CN112980848B - Rice sugar-induced promoter SRN1 and application thereof - Google Patents

Rice sugar-induced promoter SRN1 and application thereof Download PDF

Info

Publication number
CN112980848B
CN112980848B CN202110441890.XA CN202110441890A CN112980848B CN 112980848 B CN112980848 B CN 112980848B CN 202110441890 A CN202110441890 A CN 202110441890A CN 112980848 B CN112980848 B CN 112980848B
Authority
CN
China
Prior art keywords
srn1
promoter
sugar
rice
sucrose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110441890.XA
Other languages
Chinese (zh)
Other versions
CN112980848A (en
Inventor
张健
李志永
童晓红
王以锋
应杰政
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China National Rice Research Institute
Original Assignee
China National Rice Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China National Rice Research Institute filed Critical China National Rice Research Institute
Priority to CN202110441890.XA priority Critical patent/CN112980848B/en
Publication of CN112980848A publication Critical patent/CN112980848A/en
Application granted granted Critical
Publication of CN112980848B publication Critical patent/CN112980848B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/8223—Vegetative tissue-specific promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237—Externally regulated expression systems
    • C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a rice sugar-induced promoter SRN1 and application thereof. Belongs to the technical field of genetic engineering. The nucleotide sequence of the rice sugar-induced promoter SRN1 is shown in SEQ ID No. 1. The promoter SRN1 belongs to a tissue-specific promoter induced by sucrose and glucose, and has important application value in the field of plant genetic engineering and the research of conduction mechanisms of sugar signal molecules in organisms. The promoter SRN1 provides a tool for directionally expressing genes for important agronomic characters of rice or other grain crops and genetic engineering breeding for stress, and can be used for indicating the level of soluble sugar in plants in scientific research.

Description

Rice sugar-induced promoter SRN1 and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a rice sugar-induced promoter SRN1 and application thereof.
Background
The important agronomic characters of crops and the expression of regulatory genes corresponding to stress are one of the important research focuses of plant genetic engineering, and the promoter is an important regulatory sequence for regulating the expression of the genes and is a research hotspot of the plant genetic engineering. The inducible promoter can greatly increase or inhibit the transcription level of a driving gene under the stimulation of certain physical or chemical signals. Inducible promoters often have sequence structures such as enhancers, silencers, etc., and a portion of the promoters exhibit tissue-specific expression or rhythmic expression.
The inducible promoters can be classified into light-inducible promoters, temperature-inducible promoters, hormone-inducible promoters, wound-inducible promoters, microorganism-inducible promoters, and the like, according to the inducing conditions. In life, sugar is an economical and common substance, and in the case of plants, sugar is a basic substance that can be synthesized in large quantities by photosynthesis. Therefore, the sugar-inducible promoter, especially the sucrose or glucose-inducible promoter has the characteristics of convenience and high efficiency when being used as a regulation element of a genetic engineering vector. The wide application of the sugar-induced promoter in plant genetic engineering can greatly promote the genetic improvement on crop agronomic characters and stress.
Studies on sugar-inducible promoters in plants have mainly focused on synthesis, transport, and metabolic genes of sucrose, starch, and the like. However, the nucleic acid sequence of a highly efficient sucrose-inducible promoter has not been found. Therefore, there is an urgent need for sugar-inducible promoters that can play an important role in plants, particularly in food crops such as rice.
Disclosure of Invention
In view of the above, the invention provides a rice sugar-inducible promoter SRN1 and application thereof. The promoter can drive the target gene to express in plants under the induction condition of sucrose and glucose.
In order to achieve the purpose, the invention adopts the following technical scheme:
a rice sugar-inducible promoter SRN1 has the following nucleotide sequence:
tggatatatatcttcctatatattattctctttgtctataactatatactatttgtcatgaaactttgtttctctttttttcttttcttgattgtttaaataaaaaaaaaacttaatagggttggattttttttggggaaaatgaaagaaccctattgctaacgtgcgtggattgaggaaggagagggttatatatggaggatgagatggtataattagagaagaggtgtgaggcgaggaaataggcaagaaaaagctctgggttttttttttgtgtgtgtttgtgtgatttaattattggtggtgaagaagcttgtaagaacttgtgtgccatcaagtgacattactttgtttttttattgtgtaatatttggcgctctattctttgtagggagagacagggcaaagggttagttcaaattaataattcctgttgatcattttttttagattaattgatttttattaattcagcctctgtatccacgaaggatatacacagccattttttttaggaatacacatattattgtattataaacacctctcaaacaaagattgaaaaggagataaacacctctcaaaggtctaattggattcaattcgtcctccagtatatcccgggattggacactgtcatcgacgtcgtcctatttctctgaagctgaaagataaagaccacccagatgaatcacaaattcgtcgaaaccgatgaaccaaattaaatgggaaaattcttcatctaagttcatacagaaaaaggacctgggtcttttcatcacgagctttgaaaagattgtagacctccgagtgatcataacacttggccatcagctggtacagctagctttgggattctaggcgaaaacggaattaaatcacaaactgataaacaaaatgcaaaaatttgaatttcttttatgttgatttggataatcggaggagatcgttgaataggcgaactgaccgtgctgcatcacaaccggtcgtgtacacaatcatttttgcagaatgtgggtgacgtacggtgtgtgacaatcagaaaaatctgacttttttttaaagatgcggacatccctctaaatattttttcaagaaattgtgagcgtgttggggattaaacatagaacctcggagttgaaactacacaccacttaccgctacactatcaaatgcatctcctactcttatcgtatcaatgtgcttggtagagccaaaacattggataggcatgtacatgaaatgtgctttcaaatcataaatttgacacgagtgttcgtatttatagctaattattctttcaatggtaggcgatgtacccgtcgacagcgatacgcccgtggtgacttcgttaatctcaagatatactgacccagtctttcggatgtcctcatatgagtagggtgtgcattcataaacggatgagtgtgcgtgtgttatgagcgtctacatttgtactgtgtttatagaaaaaactttggataggcataaacatgaaaggagcccccatgtgatatttacgtctcgcgtgggagcaacacaccctagcaaggattgcgtggtgccaccaggacatccgtttctatctctttttgcatctcttttctcaactcaacgtacacgcgtaagagttggttttaactttttttcgtccaaattgctgaaattgccaaataggacattacatgtccaatgagtccctccaaactccgttggcaaattgcaacttttgcaaatcaacctgtacatcgtacaccacctgtatatatagacagaagcgcacataggacagatagctagaaagaaagaaataaagcatatacttttaagcaaaaacaaatgtaaagagcatgtcaccttgtcgattctctatggtgatagggtccagggcaatgccatgtcatgctatcttatccctgtgctttgcacacagctttttcaccaaatccctgcaagaatcctcctataaatacccacccaattgatccatcaatttccc；SEQ ID No.1。
further, the sugar is sucrose or glucose.
A primer pair for amplifying a promoter SRN1 has the following nucleotide sequence:
SRN1pro F1：tctctagaactagtggatccatggcgatgacaccgcagct；SEQ ID No.2；
SRN1pro R1：ataagcttgatatcgaattcctagccaccatggtttct；SEQ ID No.3。
a recombinant vector, a transgenic cell line or a recombinant bacterium containing the nucleotide sequence of the promoter SRN 1.
Furthermore, the reporter gene of the promoter SRN1 containing the nucleotide sequence shown in SEQ ID No.1 is an expression vector proSRN1 of LUC, wherein the nucleotide sequence of the LUC is as follows:
tggatatatatcttcctatatattattctctttgtctataactatatactatttgtcatgaaactttgtttctctttttttcttttcttgattgtttaaataaaaaaaaaacttaatagggttggattttttttggggaaaatgaaagaaccctattgctaacgtgcgtggattgaggaaggagagggttatatatggaggatgagatggtataattagagaagaggtgtgaggcgaggaaataggcaagaaaaagctctgggttttttttttgtgtgtgtttgtgtgatttaattattggtggtgaagaagcttgtaagaacttgtgtgccatcaagtgacattactttgtttttttattgtgtaatatttggcgctctattctttgtagggagagacagggcaaagggttagttcaaattaataattcctgttgatcattttttttagattaattgatttttattaattcagcctctgtatccacgaaggatatacacagccattttttttaggaatacacatattattgtattataaacacctctcaaacaaagattgaaaaggagataaacacctctcaaaggtctaattggattcaattcgtcctccagtatatcccgggattggacactgtcatcgacgtcgtcctatttctctgaagctgaaagataaagaccacccagatgaatcacaaattcgtcgaaaccgatgaaccaaattaaatgggaaaattcttcatctaagttcatacagaaaaaggacctgggtcttttcatcacgagctttgaaaagattgtagacctccgagtgatcataacacttggccatcagctggtacagctagctttgggattctaggcgaaaacggaattaaatcacaaactgataaacaaaatgcaaaaatttgaatttcttttatgttgatttggataatcggaggagatcgttgaataggcgaactgaccgtgctgcatcacaaccggtcgtgtacacaatcatttttgcagaatgtgggtgacgtacggtgtgtgacaatcagaaaaatctgacttttttttaaagatgcggacatccctctaaatattttttcaagaaattgtgagcgtgttggggattaaacatagaacctcggagttgaaactacacaccacttaccgctacactatcaaatgcatctcctactcttatcgtatcaatgtgcttggtagagccaaaacattggataggcatgtacatgaaatgtgctttcaaatcataaatttgacacgagtgttcgtatttatagctaattattctttcaatggtaggcgatgtacccgtcgacagcgatacgcccgtggtgacttcgttaatctcaagatatactgacccagtctttcggatgtcctcatatgagtagggtgtgcattcataaacggatgagtgtgcgtgtgttatgagcgtctacatttgtactgtgtttatagaaaaaactttggataggcataaacatgaaaggagcccccatgtgatatttacgtctcgcgtgggagcaacacaccctagcaaggattgcgtggtgccaccaggacatccgtttctatctctttttgcatctcttttctcaactcaacgtacacgcgtaagagttggttttaactttttttcgtccaaattgctgaaattgccaaataggacattacatgtccaatgagtccctccaaactccgttggcaaattgcaacttttgcaaatcaacctgtacatcgtacaccacctgtatatatagacagaagcgcacataggacagatagctagaaagaaagaaataaagcatatacttttaagcaaaaacaaatgtaaagagcatgtcaccttgtcgattctctatggtgatagggtccagggcaatgccatgtcatgctatcttatccctgtgctttgcacacagctttttcaccaaatccctgcaagaatcctcctataaatacccacccaattgatccatcaatttcccattcctttgtgttacattcttgaatgtcgctcgcagtgacattagcattccggtactgttggtaaaatggaagacgccaaaaacataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttgtgagtatttctgtctgatttctttcgagttaacgaaatgttcttaatgtttctttagacagatgcacatatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtaagcaccctcgccatcagacccaaagggaatgacgtatttaatttttaaggtgaattgctcaacagtatgaacatttcgcagcctaccgtagtgtttgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaaaaattaccaataatccagaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacatctcatctacctcccggttttaatgaatacgattttgtaccagagtcctttgatcgtgacaaaacaattgcactgataatgaattcctctggatctactgggttacctaagggtgtggcccttccgcatagaactgcctgcgtcagattctcgcatgccaggtatgtcgtataacaagagattaagtaatgttgctacacacattgtagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccattccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaagaagagctgtttttacgatcccttcaggattacaaaattcaaagtgcgttgctagtaccaaccctattttcattcttcgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctgggggcgcacctctttcgaaagaagtcggggaagcggttgcaaaacggtgagttaagcgcattgctagtatttcaaggctctaaaacggcgcgtagcttccatcttccagggatacgacaaggatatgggctcactgagactacatcagctattctgattacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggataccgggaaaacgctgggcgttaatcagagaggcgaattatgtgtcagaggacctatgattatgtccggttatgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaacacttcttcatagttgaccgcttgaagtctttaattaaatacaaaggatatcaggtaatgaagatttttacatgcacacacgctacaatacctgtaggtggcccccgctgaattggaatcgatattgttacaacaccccaacatcttcgacgcgggcgtggcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtaaatgaattcgttttacgttactcgtactacaattcttttcataggtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcataaaggccaagaagggcggaaagtccaaattgtaaaatgtaactgtattcagcgatgacgaaattcttagctattgtaatattatatgcaaattgatgaatggtaattttgtaattgtgggtcactgtactattttaacgaataataaaatcaggtataggtaactaaacgga；SEQ ID No.4。
furthermore, the reporter gene of the promoter SRN1 containing the nucleotide sequence shown in SEQ ID No.1 is expression vector proSRN of GFP, SRN1-GFP, the nucleotide sequence of which is as follows:
tggatatatatcttcctatatattattctctttgtctataactatatactatttgtcatgaaactttgtttctctttttttcttttcttgattgtttaaataaaaaaaaaacttaatagggttggattttttttggggaaaatgaaagaaccctattgctaacgtgcgtggattgaggaaggagagggttatatatggaggatgagatggtataattagagaagaggtgtgaggcgaggaaataggcaagaaaaagctctgggttttttttttgtgtgtgtttgtgtgatttaattattggtggtgaagaagcttgtaagaacttgtgtgccatcaagtgacattactttgtttttttattgtgtaatatttggcgctctattctttgtagggagagacagggcaaagggttagttcaaattaataattcctgttgatcattttttttagattaattgatttttattaattcagcctctgtatccacgaaggatatacacagccattttttttaggaatacacatattattgtattataaacacctctcaaacaaagattgaaaaggagataaacacctctcaaaggtctaattggattcaattcgtcctccagtatatcccgggattggacactgtcatcgacgtcgtcctatttctctgaagctgaaagataaagaccacccagatgaatcacaaattcgtcgaaaccgatgaaccaaattaaatgggaaaattcttcatctaagttcatacagaaaaaggacctgggtcttttcatcacgagctttgaaaagattgtagacctccgagtgatcataacacttggccatcagctggtacagctagctttgggattctaggcgaaaacggaattaaatcacaaactgataaacaaaatgcaaaaatttgaatttcttttatgttgatttggataatcggaggagatcgttgaataggcgaactgaccgtgctgcatcacaaccggtcgtgtacacaatcatttttgcagaatgtgggtgacgtacggtgtgtgacaatcagaaaaatctgacttttttttaaagatgcggacatccctctaaatattttttcaagaaattgtgagcgtgttggggattaaacatagaacctcggagttgaaactacacaccacttaccgctacactatcaaatgcatctcctactcttatcgtatcaatgtgcttggtagagccaaaacattggataggcatgtacatgaaatgtgctttcaaatcataaatttgacacgagtgttcgtatttatagctaattattctttcaatggtaggcgatgtacccgtcgacagcgatacgcccgtggtgacttcgttaatctcaagatatactgacccagtctttcggatgtcctcatatgagtagggtgtgcattcataaacggatgagtgtgcgtgtgttatgagcgtctacatttgtactgtgtttatagaaaaaactttggataggcataaacatgaaaggagcccccatgtgatatttacgtctcgcgtgggagcaacacaccctagcaaggattgcgtggtgccaccaggacatccgtttctatctctttttgcatctcttttctcaactcaacgtacacgcgtaagagttggttttaactttttttcgtccaaattgctgaaattgccaaataggacattacatgtccaatgagtccctccaaactccgttggcaaattgcaacttttgcaaatcaacctgtacatcgtacaccacctgtatatatagacagaagcgcacataggacagatagctagaaagaaagaaataaagcatatacttttaagcaaaaacaaatgtaaagagcatgtcaccttgtcgattctctatggtgatagggtccagggcaatgccatgtcatgctatcttatccctgtgctttgcacacagctttttcaccaaatccctgcaagaatcctcctataaatacccacccaattgatccatcaatttcccatggcgatgacaccgcagctagcattttctcgcatgcctccagggtttcggttccagccgacggacgagcagcttgtcgtcgactacttgcagaggcgtaccgctgcgcagccatgcgttactcccgacatcaccgatatcgacgtttacaacgtcgacccgtggcagcttccagccatggcgatgtatggatcggatcatgaccggtacttcttcacgatggcggcccgagaggcgcaggccagacgaacgacaccgtcgggtttctggaagcccaccggcacaaagaagacgatcttcgtcgtcgccggtgggcatgaggtgcccaccgccgtcaagaggaggttcgtcttctacctcggccaccaccaaccatcgggcagcaacaacaacaacaaaacatcatggatcatgcatgagtaccgtctcatgaactctccaagagcggcagtgccgtcgtcttcttcggtgaatcgtcttcccactgatgatctcacggaagagatggtgctgtgtaggatctccaacaaggacctgcctaaaccacccttcatccacaacagcttgttgcagttctcttcagtggggttgaatggtgatgggtataattacttgatccttgatcaccttgagcctccagcaatggagtatcctaatgttggcattggtaatgttgatgatgctgctgctggtactgatgatccgggtgaccttgatgaggagattgatgatagcatgcaaagaaaccatggtggcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa；SEQ ID No.5。
the application of a promoter SRN1 in efficiently starting the expression of a target gene under the induction of sugar.
Furthermore, the SRN1 promoter can drive the detection of the target gene at the transcription level and the protein level in the transgenic rice leaves.
Further, the promoter SRN1 drives the optical detection of GFP in the root cells of the transgenic rice.
According to the technical scheme, compared with the prior art, the invention has the following beneficial effects: the promoter SRN1 belongs to a tissue-specific promoter induced by sucrose and glucose, and has important application value in the field of plant genetic engineering and the research of conduction mechanisms of sugar signal molecules in organisms. The promoter SRN1 provides a tool for directionally expressing genes for important agronomic characters of rice or other grain crops and genetic engineering breeding for stress, and can be used for indicating the level of soluble sugar in plants in scientific research.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a diagram showing a functional annotation of cis-acting elements in rice promoter SRN1 in example 1 of the present invention;
FIG. 2 is a drawing showing a map of a process vector pCAMBIA1300 in example 2 of the present invention;
FIG. 3 is a diagram showing the response of root tip cells of transgenic plants to sucrose and glucose expression in example 3 of the present invention;
FIG. 4 is a diagram showing the induction of SRN1 gene at the transcriptional and translational levels in response to sucrose and glucose in example 4 of the present invention; wherein A is a relative transcription level graph, B is a relative SRN1-GFP expression quantity graph, and C is a Western blot detection result;
FIG. 5 is a graph showing the expression level of SRN1 gene in leaf blades in response to sugar in tissues and the LUC activity index measured by a multifunctional microplate reader under different sugar treatments in example 5 of the present invention; wherein A is the level expression of sugar in tissues, B is the relative amount of fluorescein, and C is a Western blot detection result.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The medicament required by the embodiment of the invention is a conventional experimental medicament purchased from a commercially available channel; the experimental methods not mentioned in the examples are conventional experimental methods, and are not described in detail herein.
Example 1: sequence analysis of rice promoter SRN1
Plant promoter prediction analysis site PlantCARE ()http:// bioinformatics.psb.ugent.be/webtools/plantcare/) And New PLACE (https:// www.dna.affrc.go.jp/PLACE/) The promoter region of the SRN gene of 2000bp (i.e., the promoter SRN1) was analyzed and organized by cis-acting elements, and the results are shown in FIG. 1 and Table 1.
TABLE 1 sequence information annotation of cis-acting elements in the Rice promoter SRN1
Figure BDA0003035408240000051
Figure BDA0003035408240000061
As can be seen from FIG. 1 and Table 1, the promoter region of the SRN gene of 2000bp (i.e., the promoter SRN1) has 14 cis-acting elements involved in 8 response expressions, and 74% of the cis-acting elements participate in the sugar response and light response processes. Because of the great correlation between sugar content and illumination state in plants, the above results indicate that the promoter SRN1 (i.e., SRN1 gene) may be expressed under sugar induction and participate in biological processes related to sugar signals.
Example 2: construction and transformation of rice proSRN1 SRN1-GFP recombinant vector
(1) Rice Nip genome DNA extracted by a CTAB method.
(2) The rice Nip cDNA is used as a template for amplifying SRN gene coding sequences, and the primer sequences are as follows:
SRN F:tcaccaaatccctgcaagaaatggtgagcaagggcgaggag；SEQ ID No.6；
SRN R:ctgtacatggtagatcttgcgaagatctaccatgtacagctcgt；SEQ ID No.7。
(3) a promoter SRN1 primer is designed according to a 2000bp sequence upstream of an ATG (transcription initiation site) of an SRN gene found on an RGAP (http:// rice. plant biology. msu. edu /) website. The promoter SRN1 was amplified using the high fidelity enzyme KOD FX, with the following primer sequences:
SRN1pro F1：tctctagaactagtggatccatggcgatgacaccgcagct；SEQ ID No.2；
SRN1pro R1：ataagcttgatatcgaattcctagccaccatggtttct；SEQ ID No.3。
(4) the GFP vector was used as a template for amplifying the coding sequence of the GFP gene. The GFP gene coding sequence was amplified by the high fidelity enzyme KOD FX with the following primer sequences:
GFP F1:tcaccaaatccctgcaagaaatggtgagcaagggcgaggag；SEQ ID No.8；
GFP R1:ctgtacatggtagatcttgcgaagatctaccatgtacagctcgt；SEQ ID No.9。
(5) and finally, connecting with the pCAMBIA1300 (the map is shown in figure 2) after the KpnI and BamHI enzyme digestion treatment by a homologous recombination method, transforming the connection product into competent cells, coating the competent cells on an LB solid plate with corresponding resistance, identifying and screening positive engineering bacteria by colony PCR, extracting plasmids and carrying out sequencing verification. Finally, the proSRN1 is successfully constructed, and the sequence of the SRN1-GFP recombinant vector is shown as SEQ ID No. 5. And the positive transformed seedling is obtained by transforming the positive transformed seedling into the callus of the Nipponbare rice by an agrobacterium-mediated method.
Example 3: observation of expression of sugar-induced rice SRN1 gene (promoter SRN1) under fluorescent microscope
The pro35s comprises the following steps:
(1) promoter 35s primers were designed based on the 35s promoter sequence found on the NCBI (http:// https:// www.ncbi.nlm.nih.gov/nuccore/AF234297/) website. The promoter 35S was amplified using the high fidelity enzyme KOD FX, with the following primer sequences:
35s pro F：acgaattcgagctcggtacccatggagtcaaagattcaa；SEQ ID No.10；
35s pro R：agtcccccgtgttctctccaaatgaa；SEQ ID No.11。
(2) the GFP vector was used as a template for amplifying the coding sequence of the GFP gene. The GFP gene coding sequence was amplified by the high fidelity enzyme KOD FX with the following primer sequences:
GFP F2:agtcccccgtgttctctatgacaccgcagcta；SEQ ID No.12；
GFP R2:ctgtacatggtagatcttgcgaagatctaccatgtacagctc；SEQ ID No.13。
(3) and finally, connecting with the pCAMBIA1300 (the map is shown in figure 2) after the KpnI and BamHI enzyme digestion treatment by a homologous recombination method, transforming the connection product into competent cells, coating the competent cells on an LB solid plate with corresponding resistance, identifying and screening positive engineering bacteria by colony PCR, extracting plasmids and carrying out sequencing verification. Finally, the pro35s is successfully constructed, the sequence of the GFP recombinant vector is shown as SEQ ID No. 14. And the positive transformed seedling is obtained by transforming the positive transformed seedling into the callus of the Nipponbare rice by an agrobacterium-mediated method.
catggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacgggggactatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa；SEQ ID No.14。
15-day proSRN1:: SRN1-GFP and pro35s:: T2 generation seedlings of GFP cultured in a light incubator (a rice total nutrient solution (a specific formula refers to a rice nutrient solution formula recommended by international rice), 28 ℃, 12h of light and 12h of dark) are respectively treated as follows:
processing for 12h and 24h under dark conditions respectively.
② adding sucrose with the final concentration of 5mM, glucose or isomaltulose as a substitute of sucrose into the rice complete nutrient solution of T2 generation seedlings under the condition of illumination for 12h and 24h respectively.
③ T2 generation seedlings (control group under illumination) under illumination were treated without sugar solution.
To exclude the effect of plant rhythm, the experiment was designed such that all treatments were terminated at the same time point and root tip tissue was taken to observe the fluorescence signal intensity under a confocal laser microscope, and the results are shown in fig. 3. The result shows that the fluorescent signal in the T2 generation seedling root tip of SRN1-GFP in dark treatment is obviously weakened compared with that in a control group in an illumination environment; in the sucrose and glucose treated group under light, the fluorescence signal in the root tip is obviously enhanced compared with the control group under the illumination environment, and the fluorescence signal is strongest after the sucrose and glucose treated group under light is treated for 24 hours. Isomaltulose, a substitute for sucrose, did not enhance the fluorescence signal, i.e., isomaltulose administered externally did not induce expression of SRN1 gene. Positive control pro35s T2 seedlings of GFP did not show significant differences in fluorescence signal among the treatment groups. The above results demonstrate that the SRN1 gene responds to sugar-induced expression and is inhibited by sugar starvation, especially with available sucrose and glucose.
Example 4: the rice SRN1 gene is induced to express by exogenous sugar at the level of transcription and translation
The 15-day indigenous fine and proSRN1 (SRN 1-GFP) T2 generation seedlings growing in a light incubator (rice complete nutrient solution, 28 ℃, 12h of light/12 h of dark) are respectively transferred to a light incubator (28 ℃) to be cultured for 36h, and leaves are taken at intervals of 6h and stored at-80 ℃ for later use. Adding sucrose, glucose or sucrose substitute isomaltulose with final concentration of 10mM into the rice total nutrient solution after 36h, continuously culturing in a lightless incubator (28 deg.C) for 36h, and taking leaves at intervals of 6h and storing at-80 deg.C for use. The expression level of SRN1 gene is detected by extracting and reverse transcribing sample RNA to obtain cDNA and qRT-PCR, and the specific method is as follows:
fresh leaf samples were taken and RNA was extracted by Trizol method. cDNA was synthesized using First Strand cDNA Synthesis Kit Rever Tra Ace-alpha, reverse transcription Kit of TOYOBO. DEPC. H for synthesized first strand cDNA2O diluted to 50. mu.L was used for molecular experiments such as cloning. Quantitative real-time fluorescence qPCR (quantitative PCR) reaction Using the assist of Shanghai san Biotech Ltd
Figure BDA0003035408240000081
Power qPCR SYBR Green Master Mix。
The 10 μ L system included: mu.L cDNA, 5. mu.L SYBR Green Master Mix, 0.2. mu.L 10. mu.M Primer F (forward), 0.2. mu.L 10. mu.M Primer R (reverse), 3.6. mu.L ddH2O。
The amplification procedure was: the reaction is carried out in a fluorescence quantitative PCR instrument for 40 cycles of 95 ℃ for 3mins, 95 ℃ for 10s, 60 ℃ for 30s and 72 ℃ for 15 s. The Ubiquitin (LOC _ Os03g13170) gene was used as an internal reference, and the relative expression level of the gene was calculated by 2-. DELTA.CT.
The primer sequence for quantitatively detecting the SRN1 expression quantity is as follows:
SRN1-qRT F：ttcggtgaatcgtcttccca；SEQ ID No.15；
SRN1-qRT R：taggcaggtccttgttggag；SEQ ID No.16。
the results are shown in FIG. 4. The result shows that as the Nipponbare seedlings are continuously cultured in the dark, the sugar in the cells is continuously consumed and can not be supplemented by photosynthesis, namely, the expression level of the SRN1 gene is rapidly reduced along with the reduction of the carbon source and the sugar on the transcription level; after the exogenous sucrose and glucose are added for supplementation, the expression amount is rapidly recovered, but the addition of isomaltulose as a substitute for sucrose does not recover the expression amount of SRN1 gene.
We found that the expression change trend of SRN1 protein during sugar starvation and exogenous sugar addition is consistent with the trend of SRN1 gene at the transcription level during the process after Western blot detection after extracting total protein of T2 seedling samples of proSRN1 & lt: SRN1-GFP (shown in FIG. 4).
Example 5: expression of rice SRN1 gene induced by tissue endogenous sugar level
Nip rice and proSRN1, namely, the T2 generation sword leaves of SRN1-GFP, are taken every 3h under the natural environment of a clear field. The collected Nip sword leaf is immediately used for RNA extraction and reverse transcription to obtain cDNA and qRT-PCR is used for detecting the rhythm expression pattern of the SRN1 gene. And simultaneously measuring the contents of sucrose, soluble sugar and starch by using Nip sword leaves collected at each time point, wherein the NSC content is equal to the content of the starch plus the content of the soluble sugar. Total protein was extracted immediately from harvested proSRN1, SRN1-GFP flag leaf, and the pattern of expression of SRN1 rhythms was examined by western blot. As shown in FIG. 5, the content of soluble sugars and starches in wild-type leaves was highest at 12 am and lowest at about 3 am. The expression of SRN1 induced by the endogenous sugar in rice tissue is concluded that the SRN1 gene has consistent expression trend of transcription level and protein level in rhythm in one day and the change trend of the content of the endogenous sugar in tissue.
Furthermore, we used 10mM sucrose, glucose or isomaltulose as a substitute for sucrose as an effector to detect the expression level of the reporter gene proSRN1:: LUC in rice protoplasts using the dual-luciferase protoplast transformation system. The specific method comprises the following steps:
the Firefly Luciferase (Firefly Luciferase) expression element carried on the p190LUC vector can be used as a reporter gene. In this experiment, the p190LUC vector was linearized by HindIII and BglI digestion. Using genome DNA of Nip as template, amplifying promoter fragment with 1.5kb length by using primer with recombination adaptor, connecting the promoter fragment to p190LUC carrier by means of homologous recombination method and transforming the recombinant plasmid into Escherichia coli DH5 alpha competent cell. And then, selecting positive clones for sequencing verification, and if the sequencing is completed and the sequencing is correct, successfully constructing the vector. High quality recombinant and empty plasmids were extracted in large quantities using the QIAGEN Plasmid Maxi Kit.
The extracted high-concentration recombinant plasmids are respectively transformed into rice protoplast cells by various different reaction combinations, and each plasmid combination is set for 6 times of repetition. The rLUC vector containing the Renilla Luciferase expression element was used as an internal control in the experiment by using Promega
Figure BDA0003035408240000091
The Reporter Assay System kit detects luciferase activity of different reaction combinations on a Promega GLOMAX instrument and records the ratio of firefly luciferase/Ren luciferase (Luc/Ren).
The results are shown in FIG. 5, and report gene proSRN1 shows that transcription of LUC can be significantly activated by sucrose and glucose, and cannot be activated and expressed by isomaltulose, which indicates that sucrose and glucose can directly activate transcription of SRN1 gene, i.e. SRN1 gene promoter is induced and expressed by sucrose and glucose.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> institute of Rice research in China
<120> rice sugar-induced promoter SRN1 and application thereof
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1999
<212> DNA
<213> Artificial Sequence
<400> 1
tggatatata tcttcctata tattattctc tttgtctata actatatact atttgtcatg 60
aaactttgtt tctctttttt tcttttcttg attgtttaaa taaaaaaaaa acttaatagg 120
gttggatttt ttttggggaa aatgaaagaa ccctattgct aacgtgcgtg gattgaggaa 180
ggagagggtt atatatggag gatgagatgg tataattaga gaagaggtgt gaggcgagga 240
aataggcaag aaaaagctct gggttttttt tttgtgtgtg tttgtgtgat ttaattattg 300
gtggtgaaga agcttgtaag aacttgtgtg ccatcaagtg acattacttt gtttttttat 360
tgtgtaatat ttggcgctct attctttgta gggagagaca gggcaaaggg ttagttcaaa 420
ttaataattc ctgttgatca ttttttttag attaattgat ttttattaat tcagcctctg 480
tatccacgaa ggatatacac agccattttt tttaggaata cacatattat tgtattataa 540
acacctctca aacaaagatt gaaaaggaga taaacacctc tcaaaggtct aattggattc 600
aattcgtcct ccagtatatc ccgggattgg acactgtcat cgacgtcgtc ctatttctct 660
gaagctgaaa gataaagacc acccagatga atcacaaatt cgtcgaaacc gatgaaccaa 720
attaaatggg aaaattcttc atctaagttc atacagaaaa aggacctggg tcttttcatc 780
acgagctttg aaaagattgt agacctccga gtgatcataa cacttggcca tcagctggta 840
cagctagctt tgggattcta ggcgaaaacg gaattaaatc acaaactgat aaacaaaatg 900
caaaaatttg aatttctttt atgttgattt ggataatcgg aggagatcgt tgaataggcg 960
aactgaccgt gctgcatcac aaccggtcgt gtacacaatc atttttgcag aatgtgggtg 1020
acgtacggtg tgtgacaatc agaaaaatct gacttttttt taaagatgcg gacatccctc 1080
taaatatttt ttcaagaaat tgtgagcgtg ttggggatta aacatagaac ctcggagttg 1140
aaactacaca ccacttaccg ctacactatc aaatgcatct cctactctta tcgtatcaat 1200
gtgcttggta gagccaaaac attggatagg catgtacatg aaatgtgctt tcaaatcata 1260
aatttgacac gagtgttcgt atttatagct aattattctt tcaatggtag gcgatgtacc 1320
cgtcgacagc gatacgcccg tggtgacttc gttaatctca agatatactg acccagtctt 1380
tcggatgtcc tcatatgagt agggtgtgca ttcataaacg gatgagtgtg cgtgtgttat 1440
gagcgtctac atttgtactg tgtttataga aaaaactttg gataggcata aacatgaaag 1500
gagcccccat gtgatattta cgtctcgcgt gggagcaaca caccctagca aggattgcgt 1560
ggtgccacca ggacatccgt ttctatctct ttttgcatct cttttctcaa ctcaacgtac 1620
acgcgtaaga gttggtttta actttttttc gtccaaattg ctgaaattgc caaataggac 1680
attacatgtc caatgagtcc ctccaaactc cgttggcaaa ttgcaacttt tgcaaatcaa 1740
cctgtacatc gtacaccacc tgtatatata gacagaagcg cacataggac agatagctag 1800
aaagaaagaa ataaagcata tacttttaag caaaaacaaa tgtaaagagc atgtcacctt 1860
gtcgattctc tatggtgata gggtccaggg caatgccatg tcatgctatc ttatccctgt 1920
gctttgcaca cagctttttc accaaatccc tgcaagaatc ctcctataaa tacccaccca 1980
attgatccat caatttccc 1999
<210> 2
<211> 40
<212> DNA
<213> Artificial Sequence
<400> 2
tctctagaac tagtggatcc atggcgatga caccgcagct 40
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 3
ataagcttga tatcgaattc ctagccacca tggtttct 38
<210> 4
<211> 4153
<212> DNA
<213> Artificial Sequence
<400> 4
tggatatata tcttcctata tattattctc tttgtctata actatatact atttgtcatg 60
aaactttgtt tctctttttt tcttttcttg attgtttaaa taaaaaaaaa acttaatagg 120
gttggatttt ttttggggaa aatgaaagaa ccctattgct aacgtgcgtg gattgaggaa 180
ggagagggtt atatatggag gatgagatgg tataattaga gaagaggtgt gaggcgagga 240
aataggcaag aaaaagctct gggttttttt tttgtgtgtg tttgtgtgat ttaattattg 300
gtggtgaaga agcttgtaag aacttgtgtg ccatcaagtg acattacttt gtttttttat 360
tgtgtaatat ttggcgctct attctttgta gggagagaca gggcaaaggg ttagttcaaa 420
ttaataattc ctgttgatca ttttttttag attaattgat ttttattaat tcagcctctg 480
tatccacgaa ggatatacac agccattttt tttaggaata cacatattat tgtattataa 540
acacctctca aacaaagatt gaaaaggaga taaacacctc tcaaaggtct aattggattc 600
aattcgtcct ccagtatatc ccgggattgg acactgtcat cgacgtcgtc ctatttctct 660
gaagctgaaa gataaagacc acccagatga atcacaaatt cgtcgaaacc gatgaaccaa 720
attaaatggg aaaattcttc atctaagttc atacagaaaa aggacctggg tcttttcatc 780
acgagctttg aaaagattgt agacctccga gtgatcataa cacttggcca tcagctggta 840
cagctagctt tgggattcta ggcgaaaacg gaattaaatc acaaactgat aaacaaaatg 900
caaaaatttg aatttctttt atgttgattt ggataatcgg aggagatcgt tgaataggcg 960
aactgaccgt gctgcatcac aaccggtcgt gtacacaatc atttttgcag aatgtgggtg 1020
acgtacggtg tgtgacaatc agaaaaatct gacttttttt taaagatgcg gacatccctc 1080
taaatatttt ttcaagaaat tgtgagcgtg ttggggatta aacatagaac ctcggagttg 1140
aaactacaca ccacttaccg ctacactatc aaatgcatct cctactctta tcgtatcaat 1200
gtgcttggta gagccaaaac attggatagg catgtacatg aaatgtgctt tcaaatcata 1260
aatttgacac gagtgttcgt atttatagct aattattctt tcaatggtag gcgatgtacc 1320
cgtcgacagc gatacgcccg tggtgacttc gttaatctca agatatactg acccagtctt 1380
tcggatgtcc tcatatgagt agggtgtgca ttcataaacg gatgagtgtg cgtgtgttat 1440
gagcgtctac atttgtactg tgtttataga aaaaactttg gataggcata aacatgaaag 1500
gagcccccat gtgatattta cgtctcgcgt gggagcaaca caccctagca aggattgcgt 1560
ggtgccacca ggacatccgt ttctatctct ttttgcatct cttttctcaa ctcaacgtac 1620
acgcgtaaga gttggtttta actttttttc gtccaaattg ctgaaattgc caaataggac 1680
attacatgtc caatgagtcc ctccaaactc cgttggcaaa ttgcaacttt tgcaaatcaa 1740
cctgtacatc gtacaccacc tgtatatata gacagaagcg cacataggac agatagctag 1800
aaagaaagaa ataaagcata tacttttaag caaaaacaaa tgtaaagagc atgtcacctt 1860
gtcgattctc tatggtgata gggtccaggg caatgccatg tcatgctatc ttatccctgt 1920
gctttgcaca cagctttttc accaaatccc tgcaagaatc ctcctataaa tacccaccca 1980
attgatccat caatttccca ttcctttgtg ttacattctt gaatgtcgct cgcagtgaca 2040
ttagcattcc ggtactgttg gtaaaatgga agacgccaaa aacataaaga aaggcccggc 2100
gccattctat cctctagagg atggaaccgc tggagagcaa ctgcataagg ctatgaagag 2160
atacgccctg gttcctggaa caattgcttt tgtgagtatt tctgtctgat ttctttcgag 2220
ttaacgaaat gttcttaatg tttctttaga cagatgcaca tatcgaggtg aacatcacgt 2280
acgcggaata cttcgaaatg tccgttcggt tggcagaagc tatgaaacga tatgggctga 2340
atacaaatca cagaatcgtc gtatgcagtg aaaactctct tcaattcttt atgccggtgt 2400
tgggcgcgtt atttatcgga gttgcagttg cgcccgcgaa cgacatttat aatgaacgta 2460
agcaccctcg ccatcagacc caaagggaat gacgtattta atttttaagg tgaattgctc 2520
aacagtatga acatttcgca gcctaccgta gtgtttgttt ccaaaaaggg gttgcaaaaa 2580
attttgaacg tgcaaaaaaa attaccaata atccagaaaa ttattatcat ggattctaaa 2640
acggattacc agggatttca gtcgatgtac acgttcgtca catctcatct acctcccggt 2700
tttaatgaat acgattttgt accagagtcc tttgatcgtg acaaaacaat tgcactgata 2760
atgaattcct ctggatctac tgggttacct aagggtgtgg cccttccgca tagaactgcc 2820
tgcgtcagat tctcgcatgc caggtatgtc gtataacaag agattaagta atgttgctac 2880
acacattgta gagatcctat ttttggcaat caaatcattc cggatactgc gattttaagt 2940
gttgttccat tccatcacgg ttttggaatg tttactacac tcggatattt gatatgtgga 3000
tttcgagtcg tcttaatgta tagatttgaa gaagagctgt ttttacgatc ccttcaggat 3060
tacaaaattc aaagtgcgtt gctagtacca accctatttt cattcttcgc caaaagcact 3120
ctgattgaca aatacgattt atctaattta cacgaaattg cttctggggg cgcacctctt 3180
tcgaaagaag tcggggaagc ggttgcaaaa cggtgagtta agcgcattgc tagtatttca 3240
aggctctaaa acggcgcgta gcttccatct tccagggata cgacaaggat atgggctcac 3300
tgagactaca tcagctattc tgattacacc cgagggggat gataaaccgg gcgcggtcgg 3360
taaagttgtt ccattttttg aagcgaaggt tgtggatctg gataccggga aaacgctggg 3420
cgttaatcag agaggcgaat tatgtgtcag aggacctatg attatgtccg gttatgtaaa 3480
caatccggaa gcgaccaacg ccttgattga caaggatgga tggctacatt ctggagacat 3540
agcttactgg gacgaagacg aacacttctt catagttgac cgcttgaagt ctttaattaa 3600
atacaaagga tatcaggtaa tgaagatttt tacatgcaca cacgctacaa tacctgtagg 3660
tggcccccgc tgaattggaa tcgatattgt tacaacaccc caacatcttc gacgcgggcg 3720
tggcaggtct tcccgacgat gacgccggtg aacttcccgc cgccgttgtt gttttggagc 3780
acggaaagac gatgacggaa aaagagatcg tggattacgt cgccagtaaa tgaattcgtt 3840
ttacgttact cgtactacaa ttcttttcat aggtcaagta acaaccgcga aaaagttgcg 3900
cggaggagtt gtgtttgtgg acgaagtacc gaaaggtctt accggaaaac tcgacgcaag 3960
aaaaatcaga gagatcctca taaaggccaa gaagggcgga aagtccaaat tgtaaaatgt 4020
aactgtattc agcgatgacg aaattcttag ctattgtaat attatatgca aattgatgaa 4080
tggtaatttt gtaattgtgg gtcactgtac tattttaacg aataataaaa tcaggtatag 4140
gtaactaaac gga 4153
<210> 5
<211> 3475
<212> DNA
<213> Artificial Sequence
<400> 5
tggatatata tcttcctata tattattctc tttgtctata actatatact atttgtcatg 60
aaactttgtt tctctttttt tcttttcttg attgtttaaa taaaaaaaaa acttaatagg 120
gttggatttt ttttggggaa aatgaaagaa ccctattgct aacgtgcgtg gattgaggaa 180
ggagagggtt atatatggag gatgagatgg tataattaga gaagaggtgt gaggcgagga 240
aataggcaag aaaaagctct gggttttttt tttgtgtgtg tttgtgtgat ttaattattg 300
gtggtgaaga agcttgtaag aacttgtgtg ccatcaagtg acattacttt gtttttttat 360
tgtgtaatat ttggcgctct attctttgta gggagagaca gggcaaaggg ttagttcaaa 420
ttaataattc ctgttgatca ttttttttag attaattgat ttttattaat tcagcctctg 480
tatccacgaa ggatatacac agccattttt tttaggaata cacatattat tgtattataa 540
acacctctca aacaaagatt gaaaaggaga taaacacctc tcaaaggtct aattggattc 600
aattcgtcct ccagtatatc ccgggattgg acactgtcat cgacgtcgtc ctatttctct 660
gaagctgaaa gataaagacc acccagatga atcacaaatt cgtcgaaacc gatgaaccaa 720
attaaatggg aaaattcttc atctaagttc atacagaaaa aggacctggg tcttttcatc 780
acgagctttg aaaagattgt agacctccga gtgatcataa cacttggcca tcagctggta 840
cagctagctt tgggattcta ggcgaaaacg gaattaaatc acaaactgat aaacaaaatg 900
caaaaatttg aatttctttt atgttgattt ggataatcgg aggagatcgt tgaataggcg 960
aactgaccgt gctgcatcac aaccggtcgt gtacacaatc atttttgcag aatgtgggtg 1020
acgtacggtg tgtgacaatc agaaaaatct gacttttttt taaagatgcg gacatccctc 1080
taaatatttt ttcaagaaat tgtgagcgtg ttggggatta aacatagaac ctcggagttg 1140
aaactacaca ccacttaccg ctacactatc aaatgcatct cctactctta tcgtatcaat 1200
gtgcttggta gagccaaaac attggatagg catgtacatg aaatgtgctt tcaaatcata 1260
aatttgacac gagtgttcgt atttatagct aattattctt tcaatggtag gcgatgtacc 1320
cgtcgacagc gatacgcccg tggtgacttc gttaatctca agatatactg acccagtctt 1380
tcggatgtcc tcatatgagt agggtgtgca ttcataaacg gatgagtgtg cgtgtgttat 1440
gagcgtctac atttgtactg tgtttataga aaaaactttg gataggcata aacatgaaag 1500
gagcccccat gtgatattta cgtctcgcgt gggagcaaca caccctagca aggattgcgt 1560
ggtgccacca ggacatccgt ttctatctct ttttgcatct cttttctcaa ctcaacgtac 1620
acgcgtaaga gttggtttta actttttttc gtccaaattg ctgaaattgc caaataggac 1680
attacatgtc caatgagtcc ctccaaactc cgttggcaaa ttgcaacttt tgcaaatcaa 1740
cctgtacatc gtacaccacc tgtatatata gacagaagcg cacataggac agatagctag 1800
aaagaaagaa ataaagcata tacttttaag caaaaacaaa tgtaaagagc atgtcacctt 1860
gtcgattctc tatggtgata gggtccaggg caatgccatg tcatgctatc ttatccctgt 1920
gctttgcaca cagctttttc accaaatccc tgcaagaatc ctcctataaa tacccaccca 1980
attgatccat caatttccca tggcgatgac accgcagcta gcattttctc gcatgcctcc 2040
agggtttcgg ttccagccga cggacgagca gcttgtcgtc gactacttgc agaggcgtac 2100
cgctgcgcag ccatgcgtta ctcccgacat caccgatatc gacgtttaca acgtcgaccc 2160
gtggcagctt ccagccatgg cgatgtatgg atcggatcat gaccggtact tcttcacgat 2220
ggcggcccga gaggcgcagg ccagacgaac gacaccgtcg ggtttctgga agcccaccgg 2280
cacaaagaag acgatcttcg tcgtcgccgg tgggcatgag gtgcccaccg ccgtcaagag 2340
gaggttcgtc ttctacctcg gccaccacca accatcgggc agcaacaaca acaacaaaac 2400
atcatggatc atgcatgagt accgtctcat gaactctcca agagcggcag tgccgtcgtc 2460
ttcttcggtg aatcgtcttc ccactgatga tctcacggaa gagatggtgc tgtgtaggat 2520
ctccaacaag gacctgccta aaccaccctt catccacaac agcttgttgc agttctcttc 2580
agtggggttg aatggtgatg ggtataatta cttgatcctt gatcaccttg agcctccagc 2640
aatggagtat cctaatgttg gcattggtaa tgttgatgat gctgctgctg gtactgatga 2700
tccgggtgac cttgatgagg agattgatga tagcatgcaa agaaaccatg gtggcatggt 2760
gagcaagggc gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga 2820
cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa 2880
gctgaccctg aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt 2940
gaccaccctg acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca 3000
cgacttcttc aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa 3060
ggacgacggc aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa 3120
ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct 3180
ggagtacaac tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat 3240
caaggtgaac ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca 3300
ctaccagcag aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct 3360
gagcacccag tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct 3420
ggagttcgtg accgccgccg ggatcactct cggcatggac gagctgtaca agtaa 3475
<210> 6
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 6
tcaccaaatc cctgcaagaa atggtgagca agggcgagga g 41
<210> 7
<211> 44
<212> DNA
<213> Artificial Sequence
<400> 7
ctgtacatgg tagatcttgc gaagatctac catgtacagc tcgt 44
<210> 8
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 8
tcaccaaatc cctgcaagaa atggtgagca agggcgagga g 41
<210> 9
<211> 44
<212> DNA
<213> Artificial Sequence
<400> 9
ctgtacatgg tagatcttgc gaagatctac catgtacagc tcgt 44
<210> 10
<211> 39
<212> DNA
<213> Artificial Sequence
<400> 10
acgaattcga gctcggtacc catggagtca aagattcaa 39
<210> 11
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 11
agtcccccgt gttctctcca aatgaa 26
<210> 12
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 12
agtcccccgt gttctctatg acaccgcagc ta 32
<210> 13
<211> 42
<212> DNA
<213> Artificial Sequence
<400> 13
ctgtacatgg tagatcttgc gaagatctac catgtacagc tc 42
<210> 14
<211> 1258
<212> DNA
<213> Artificial Sequence
<400> 14
catggagtca aagattcaaa tagaggacct aacagaactc gccgtaaaga ctggcgaaca 60
gttcatacag agtctcttac gactcaatga caagaagaaa atcttcgtca acatggtgga 120
gcacgacaca cttgtctact ccaaaaatat caaagataca gtctcagaag accaaagggc 180
aattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc attgcccagc 240
tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca aatgccatca 300
ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg 360
acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca 420
agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc actatccttc 480
gcaagaccct tcctctatat aaggaagttc atttcatttg gagagaacac gggggactat 540
ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg agctggacgg 600
cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg ccacctacgg 660
caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct ggcccaccct 720
cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc taccccgacc acatgaagca 780
gcacgacttc ttcaagtccg ccatgcccga aggctacgtc caggagcgca ccatcttctt 840
caaggacgac ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg acaccctggt 900
gaaccgcatc gagctgaagg gcatcgactt caaggaggac ggcaacatcc tggggcacaa 960
gctggagtac aactacaaca gccacaacgt ctatatcatg gccgacaagc agaagaacgg 1020
catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc agctcgccga 1080
ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg acaaccacta 1140
cctgagcacc cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc acatggtcct 1200
gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt acaagtaa 1258
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 15
ttcggtgaat cgtcttccca 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 16
taggcaggtc cttgttggag 20

Claims (5)

1. A rice sugar-inducible promoter SRN1 is characterized in that the nucleotide sequence of the rice sugar-inducible promoter SRN1 is shown as SEQ ID No. 1.
2. The rice sugar-inducible promoter SRN1 of claim 1, wherein the sugar is sucrose or glucose.
3. Primer pair for amplifying promoter SRN1, characterized in that the nucleotide sequence is as follows:
SRN1proF1：tctctagaactagtggatccatggcgatgacaccgcagct；SEQIDNo.2；
SRN1proR1：ataagcttgatatcgaattcctagccaccatggtttct；SEQIDNo.3。
4. a recombinant vector or a recombinant bacterium comprising the nucleotide sequence of the promoter SRN1 according to claim 1.
5. The use of the promoter SRN1 in promoting the expression of target gene under the induction of sugar, wherein the sugar is sucrose or glucose.
CN202110441890.XA 2021-04-23 2021-04-23 Rice sugar-induced promoter SRN1 and application thereof Active CN112980848B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110441890.XA CN112980848B (en) 2021-04-23 2021-04-23 Rice sugar-induced promoter SRN1 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110441890.XA CN112980848B (en) 2021-04-23 2021-04-23 Rice sugar-induced promoter SRN1 and application thereof

Publications (2)

Publication Number Publication Date
CN112980848A CN112980848A (en) 2021-06-18
CN112980848B true CN112980848B (en) 2022-03-18

Family

ID=76339993

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110441890.XA Active CN112980848B (en) 2021-04-23 2021-04-23 Rice sugar-induced promoter SRN1 and application thereof

Country Status (1)

Country Link
CN (1) CN112980848B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113832151B (en) * 2021-07-23 2023-07-04 电子科技大学 Cucumber endogenous promoter and application thereof
CN114717236B (en) * 2022-04-24 2023-10-10 西南大学 Cloning and application of inducible promoter added with exogenous sugar to capsicum

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000015812A1 (en) * 1998-09-10 2000-03-23 Nissan Chemical Industries, Ltd. Dna fragment having promoter function
CN106434658A (en) * 2016-09-22 2017-02-22 浙江农林大学 Rice MIR528 gene promoter and application thereof
CN106754925A (en) * 2016-12-21 2017-05-31 复旦大学 A kind of abscisic acid rapid induction promoter and its application
CN108795942A (en) * 2018-07-03 2018-11-13 安徽省农业科学院水稻研究所 A kind of rice external cause stress-inducing expression promoter Ps ubs3 and its application

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000015812A1 (en) * 1998-09-10 2000-03-23 Nissan Chemical Industries, Ltd. Dna fragment having promoter function
CN106434658A (en) * 2016-09-22 2017-02-22 浙江农林大学 Rice MIR528 gene promoter and application thereof
CN106754925A (en) * 2016-12-21 2017-05-31 复旦大学 A kind of abscisic acid rapid induction promoter and its application
CN108795942A (en) * 2018-07-03 2018-11-13 安徽省农业科学院水稻研究所 A kind of rice external cause stress-inducing expression promoter Ps ubs3 and its application

Also Published As

Publication number Publication date
CN112980848A (en) 2021-06-18

Similar Documents

Publication Publication Date Title
CN113881652B (en) Novel Cas enzymes and systems and applications
CN112980848B (en) Rice sugar-induced promoter SRN1 and application thereof
JP6578392B2 (en) Plant regulatory elements and uses thereof
CN104560742A (en) Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof
CN114106130B (en) Purple sweet potato anthocyanin synthesis regulation factor IbJOX4 and application thereof
CN110066323B (en) Microalgae light-harvesting protein NoHLR1 gene and application thereof
CN107652360B (en) Application of ABI5 protein and coding gene thereof in regulation and control of plant seed oxidation stress resistance
CN109266650B (en) Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter
CN111471699B (en) Method for regulating CPEB3 gene expression
CN113061171A (en) Rice blast resistant protein and gene, isolated nucleic acid and application thereof
CN107325161B (en) Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof
CN112574992A (en) Circular RNA over-expression cyclization vector DNA sequence and construction method and application thereof
CN107058324B (en) Rice root specific expression promoter POsRO4 and corresponding rice cultivation method
CN110791503B (en) Low-phosphorus inducible promoter and application thereof
CN112458080B (en) siRNA fishing method for obtaining lncRNA LOC157273
CN112813092B (en) Application of GbBCCP5 protein and coding gene thereof in regulation and control of biological oil content
CN111826376B (en) Plant promoter and application thereof
LU500221B1 (en) Sugar inducible promotors srn1 for rice and application thereof
CN109504680B (en) Salt stress inducible promoter, primer, expression vector and application thereof
CN103397048B (en) Method for cultivation of transgenic wheat resisting take-all and sharp eyespot and related biological materials thereof
CN101875935B (en) Identification of cotton fiber specific promoter GhTUA9
KR20080051437A (en) Stress specific promoters
KR20210003007A (en) Novel promoter HASP1 of Phaeodactylum tricornutum and signal peptide thereof and uses thereof
CN112322622B (en) Application of lncRNA17978 in improvement of disease resistance of rice
RU2812893C2 (en) Regulatory elements of plants and their use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant