBIA3301 vector after enzyme digestion by using the One step cloning kit of Vazyme, after the competent cells of escherichia coli DH5 alpha are transformed by a heat shock method, the competent cells are activated, then the target fragment is transferred into the activated competent cells, positive clones are obtained by colony PCR screening, and the monoclonal shaking liquid extract plasmid is selected. The recombinant is screened by colony PCR and the correct result is verified by double enzyme digestion (the detection result is shown as figure 2, the result of the genotype identification of the transgenic corn is consistent with the expected result, and is a positive plant), the positive colony shaking bacteria are picked up, the plasmid is delivered to Guangzhou Ai Ji biotechnology limited company for sequencing, the correct recombinant is sequenced (the information of the transferred vector in the transgenic corn is shown as figure 1, which contains miR399j promoter, GFP sequence and miR399j to start GFP expression), the plasmid is extracted, and the positive colony shaking bacteria are picked up and the bacterial liquid is preserved for standby by glycerol.
Example 2 Water planting and identification of Pro-Zm-miR399j promoter Low phosphorus inducible Activity genotype
The constructed pCAMBIA3301-miR399j-pro-GFP-NLS vector (shown in FIG. 1) was transfected into maize by Pseudomonas. The DNA of transgenic corn leaf and root transformed with the promoter was extracted according to TRIzol method, respectively.
In specific implementation, transgenic corn seeds are subjected to water culture by using Hoagland nutrient solution until the period of V1 (the period of V1 is that seedlings grow out of a first leaf ring), a small amount of leaf extract DNA is taken for genotyping, and the upstream primer sequences for genotyping are as follows:
forward primer: GTCCATCTAGAATGGTGAGCAAGGG
Reverse primer: TAGTTGCCGTCGTCCTTGAAGA
The size of the product is 331bp, seedlings which are identified as positive are divided into two groups, and after the seedlings are respectively subjected to low phosphorus treatment and normal phosphorus treatment and cultured for 7 days, leaves and roots are respectively taken out, and fluorescence is observed by a microscope.
In addition, after cDNA is obtained through reverse transcription by a conventional method, qPCR is performed to analyze the expression quantity of GFP, and the relative expression quantity of genes in leaves and roots of seedlings during statistical low-phosphorus treatment and normal phosphorus treatment, wherein the primer sequences of the qPCR are as follows:
forward primer: AGGACGACGGCAACTACAAG
Reverse primer: TTCTGCTTGTCGGCCATGAT
The results are shown in FIG. 3 and FIG. 4, where FIG. 3 shows the amount of GFP expressed at the cellular level in the roots and leaves of maize seedlings before and after the low-phosphorus treatment, and where there is significant fluorescence in the roots and leaves of plants after the low-phosphorus stress treatment (FIG. 3A, B and C, FIG. 4), and FIG. 4 shows that the amount of GFP expressed after the low-phosphorus treatment is increased, and where after the low-phosphorus treatment the amount of GFP expressed in the roots is approximately 3 times before the treatment and the amount of GFP expressed in the leaves is 2 times more before the treatment. From this, the Pro-Zm-miR399j promoter was a low phosphorus-inducible promoter.
Example 3 quantitative PCR identification of Pro-Zm-miR399j promoter Low phosphorus Induction Activity
Performing reverse transcription by a conventional method to obtain cDNA, and then performing qPCR (quantitative polymerase chain reaction) analysis on the expression level of Pro-Zm-miR399 precursor genes, and counting the relative expression level of genes in leaves and roots of seedlings during low-phosphorus treatment and normal phosphorus treatment, wherein the qPCR has the following primer sequences:
forward primer: GGTTGCTTGGCTCTGCTATGCTG
Reverse primer: CGATCTTGTTCGAGCTGAAGACAG
The results are shown in FIG. 5. FIG. 5 shows that miR399j precursor gene can be significantly induced to express by low phosphorus in both leaves and roots of maize (h represents hours, d represents days); when the normal nutrient solution treatment and the low-phosphorus stress treatment are simultaneously compared in a laboratory, the relative expression amount of the miR399j precursor gene in the leaves of the plant after the low-phosphorus nutrient solution treatment reaches a peak value at the 7 th day and is approximately 20 times that in the normal nutrient solution treatment (in FIG. 5, 5a represents the relative expression amount of the miR399j precursor gene in the leaves of the plant, wherein a line L1 represents the relative expression amount of the gene after the low-phosphorus nutrient solution treatment and a line L2 represents the relative expression amount of the gene after the normal nutrient solution treatment); further, when laboratory comparisons were made while normal nutrient solution treatment and low-phosphorus stress treatment were performed, the relative expression amount of miR399j precursor gene in the roots of the plants after low-phosphorus nutrient solution treatment peaked at day 10, approximately 70 times that in normal nutrient solution treatment (in fig. 5, 5b represents the relative expression amount of miR399j precursor gene in the roots of the plants, where line L3 represents the relative expression amount of gene after low-phosphorus nutrient solution treatment, and line L4 represents the relative expression amount of gene after normal nutrient solution treatment); thus, it was revealed that the GFP expression level of the plant leaves and roots was increased after the low phosphorus treatment.
Further, when laboratory comparisons were made with normal nutrient solution treatment and low phosphorus stress treatment, the relative expression level of the miR399j precursor gene in the leaves of the plants after low phosphorus nutrient solution treatment was approximately 10 times that in the roots of the plants after low phosphorus nutrient solution treatment at day 7 (as can be seen in fig. 5 by comparing the relative expression levels of the genes represented by line L1 of fig. 5a and line L13 of fig. 5 b); and may indicate that the low phosphorus induction activity of the promoter in leaves is stronger than the induction activity of the promoter in roots for a period of time after low phosphorus stress treatment.
Specific example 4 information analysis of promoter Pro-Zm-miR399j
Cis-acting elements in the low-phosphorus inducible promoter Pro-Zm-miR399j are analyzed by online promoter analysis software plantaCARE to predict regulatory elements in the Zm-miR399j-Pro promoter sequence, and the results are shown in the following table.
Since multicellular organisms need to integrate different tissues during growth, differentiation and development, the regulation of transcriptional initiation is an important part of the process, developmental, environmental signal regulating gene expression. Cis-acting elements are specific DNA sequences in the same DNA molecule that have transcription regulatory functions, i.e., transcription factor DNA binding sites and other regulatory motifs (motif) that have specific functions. From the above table, it can be seen that the regulatory elements in the promoter Pro-Zm-miR399j of the invention can be obtained by software prediction. Among them, the regulatory element G-box is an essential element for many stress-responsive promoters to function, and plays an important role in the influence of plant promoters on light, anaerobic environment and plant hormones.
The above description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes or modifications according to the present invention without departing from the spirit of the present invention, and shall fall within the scope of the appended claims.
Sequence listing
<110> Shenzhen university
<120> a low phosphorus inducible promoter and use thereof
<170>SIPOSequenceListing 1.0
<210>1
<211>1899
<212>DNA
<213> Low phosphorus inducible promoters
<400>1:
ttactttcac aaaggaagag caacaaagcg atgaataatt aaatttgttc ctgagactaa 60
cgggtgagat tattcatgct atcaagcttt atcatccaaa taaaaaaata cctacatgtt 120
tactaaacca aaataaaaaa tagaactgat tgaacatata tgtacccgat ttgaaattac 180
atagagctta ctttttataa tgtacatgcg tgtgcgtgta attgatgtac tccatttgaa 240
atggactata tatatgatga gattgagtgt gtactaataa ggacggaatt aaacttggcc 300
aaggtggatg ttggtcatgg caggcacaca tggactggcg gccggacacg caaatttcct 360
agctgtcata tgtaaataca cactcaatat aatattctcg atcaatatat aatattctcg 420
gatcgatcac taagcgtggt cacatcagag ggtttccggc cattaacttt tgttccaaac 480
cggttactga tccaaatact agtacctgag attttaaata tcgcatcatc cagatcataa 540
cagtaccagt tgatgtctcg cttgattaac gcatccaaat aagaaaccga tttttatttt 600
tgtgttgatg gtatttgtag gaacaaaact acatctcact tgcttttttg tttctttctc 660
accaaaccaa ctattcagaa tttgtattgg gcatgcacaa cagagaaacg aaactaatca 720
aatatgtctg gtctccattg cataccgttt taactcagtc tggctctaaa tctcatacag 780
gctcagttgg gccacgaacc aattggaccc tatatagtca accaacaaac acatgtgacg 840
cctaaaatca ttctaggctt ctagcttttt tttccgttcg cattcgaatg aatgtagatt 900
tatatacaaa atatattcat aagttaatta atgaatttat atttagtcta aaatgaatta 960
tattttgaga cggcttgtgt agaatggaat tcaattctaa gaatgcaaac tggacgttac 1020
atttcttcta gattaaatta aacatgaaag ctaaattcct atcaggtaca caacttacaa 1080
ctatagccgc aatttggaat tagaggaaag gtgcactacc ggaatccggc tctttgtcga 1140
gtgctctaat ctatatcgag ggcaatttat cagacactcg ataaaacatg ctttaccgag 1200
cgtcgaacac ttcacataca cggaaggagg ctttgacgaa tgtcacacgc gatcctaacc 1260
ctacaattgt cagcagtcat ctatggctaa cagacgagac ctcttcaccg acagttgtta 1320
tagtcggttt accaaaaatt atactcggta aaaagttagc caagtgtttt taaggtttca 1380
acactcgaca aaaaacctga ttccgtcagt ggtgcttgac aagcgacgag cgactcacgg 1440
cacgtagcag gtagcaaagc catccgatcg gcgcccggcc cggtggacga cagtggctgg 1500
acacagacca gcgatcggcc ggccccggga ttctccatgt cgacggaagc ctcatcgtgg 1560
ccggggaata ggataaagtt gatgggcgcg gaggaatccc ggaggaggga tatccatggt 1620
acaaccatgg gcctaaaaag tcgcagcgca tcatgcgcat gcatccatcg gtaggcccat 1680
gcatcctgca gcagcagcag cagcagcacg gcatatgcca ccgccgcccg cctgccaggc 1740
tgccacacgc gcccctgctg atcgacgggc tactccgttc ctcggtcgtc gtcgtggact 1800
gactctataa gaggagcgcc aacacttcgc gaggtctaag cagaggagct agctaggaag 1860
aggtacggtg ctggctaagc tagctagatc catcgtcca 1899。
Sequence listing
<110> Shenzhen university
<120> a low phosphorus inducible promoter and use thereof
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2000
<212> DNA
<213> Low phosphorus inducible promoters
<400> 1:
ttactttcac aaaggaagag caacaaagcg atgaataatt aaatttgttc ctgagactaa 60
cgggtgagat tattcatgct atcaagcttt atcatccaaa taaaaaaata cctacatgtt 120
tactaaacca aaataaaaaa tagaactgat tgaacatata tgtacccgat ttgaaattac 180
atagagctta ctttttataa tgtacatgcg tgtgcgtgta attgatgtac tccatttgaa 240
atggactata tatatgatga gattgagtgt gtactaataa ggacggaatt aaacttggcc 300
aaggtggatg ttggtcatgg caggcacaca tggactggcg gccggacacg caaatttcct 360
agctgtcata tgtaaataca cactcaatat aatattctcg atcaatatat aatattctcg 420
gatcgatcac taagcgtggt cacatcagag ggtttccggc cattaacttt tgttccaaac 480
cggttactga tccaaatact agtacctgag attttaaata tcgcatcatc cagatcataa 540
cagtaccagt tgatgtctcg cttgattaac gcatccaaat aagaaaccga tttttatttt 600
tgtgttgatg gtatttgtag gaacaaaact acatctcact tgcttttttg tttctttctc 660
accaaaccaa ctattcagaa tttgtattgg gcatgcacaa cagagaaacg aaactaatca 720
aatatgtctg gtctccattg cataccgttt taactcagtc tggctctaaa tctcatacag 780
gctcagttgg gccacgaacc aattggaccc tatatagtca accaacaaac acatgtgacg 840
cctaaaatca ttctaggctt ctagcttttt tttccgttcg cattcgaatg aatgtagatt 900
tatatacaaa atatattcat aagttaatta atgaatttat atttagtcta aaatgaatta 960
tattttgaga cggcttgtgt agaatggaat tcaattctaa gaatgcaaac tggacgttac 1020
atttcttcta gattaaatta aacatgaaag ctaaattcct atcaggtaca caacttacaa 1080
ctatagccgc aatttggaat tagaggaaag gtgcactacc ggaatccggc tctttgtcga 1140
gtgctctaat ctatatcgag ggcaatttat cagacactcg ataaaacatg ctttaccgag 12009
cgtcgaacac ttcacataca cggaaggagg ctttgacgaa tgtcacacgc gatcctaacc 1260
ctacaattgt cagcagtcat ctatggctaa cagacgagac ctcttcaccg acagttgtta 1320
tagtcggttt accaaaaatt atactcggta aaaagttagc caagtgtttt taaggtttca 1380
acactcgaca aaaaacctga ttccgtcagt ggtgcttgac aagcgacgag cgactcacgg 1440
cacgtagcag gtagcaaagc catccgatcg gcgcccggcc cggtggacga cagtggctgg 1500
acacagacca gcgatcggcc ggccccggga ttctccatgt cgacggaagc ctcatcgtgg 1560
ccggggaata ggataaagtt gatgggcgcg gaggaatccc ggaggaggga tatccatggt 1620
acaaccatgg gcctaaaaag tcgcagcgca tcatgcgcat gcatccatcg gtaggcccat 1680
gcatcctgca gcagcagcag cagcagcacg gcatatgcca ccgccgcccg cctgccaggc 1740
tgccacacgc gcccctgctg atcgacgggc tactccgttc ctcggtcgtc gtcgtggact 1800
gactctataa gaggagcgcc aacacttcgc gaggtctaag cagaggagct agctaggaag 1860
aggtacggtg ctggctaagc tagctagatc catcgtcca 2000
Claims (3)
1. Use of a low-phosphorous inducible promoter in the cultivation of transgenic plants, said low-phosphorous inducible promoter being SEQ ID No:1, said use being for increasing the growth viability of a plant under low phosphorus conditions; the plant is monocot maize.
2. An application of a recombinant expression vector in culturing transgenic plants, wherein the recombinant expression vector is a recombinant plasmid obtained by inserting a low-phosphorus inducible promoter into a multiple cloning site of the plant expression vector, a nucleotide sequence is connected to the upstream of a gene sequence to be expressed in the vector, and the low-phosphorus inducible promoter is SEQ ID No:1, said use being for increasing the growth viability of a plant under low phosphorus conditions; the plant is monocot maize.
3. Use of a host cell comprising a low-phosphorous inducible promoter or comprising a recombinant expression vector, said low-phosphorous inducible promoter being SEQ ID No:1, wherein the recombinant expression vector is a recombinant plasmid obtained by inserting the low-phosphorus inducible promoter into a multiple cloning site of a plant expression vector, the nucleotide sequence is connected to the upstream of a gene sequence to be expressed in the vector, and the application is used for improving the growth and viability of plants under the low-phosphorus condition; the plant is monocot maize.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910759506.3A CN110791503B (en) | 2019-08-16 | 2019-08-16 | Low-phosphorus inducible promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910759506.3A CN110791503B (en) | 2019-08-16 | 2019-08-16 | Low-phosphorus inducible promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110791503A CN110791503A (en) | 2020-02-14 |
| CN110791503B true CN110791503B (en) | 2023-09-08 |
Family
ID=69427459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910759506.3A Active CN110791503B (en) | 2019-08-16 | 2019-08-16 | Low-phosphorus inducible promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110791503B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113881668B (en) * | 2021-09-13 | 2023-09-12 | 深圳大学 | Light-induced gene promoter, recombinant vector, construction method of light-induced gene promoter and recombinant bacteria |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1671739A (en) * | 2002-07-31 | 2005-09-21 | 拜尔生物科学股份有限公司 | Corn root preferential promoters and uses thereof |
| CN108424912A (en) * | 2018-02-01 | 2018-08-21 | 山西省农业科学院作物科学研究所 | The promoter of corn low-phosphorus stress induced expression and its application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000897A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of phosphate transporter genes |
| JP4771259B2 (en) * | 2005-09-16 | 2011-09-14 | 独立行政法人国際農林水産業研究センター | Stress-inducible transcription factor from maize |
-
2019
- 2019-08-16 CN CN201910759506.3A patent/CN110791503B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1671739A (en) * | 2002-07-31 | 2005-09-21 | 拜尔生物科学股份有限公司 | Corn root preferential promoters and uses thereof |
| CN108424912A (en) * | 2018-02-01 | 2018-08-21 | 山西省农业科学院作物科学研究所 | The promoter of corn low-phosphorus stress induced expression and its application |
Non-Patent Citations (1)
| Title |
|---|
| 小麦磷转运蛋白基因TaPT2的转录调控特征研究;张树华 等;河北农业大学学报;第34卷(第02期);第6-12页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110791503A (en) | 2020-02-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Han et al. | Decreasing nitrogen assimilation under drought stress by suppressing DST-mediated activation of Nitrate Reductase 1.2 in rice | |
| CN109825501B (en) | Long-chain non-coding RNA T5120 from arabidopsis thaliana and application thereof | |
| CN112980848B (en) | Rice sugar-induced promoter SRN1 and application thereof | |
| CN110592114A (en) | Application of oryza sativa auxin glycosyl transferase gene | |
| CN110791503B (en) | Low-phosphorus inducible promoter and application thereof | |
| CN106674337A (en) | Plant phosphorus transport protein ZmPHT1;7, and encoding gene and application thereof | |
| CN103044534B (en) | Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein | |
| CN107058324B (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivation method | |
| CN108795927A (en) | The clone of common wheat gene TaSPX3 coded sequences and its application | |
| CN110144360B (en) | Chilo suppressalis SDR gene and encoded protein and application thereof, dsRNA and amplification primer pair and application thereof | |
| CN1844394A (en) | Phosphorus starvation induced gene promoter and its application | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof | |
| CN1239702C (en) | Rice root system phosphorus starvation induction specific expression promoter and its plant culture method | |
| CN110964729A (en) | Cloning method, application and application method of common wheat gene TaSNX1 | |
| CN109880845A (en) | A method of improving plant nodulation and nitrogen fixation efficiency | |
| CN109082425A (en) | Rape Boron efficiency gene BnA3NIP5;The transposons Insert Fragment TEQ and primer of 1Q and its application | |
| CN111454346B (en) | Transcription factor HvNLP2 from barley and participating in nitrate nitrogen regulation and application thereof | |
| CN114478728B (en) | Application of nKCBP protein in regulation and control of nitrogen fixation capacity of leguminous plants | |
| CN101955522A (en) | Peanut ferrous transport protein as well as encoding gene and application thereof | |
| CN108892712B (en) | Application of protein TabZIP60 in regulation and control of plant yield | |
| CN108841839B (en) | Application of protein TabZIP60 in regulation and control of nitrogen absorption of plants | |
| CN108409845B (en) | Application of protein TaNRT2.5 in regulation and control of nitrogen fertilizer utilization efficiency of plants | |
| CN118028356A (en) | Application of TaSPL6 gene in negative regulation of wheat yield and nitrogen utilization efficiency | |
| CN107083390A (en) | Application of the rice Os PRAF1 genes in improvement root system of plant and raising Cd stress resistance | |
| CN105384802B (en) | A kind of nucleotide sequence and its application from the controllable downstream gene translation efficiency of rubber tree |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |