CN110791523A

CN110791523A - Cotton drought-resistant related gene GhRCHY1 and application thereof

Info

Publication number: CN110791523A
Application number: CN201911281727.0A
Authority: CN
Inventors: 郭旺珍; 张大勇; 钮鑫
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2019-12-13
Filing date: 2019-12-13
Publication date: 2020-02-14
Anticipated expiration: 2039-12-13
Also published as: CN110791523B

Abstract

The invention discloses a cotton drought-resistant gene GhRCHY1 and application thereof, and belongs to the field of biotechnology application. The GhRCHY1 gene encodes a zinc finger protein. The invention provides a full-length ORF nucleotide sequence, a genome sequence and an amino acid sequence of GhRCHY1 in an allopetraploid upland cotton genetic standard line TM-1. The GhRCHY1 gene in cotton is obviously induced and expressed by abiotic stress. The over-expression transgenic cotton material is obtained by an agrobacterium-mediated genetic transformation method. The natural drought identification of the offspring homozygous transgenic line in the seedling stage shows that the drought resistance of the plant can be obviously improved by over-expressing the gene compared with a transgenic receptor material; meanwhile, the drought tolerance of the plant is obviously reduced by interfering the expression of virus-induced gene silencing (VIGS), which indicates that the gene plays an important role in the drought stress resisting process of cotton.

Description

Cotton drought-resistant related gene GhRCHY1 and application thereof

Technical Field

The invention belongs to the field of biotechnology application, and relates to a cotton GhRCHY1 gene and application thereof, wherein the gene codes a zinc finger protein. Through the analysis of a transcriptome data system under drought stress of cotton, the GhRCHY1 gene is found to be significantly up-regulated. The over-expression transgenic cotton material is obtained by an agrobacterium-mediated genetic transformation method. The natural drought identification of the progeny homozygous transgenic line in the seedling stage shows that compared with a transgenic receptor material, the drought tolerance of the plant can be obviously improved by over-expressing the gene, and the drought tolerance of the plant is obviously reduced by interfering the expression of virus-induced gene silencing (VIGS), which indicates that the gene plays an important role in the drought stress process of cotton.

Background

Abiotic stresses (including drought, high salt, low temperature, etc.) severely affect the growth and development of crops. This trend has been exacerbated by global water shortages, soil salinization, and frequent extreme weather in recent years (FAO, 2009). The adaptability to abiotic stress and the improvement of the environmental adaptability of crops are one of the requirements of new variety breeding at present. Cotton is an important economic crop worldwide, and China is a world-wide country for cotton production, consumption and import, and is also a world-wide trade for textile and clothing production, and plays an important role in cotton planting worldwide. However, the main cotton production area in China is also an important grain or other important economic crop production area, the contradiction of land competition between grain cotton and grain is prominent all the time, and the requirement on the cotton stress tolerance is further increased. Effectively solves the challenge, creates a new stress-resistant material and is a basis for cultivating new stress-resistant varieties. Therefore, key drought-tolerant gene resources are explored, measures such as genetic engineering and molecular breeding are utilized, and the traditional breeding technology is combined to create stress-resistant excellent germplasm resources, so that high-yield, high-quality and multi-resistant new varieties are cultivated, and the universality and stress-tolerant level of the new varieties are improved.

Zinc Finger proteins (ZFP, Zinc Finger Protein) are a class of transcription factors with "Finger-like" domains that were first discovered in the Xenopus transcription factor IIIA (TFIIIA) Protein by Klug and colleagues of Nobel prize winner. Zinc finger proteins can be classified into subtypes C2H2, C2HC, C2C2 and the like according to the number and positions of cysteine (C) and histidine (H) residues, are one of the main members of plant transcription factor families, and play various regulatory roles in plant stress response and development (Kim et al, 2001; Sakamoto et al, 2004; de Lorenzo et al, 2007; Xu et al, 2007). The functions of different members in the aspect of plant resistance formation are determined, and the method has important significance for regulating and controlling plant resistance and improving the plant resistance by using genetic engineering.

Zinc finger proteins (zinc finger proteins) are a class of transcription factors that bind zinc ions and fold into finger-like domains under the action of zinc ions. In 1985, a transcription factor containing repetitive zinc finger domains was first discovered in Xenopus oocytes by Miller (Miller et al, 1985). Zinc finger proteins are ubiquitous in eukaryotes, e.g., the human genome encodes about 2% of zinc finger proteins, primarily the TFIIIA double zinc finger type (Hoovirs et al, 1992). Zinc finger proteins have been isolated from Arabidopsis, rice, petunia, cotton, soybean, etc., and functional identification has been carried out, indicating that these genes are widely involved in stress response and growth and development regulation in plants (Kobayashi A et al, 1998; Sakamoto H et al, 2000; Kim J C et al, 2001; Yang et al, 2006). With the progress of research, it has been found that zinc finger proteins can also modulate the interaction between proteins, proteins and lipids (Matthews and Sunde, 2002; Matthews, 2007). Such proteins are usually combined with specific DNA sequences in the promoter or enhancer region of the target gene to regulate the expression of downstream genes and thus regulate various biological functions such as growth, hormone response, stress resistance, pathogenic response, etc. (Kasuga M, 1999; Singh K, 2002). Some zinc finger proteins are specific to plants, and the proteins have great influence on the growth development and stress tolerance of the plants. Current research results indicate that most zinc finger proteins are positive regulators of stress response (Wolfe et al, 2000; daohua et al, 2012; Chenchang winter et al, 2012).

Currently, a number of zinc finger protein genes have been identified from a variety of plants using molecular biology approaches. The results of various researches find that the zinc finger protein is related to the plant adaptation to abiotic stress, such as: sun et al (2010) research finds that transgenic rice plants over-expressing the rice ZFP179 gene have improved salt stress tolerance and are highly sensitive to ABA, and shows that the gene plays an important role in the plant salt stress response process; sultan et al (2007) report that a zinc finger protein Zat7 with an EAR motif plays a key role in the salt stress response process of Arabidopsis thaliana, and utilize a yeast two-hybrid technology to identify proteins WRKY70 and HATY interacting with Zat7, and clarify the action path of the protein in the salt tolerance process of Arabidopsis thaliana; davletova et al (2006) found that Arabidopsis Zat12 plays a central role in the signaling of active oxygen and abiotic stress; mittler et al (2006) found that Arabidopsis Zat10 plays dual roles of positive regulation and negative regulation simultaneously in the process of abiotic stress, and the tolerance of plants to external stress can be greatly improved by both overexpression and suppression of expression; sakamoto et al found that over-expressed plants of Arabidopsis AZF2 and STZ, although enhancing drought tolerance, showed a developmental delay indicating that they act as transcriptional repressors during development (Sakamoto et al, 2004); pan and the like separate a first zinc finger protein gene AhZFP1 from walnuts for the first time, and expression analysis shows that the gene is induced by salt stress (Pan et al, 2010); wang et al isolated the pine PSTZ gene, which transgenic tobacco enhanced tolerance to salt stress (Wang et al, 2002); liu et al isolated the DgZFP gene by RACE technology, and tobacco over-expressing the gene improved tolerance to salt stress, but growth was inhibited (Liu et al, 2010); martin et al (2009) isolated a poplar PtaZFP2 gene, expression analysis found that the gene plays a key role in regulation and control under mechanical damage such as tree bending and other abiotic factor stresses (Martin et al, 2009).

Cotton is a worldwide important commercial crop and cotton fiber is an important textile material. Guo Yinghui et al (2009) screen a new coding CCCH type zinc finger protein gene GhZFP1 by constructing a cotton salt stress cDNA library, and transfer the gene into tobacco, wherein the overexpression of the GhZFP1 gene obviously improves the salt tolerance and disease resistance of transgenic tobacco. The research obtains a GhRCHY1 gene for coding zinc finger protein, and the drought resistance of the cotton new material is obviously improved through transgenic over-expression. The zinc finger protein is shown to play a role in cotton stress resistance, and important candidate genes and regulatory elements are provided for improving cotton stress resistance gene engineering.

Disclosure of Invention

The invention aims to provide application of a cotton GhRCHY1 gene in improving the drought resistance of cotton and cultivating new cotton seeds. Transgenic over-expression cotton material is obtained by agrobacterium-mediated genetic transformation method. The natural drought identification of the offspring homozygous transgenic line in the seedling stage shows that the drought resistance of the plant can be obviously improved by over-expressing the gene compared with a transgenic receptor material. The gene is used as a target gene, and the GhRCHY1 gene is overexpressed by gene engineering methods such as transgenosis and the like, so that a new cotton germplasm which has good growth and development, normal cotton fiber yield and quality and remarkably improved resistance is cultivated and applied to production.

Another object of the present invention is to provide a method for improving drought resistance of cotton.

The invention also aims to provide a cotton GhRCHY1 gene, and provides a full-length ORF nucleotide sequence, a genome sequence and an amino acid sequence of the GhRCHY1 in an allopetraploid upland cotton genetic standard line TM-1.

The purpose of the invention is realized by the following technical scheme:

the GhRCHY1 gene shown in SEQ ID NO.1 or SEQ ID NO.2 is used in raising the drought resistance of cotton and breeding new cotton variety.

The above application, which consists in: the excess of the GhRCHY1 gene is used for improving the drought resistance in cotton. The GhRCHY1 gene is used as a target gene, and the GhRCHY1 gene is overexpressed in cotton by gene engineering methods such as an overexpression technology and the like, so that new cotton seeds which are normal in growth and development and remarkably improved in drought resistance are cultivated and applied to production.

A method for improving the drought resistance of cotton is to over-express GhRCHY1 gene with a nucleotide sequence shown as SEQ ID No.1 or SEQ ID No.2 in cotton.

A GhRCHY1 gene capable of obviously improving the drought resistance of cotton, and the gene has an ORF sequence shown as SEQ ID No.1 or a genome sequence shown as SEQ ID No. 2;

the protein coded by the GhRCHY1 gene with the nucleotide sequence shown as SEQ ID No.1 or SEQ ID No.2 has the amino acid sequence shown as SEQ ID No. 3.

A recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the GhRCHY1 gene.

The recombinant vector, the expression cassette, the transgenic cell line or the recombinant strain are applied to improving the drought resistance of cotton and cultivating new germplasm of cotton.

The new germplasm is a cotton new germplasm with obviously improved drought resistance.

The invention has the advantages that:

(1) the stable transgenic cotton material over-expressing GhRCHY1 is obtained through agrobacterium-mediated genetic transformation.

(2) The transgenic cotton with the overexpression of the GhRCHY1 is an excellent material for researching drought resistance change caused by genes and an adverse environment signal path and a molecular mechanism influenced by the change, the drought resistance of transgenic plants can be enhanced by the overexpression of the GhRCHY1, and the drought resistance is obviously reduced by interfering the expression.

Drawings

FIG. 1 GhRCHY1 induced expression analysis under different stresses

GhRCHY1 reached very significant induction from 2h on expression patterns of 0h,2h,4h,6h,10h,12h,24h, treated with 200mM NaCl and 20% PEG6000(g/100mL), respectively, drought and salt treatments, where a and indicates significance at p <0.05 and p <0.01 levels, respectively, compared to 0 h.

FIG. 2 identification of the GhRCHY1 activator protein domain

Through constructing the full-length coding sequence of the GhRCHY1 gene and 3 yeast two-hybrid vectors with different fragments deleted, the full-length sequence and the fragment 1 are found to have self-activating activity, and the other 2 fragments have no self-activating activity.

FIG. 3 subcellular localization analysis of GhRCHY1

Compared with the GFP empty carrier CK control, the GhRCHY1 fluorescence signal is mainly distributed on cell nucleus and cell membrane.

FIG. 4 creation and identification of GhRCHY1 gene-transferred cotton material

Amplification of the gene of interest, marker gene and reporter gene in the transgenic material. Respectively amplifying a target gene by using a 35S promoter (forward primer) -gene specific primer (reverse primer), wherein a target band is 1073 bp; detecting the marker gene by using a kana specific primer, wherein the target band is 720 bp; the reporter gene is GUS gene, GUS specific primer is used for amplification, and the target band is 576 bp. The Marker, the positive control and the negative control are respectively a molecular weight Marker (DL2000Plus), a plasmid positive control and a wild type negative control, R-1, R-2 and R-3 are respectively transgenic T5 generation over-expression pure lines, and each transgenic line randomly selects 2 single plants for drawing; the wild type is a transgenic receptor W0.

The quantitative primer is used for detecting the expression of GhRCHY1 in root and leaf tissues of over-expressed materials (R-1, R-2 and R-3), and the result shows that the expression of a target gene is obviously improved in the over-expressed materials compared with W0.

FIG. 5 drought resistance identification of GhRCHY1 gene-transferred cotton material

The GhRCHY1 is naturally drought-treated in the overexpression material (R-1, R-2 and R-3) and the control W0 in seedling stage, the W0 leaves begin to wilt while the overexpression material is still greener after 13 days of treatment, and the control W0 completely wilts to die after 2 days of rehydration while the overexpression material recovers better. The relative water content and water loss rate of the leaves are measured, and the over-expressed material has higher relative water content and slower water loss compared with a control. Wherein and represent significance at p <0.05 and p <0.01 levels, respectively, compared to 0 h.

FIG. 6 identification of drought resistance of VIGS plants

Compared with the control TRV2, the VIGS material TRV GhRCHY1 of GhRCHY1 shows drought sensitivity after natural drought treatment of 13 days, and the control recovers well after rehydration for 2 days, while the TRV GhRCHY1 wilts to death.

Detailed Description

The specific experimental methods not shown in the following examples can be carried out according to conventional methods. Such as the conditions described in Sambrook (Sambrook J.) and Russell (Russell D W.) in the molecular cloning instructions (scientific press, 2005) or according to the instructions of the manufacturers of biological reagents.

Example 1 analysis of GhRCHY1 Induction expression under different stresses

The real-time quantitative PCR method is adopted to detect the expression modes of the GhRCHY1 in the root tissue of the upland cotton genetic standard system TM-1 under different treatment conditions, and comprises the steps of respectively treating the root tissue with 200mM NaCl and 20% PEG6000 for 0h,2h,4h,6h,8h,10h,12h and 24h, and the following measures are taken to ensure the reliability of the detection result: digesting the extracted total RNA with amplification level DNase I to eliminate genomic DNA, taking out partial total RNA sample digested with DNase I to perform conventional PCR reaction, performing reverse transcription when no amplification band is generated, and cutting PCR product into gel, recovering and sequencing to verify whether the real-time quantitative PCR amplification band is GhRCHY 1. Primers for quantitative PCR were P1 and P2 (primers synthesized by shanghai bioengineering company):

P1：5-ATGCGGACATACAATTCA-3’，

P2：5-ATTTCTCCCAGACCTTTG-3’。

the histone cDNA of cotton is used as an internal reference, and the quantitative PCR primers are as follows (the primers are synthesized by Shanghai bioengineering company):

H-F (upstream primer): 5-AGACCACCAAGTACTACTGCAC-3'

H-R (downstream primer): 5-CCACCAATCTTGTACACATCC-3'

The experimental procedure was as follows: first, 1. mu.g of total RNA was added to amplification-grade DNase I (Sigma, USA) and left at room temperature for 30 minutes to remove genomic DNA contamination, and then stop buffer (50mM EDTA) was added and heated at 70 ℃ for 10 minutes to denature DNase I and RNA; then reverse transcription is carried out by adopting a reverse transcription kit of Bao bioengineering (Dalian) Limited company according to the kit instruction, 1 mu g of total RNA is taken from each sample, the reaction is carried out for 1 hour at 42 ℃, the sample is taken out after being heated for 10 minutes at 70 ℃, and the sample is placed on ice so as to lead reverse transcriptase to be alive; finally, 1 mul of the inverted transcription product is taken for semi-quantitative PCR amplification. This was done on a fluorescent quantitative PCR instrument Light Cycler 2.0 (Roche) using SYBR Green I dye. Data processing the relative expression level of gene was analyzed by the 2- Δ Δ cp method in Light Cycler 2.0. The PCR reaction conditions are as follows: 5s at 95 ℃,10 s at 60 ℃ and 20s at 72 ℃ for 40 cycles. The detection result shows that the expression of GhRCHY1 is induced by PEG and NaCl (figure 1).

Example 2 identification of GhRCHY1 activin Domain

Specific primers and 3 deletion sections with different sizes are designed according to a coding region (CDS) of GhRCHY1, and the primer sequences are respectively as follows:

pGBKT7-GhRCHY, forward primer:

5'ATGGCCATGGAGGCCGAATTCATGTCATTTTCAATGGAAGAAGTGG3'

reverse primer:

5'CGCTGCAGGTCGACTGGATCCTCAGCCTCGTGTTTGCCTAGT3'；

pGBKT7-GhRCHY-1, forward primer:

5'ATGGCCATGGAGGCCGAATTCATGTCATTTTCAATGGAAGAAGTGG3'

reverse primer:

5'CGCTGCAGGTCGACTGGATCCTCAACAGTCATGGTGCATCGC3'；

pGBKT7-GhRCHY-2, forward primer:

5'ATGGCCATGGAGGCCGAATTCATGCCCATATGCTTTGAGTTCTT3'

reverse primer:

5'CGCTGCAGGTCGACTGGATCCTCAGCCTCGTGTTTGCCTAGT3'；

pGBKT7-GhRCHY-3, forward primer:

5'ATGGCCATGGAGGCCGAATTCATGTCCAAATCGGTTTGTGACA3'

reverse primer: 5'CGCTGCAGGTCGACTGGATCCTCAGCCTCGTGTTTGCCTAGT 3'.

Amplifying the above 4 fragments and connecting into the known technical personnel, constructing the effect recombinant plasmid pGBKT7-GhRCHY1 which is translationally fused with BD (binding domain) by a yeast expression vector pGBKT7 (purchased by Clontech company), transferring into Saccharomyces cerevisiae Y187 by a lithium acetate precipitation method after sequencing verification, referring to the yeast transformation system specification of Clonetech company in the transformation step and simultaneously transferring into a response empty vector as a control, uniformly coating the plasmid on an SD/-Trp single-defect plate, screening positive transformants by combining colony PCR, inoculating the screened positive transformants into YPDA culture medium, culturing for 2-3 days by shake culture, uniformly coating the transformants on an SD/-Trp/-His/-Ade triple-defect plate, observing the growth condition of the transformants, selecting transformants, coating the transformants on an SD/-Trp/-Xgal chromogenic plate, carrying out galactosidase activity detection, and recording the result to find that the transformant fragment 1 and the other two fragments have transcription activity (figure 2).

Example 3 GhRCHY1 subcellular localization analysis

The subcellular localization expression vector was constructed by inserting SEQ ID NO.1 between Kpn1I and BamHI of pBINPLUS. GFP4 vector well known to those skilled in the art.

The primer sequences used were, forward primer:

5'ATTTACGAACGATAGGGTACCATGTCATTTTCAATGGAAGAAGTGG3'；

reverse primer:

5'GCCCTTGCTCACCATGGATCCGCCTCGTGTTTGCCTAGTATTGT3'。

pGFP4-GhRCHY1-GFP agrobacterium GV3101 is transformed by a freeze-thaw method, then tobacco epidermis is injected, the tobacco epidermis is cultured for 24 hours at 25 ℃, a GFP signal is observed by a laser confocal microscope (ZEISS LSM-510META, Germany), and the subcellular localization of the GFP is determined. As a result, the protein was found to be localized to the cell nucleus and the cell membrane (FIG. 3).

Example 4 creation and identification of GhRCHY1 Gene-transferred Cotton Material

A stable transgenic cotton plant is obtained by adopting an agrobacterium-mediated genetic transformation method, and DNA and mRNA levels are identified according to a promoter sequence, a reporter gene and a marker gene sequence carried on a vector.

The specific implementation steps are as follows: the SEQ ID NO.1 is inserted between XbaI and BamHI of pBI121 (derived from Escherichia coli) vector by using the technology known by the technicians in the field, an overexpression vector driven by CaMV35S constitutive expression promoter of GhRCHY1 gene is constructed, and the overexpression vector is transferred into cotton by an agrobacterium-mediated transformation method to obtain a transgenic strain with stable inheritance.

The DNA level was identified by a PCR method comprising:

【1】 Cotton genome DNA extraction method

Selecting plant leaves with strong GUS activity, extracting DNA, taking 1g of cotton leaf slices, adding liquid nitrogen, grinding into powder, transferring into a 50mL centrifuge tube, adding 5mL of extraction buffer (500mM NaCl; 50mM Tris/HCl, pH 8.0; 50mM EDTA, pH 8.0; 1% (v/v) β -mercaptoethanol), 0.6mL of 20% PVP (g/100mL) and 1mL of 10% SDS (g/100mL), mixing gently, incubating at 65 ℃ for 20 minutes, adding 1/10 volume of 5M KAC, centrifuging at 30 minutes and 4 ℃ at 15,000rpm for 10 minutes, sucking supernatant, adding 0.6 volume of isopropanol, mixing, incubating at10 minutes in an ice bath, centrifuging at 4 ℃ and 10,000rpm for 5 minutes, discarding supernatant, washing precipitate with 75% (v/v) ethanol, drying, adding 500uL of TE, dissolving, adding appropriate amount of RNase, incubating at 37 ℃ for 30 minutes, extracting with equal volume of phenol: isoamyl (25:24:1) and precipitating with equal volume of chloroform, adding dry ethanol, centrifuging at 632 rpm, adding equal volume of ethanol, precipitating at 52 min, adding equal volume of ethanol, centrifuging at 632 rpm, adding equal volume of ethanol, precipitating at 52 ℃ to a new dry tube, and centrifuging at 52 min, adding equal volume of ethanol, precipitating at 632, precipitating at 632, and precipitating.

TABLE 1 DNA extraction buffer preparation

TABLE 2 lysis buffer preparation

The solution is clear and can be stored at room temperature for 1-2 weeks, and β -Me (mercaptoethanol) is added before use.

【2】 PCR detection Process

1) Taking 2-3 tender leaves of the regenerated plantlets on an ultra-clean bench, adding 600 mu L of precooled and freshly prepared extraction buffer solution, and carrying out electric conversion grinding. Centrifuging at 5000rpm for 20min (4 deg.C), and discarding the supernatant;

2) adding 600 μ L of 65 deg.C preheated lysis buffer solution into the precipitate, water bathing at 65 deg.C for 30min, turning and mixing for 2-3 times;

3) to this was added 800. mu.l of chloroform/isoamyl alcohol (24: 1) the mixture was inverted more than 50 times, centrifuged at 9,000rpm for 20min (15 ℃), the supernatant was transferred to a 1.5mL centrifuge tube, 0.6 volume of pre-cooled isopropanol was added, slowly inverted 30 times, mixed, left to stand for 10min, at 9,000rpm, centrifuged for 10min (RT), the supernatant was discarded, 1mL of 70% ethanol was added to the precipitate for washing, and centrifuged at1,000 rpm for 2 min. Pouring out the supernatant, and air drying for 20 min;

4) add 30. mu.L of TE buffer, dissolve the DNA (4 ℃, 30min or more), and store.

(TE buffer: 10mM Tris/HCl (pH 8.0), 1mM EDTA (pH 8.0)).

The PCR detection of the regenerated cotton plant uses a specific primer matched with a 35S promoter and a target gene, and the sequence of the primer is as follows:

Forward：5'CGTAAGGGATGACGCACAAT 3'；

reverse: 5'CGGTTTCTACATCCCACTCTAAGCCA 3', the product size is 1073 bp.

Selection marker gene nptii primers:

Forward：5'GAGGCTATTCGGCTATGACTG 3'，

reverse: 5'TAGAAGGCGATGCGCTGCGA 3', the product size is 720 bp.

Reporter gene GUS primer:

Forward：5'GTGATGTCAGCGTTGAACTG 3'，

reverse: 5'GGTTTTTGTCACGCGCTATC3', the product size was 576 bp.

PCR reaction volume: (20ul)

The mRNA level detection is analyzed by qRT-PCR technology, the implementation steps, the implementation method and the used primers are the same as those in the specific example 1, and the detection result shows that the expression of GhRCHY1 in leaf tissues of wild type and over-expressed materials is extremely obviously different, and a stably transformed over-expressed plant is obtained (figure 4).

Example 5 drought resistance identification of GhRCHY1 transgenic cotton material

Under the condition of controlling soil quantity and water content to be consistent, carrying out natural drought treatment on transgenic plant lines and wild type seedlings with two leaves and one heart stage, photographing at regular intervals, and simultaneously sampling leaves before and after treatment to carry out quantitative detection on marker genes.

The method comprises the following specific steps: mixing culture soil and vermiculite in a ratio of 1:1 (volume ratio), baking in an oven at 100 ℃ for 4 hours, cooling the mixed culture soil to room temperature, mixing the mixed culture soil with water in a ratio of 7: 4, stirring uniformly, weighing about 130g after mixing, putting into a paper cup, quantitatively watering for 40-50 mL each time after seedling emergence, generally watering once every four days (as the case requires), starting to perform drought treatment without watering when the plants are in a two-leaf one-heart state, and showing a phenotype about 10 days. The detection results show that under the stress treatment of natural drought, the over-expressed material has obvious drought resistance compared with the wild type material, and can still recover growth after the drought treatment is rehydrated, while the wild type material can not continue to grow (figure 5).

Example 6 identification of drought resistance of VIGS plants

【1】 Construction of VIGS vector for candidate Gene

Viral vectors used for VIGS were pTRV1 and pTRV2, respectively, with cotton chlorophyll synthesis key gene (ghcia 1) as technical control (wangxiyu et al, 2014). Carrying out multiple sequence comparison analysis by using BioXM, finding out fragments with the size of about 200-300 bp of a specific region of a candidate gene, selecting enzyme cutting sites by using CE Design V1.03 software, and designing a recombinant primer, wherein the primer sequence is as follows:

a forward primer: 5'GTGAGTAAGGTTACCGAATTCTGTTCTGCCATGCGGACAT 3';

reverse primer: 5'CGTGAGCTCGGTACCGGATCCTCGCAATCGTTGCAAAGGA3'.

Cloning target fragment with upland cotton genetic standard system TM-1 leaf cDNA as template, recovering gel, and homologous recombinationKit (Vazyme) Rapid cloning technology the fragment of interest was ligated with the TRV2 vector. Then, the ligation product is transformed into Escherichia coli, and plasmid DNA is extracted after positive cloning and sequencing.

The connecting system of the kit is as follows:

ligation was performed at 37 ℃ for 30 min.

【2】 Agrobacterium transformation

1) Adding 0.1-1 mu g of plasmid DNA into 100 mu L of GV3101 agrobacterium competent cells (FCNCS, Nanjing), and carrying out ice bath for 30 min;

2) quickly freezing in liquid nitrogen for 5min, and immediately placing in water bath at 37 deg.C for 5 min;

3) taking out the centrifuge tube, adding 700 μ L LB into the ultra-clean bench, and performing shake culture at 28 deg.C and 220rpm for 3-5 h;

4) centrifuging at 4000rpm for 2min, pouring off excessive supernatant, and leaving about 100 μ L of supernatant to be fully suspended with the precipitate;

5) the bacterial liquid is coated on a solid LB culture medium containing rifampicin and antibiotics corresponding to the carrier, inverted culture is carried out for 2 days at 28 ℃, and bacterial colonies are visible;

6) picking positive monoclonals from the plate, culturing the monoclonals in 700 mu L of liquid culture medium containing corresponding antibiotics at the temperature of 28 ℃ for 1 day by a shaking table at 220 rpm;

7) PCR detecting positive clone with bacteria liquid, adding 30% of 50% glycerin and storing at-80 deg.C for use.

【3】 Preparation of agrobacterium inoculation bacterial liquid

1) The single colony of Agrobacterium GV3101, pTRV1, pTRV2 (negative control) and pTRV2: GhCLA1 (positive control) of the pTRV2 plasmid containing the target gene fragment preserved as described above were streaked on LB solid medium containing the corresponding antibiotics (Kan, 100. mu.g/mL, Rif, 50. mu.g/mL) and cultured at 28 ℃ for 2 days;

2) selecting single clones, respectively inoculating on LB liquid culture medium containing corresponding antibiotics (Kan, 100. mu.g/mL, Rif, 50. mu.g/mL), and performing shake culture at 28 deg.C and 200rpm for 16 h;

3) inoculating the bacterial liquid into LB liquid culture medium with the required amount for experiment according to the volume ratio of 1:100, respectively, and performing 28 DEG CShaking at 200rpm for about 12h, and culturing to obtain bacterial liquid OD₆₀₀About 0.8;

4) the cells were collected by centrifugation at 4000rpm for 10min and resuspended in 10mM MgCl₂10mM MES, 200. mu.M Microsyringone) to a final OD₆₀₀Is 2.0;

5) standing the re-suspension for 3h at room temperature in the dark, and then mixing TRV1 with TRV2 to obtain a mixture of the bacterium liquid 1: mixing at a ratio of 1(v/v), and injecting into cotton cotyledon.

【4】 Injection inoculation of agrobacterium liquid

1) The cotton planting and culturing method is characterized in that the specific operation is to mix nutrient soil: putting vermiculite into a disposable paper cup (three holes are punched at the bottom for water absorption) with a volume ratio of 2:1, placing the filled soil cup on a tray, then watering a large amount of water in the tray, putting a cotton seed after the soil in the paper cup is wetted by the water, and then covering soil. The growth condition is 16h light culture and 8h dark culture circulation growth at 28 ℃.

2) After two cotyledons of the seedlings are flattened, carrying out an injection inoculation experiment of agrobacterium after about 7-8 days; the cotyledon blade syringe soaking method is used, and the specific operation is that firstly, the back of the cotyledon is slightly scratched by a syringe needle to form a micro wound, then, the syringe with the syringe needle is used for injecting the mixed agrobacterium liquid from the wound on the back, and the fact that the whole leaf surface is glossy is preferred to indicate that the liquid successfully enters the cotyledon.

3) The cotton seedlings after injection are placed at 23 ℃ for 16h light culture and 8h dark culture for cyclic growth, and about 8 days, pTRV2 is injected: ghcia 1 began to develop a albino phenotype and just emerged true leaves were completely albino two weeks after injection, and at least 40 plants were inoculated per treatment.

4) When albino phenotype is obvious, randomly sampling a second true leaf for cotton seedlings injected with different vectors and controls, repeating for at least 3 times, taking 3 plants for each repetition, quickly freezing by liquid nitrogen, and storing at-80 ℃.

【5】 VIGS drought-resistant phenotype identification of GhRCHY1

After the emergence of albino phenotype in GhCLA1, the inoculated TRV, GhRCHY1 and TRV2 materials are subjected to natural drought treatment, and the drought tolerance of the plants is obviously reduced after GhRCHY1 is silenced compared with that of the TRV2 material, which shows that GhRCHY1 has an important role in cotton drought stress treatment (figure 6).

Nucleotide sequence of GhRCHY1 cDNA of SEQ ID1 target gene

ATGTCATTTTCAATGGAAGAAGTGGAAATTAAGCATTCTGGAGCTAAAGAGCTTAGCTATCAGCAACAAAATGAAAGCTACGAAGTATTTGAAGAAGAGGTGAGGGGATCATTCTCACCACAGTCAGGTGGAAACCGTGTGGATAAACAAGAATCAAATGATGCAGAAGCAACTGAATTGCTGGACAAGGGGTTTATGGAGTATGGTTGCCCACATTATCGAAGAAGGTGCCGGATTAGAGCTCCCTGTTGTGGTGAGATATTTGATTGTCGTCACTGTCATAATGAGGCAAAGAACAATATCAATGTTGACCAGAAGCTCAGACATGATCTCCCACGCCGTCAAATCAGTAAGGTTATTTGTTCTCTATGTGGCACAGAACAAGAGGCTCAACAAGTTTGCATCAACTGTGGTGTTTGTATGGGGAAGTATTTCTGCAACTCCTGCAAACTTTTTGATGATGATACATCGAAGAGACAGTATCATTGTGACGGTTGTGGGATCTGTAGGATTGGAGGGCAGGAGAACTTCTTCCATTGCCACAAGTGTGGTTGCTGCTATTCAATTCTTCTGAAAAAAAGCCATCCCTGTGTTGAAGGAGCGATGCACCATGACTGTCCCATATGCTTTGAGTTCTTGTTCGAATCGAGACAGAATGTAACTGTTCTGCCATGCGGACATACAATTCACACAAATTGTTTCAAGGAAATGAGGGACCATTTCCAATATGCCTGCCCTCTGTGCTCCAAATCGGTTTGTGACATGTCAAAGGTCTGGGAGAAATTCGACGAGGAGATCGCAGCTACACCAATGCCGGAACAGTACCAAAACAAAATGGTCTCGATCCTTTGCAACGATTGCGAGACAAAATCTCTAGTTCGGTTTCATGTCCTGGCTCAGAAATGCCCGAATTGCAAGTCATACAATACTAGGCAAACACGAGGCTGASEQID1 nucleotide sequence of GhRCHY1 gene group

ATGTCATTTTCAATGGAAGAAGTGGAAATTAAGCATTCTGGAGCTAAAGAGCTTAGCTATCAGCAACAAAATGAAAGCTACGAAGTATTTGAAGAAGAGGTGAGGGGATCATTCTCACCACAGTCAGGTGGAAACCGTGTGGATAAACAAGAATCAAATGATGCAGAAGCAACTGAATTGCTGGACAAGGGGTTTATGGAGTATGGGTAAGTTCTGATCTTTTCCTTTACGTTAATTTGTTTCTGTTCAGGTTCCGTTCTTTTATTTGTTGGTTGACGATGTGTTGTTGATTTTCCCCTGTTTTCTCCAGTTGCCCACATTATCGAAGAAGGTGCCGGATTAGAGCTCCCTGTTGTGGTGAGATATTTGATTGTCGTCACTGTCATAATGAGGCAAAGGTTAGTTTACGTCCTTAACATTTTATGATCAACAGTAGTTGCTATCTATATTACACTAGTATGAGAATGTTATTTCATTAATTTGAGTGTTATGTTTTTTTACTTTGTTTATGGTAACCTTTTAAGGCCATCAGATTTCAATATTTATATGCTTTAACTGAAAATATGTTGCGATAGCTATAACAAATTAATACATTCTAACATGCAACTGGCAAGTTTAGATTTATCATCCAAAAAACATCTTTACCTTTTGTTAGTTTCAATAATATTAACATCTAACTGATTATTATTGTGCTCAGAACAATATCAATGTTGACCAGAAGCTCAGACATGATCTCCCACGCCGTCAAATCAGTAAGGTAAATATATCCATAAATTCAGCCTAGTTTCTTGGTGAAAATCTTTTTCTTTGTATTGGTGGCATCTCTACCGTATGCTCCATGTTGCTAACATTTATCCATAACTTTTACCAGGTTATTTGTTCTCTATGTGGCACAGAACAAGAGGTAAGTTATGCGATTAATTCTAGTTTTCATGACATTCTTGATGACAAGGAAAATTTAGTTTTGCAGTGTTTAGCATTTTAGAGGCTCTTTGTACTTGGTTGGATTTCTTCTGAGGTTGTTTGCTTTTGATATTGTTTTGAACAGGCTCAACAAGTTTGCATCAACTGTGGTGTTTGTATGGGGAAGTATTTCTGCAACTCCTGCAAACTTTTTGATGATGATGTAAGTGGATAACCAAATGCAAACCAAAGTTTTTCCGTGTTTTATAGTTCTGTGATTTGTTCTGTTGTCTCAGCTCTTTATTTTTGCGCAAAGAGTTAAAAGATGCACGCAATGGCATACTAATGTTTGTTTCTACCGTGCAGACATCGAAGAGACAGTATCATTGTGACGGTTGTGGGATCTGTAGGTATGTTGTTCATTTCCTGGTTTTCTTCGCCTTAATTTATGAAATTAGTTTTACTTATTTCGCCCTCATTCACTTCTCTTTTTATCTTTTAATCTTGTCATTTTCACAACTAAATAATAATGTTATTTTCTCCCAGGATTGGAGGGCAGGAGAACTTCTTCCATTGCCACAAGTGTGGTAAGCTAATCTGAATCCATCTTTATGTAAGCTTTTATTAGTCTTATTGGGGTATTTGAACATCACTAATACTTTTATCCGTTTGTTTTTATGTTTTTTGTTGCACAAAGGTTGCTGCTATTCAATTCTTCTGAAAAAAAGCCATCCCTGTGTTGAAGGAGCGATGCACCATGACTGTCCCATATGCTTTGAGGTAATTTCAAGTTCTCTTATTTACCATCAAATATGATAATGAATTACTTTGATATTTTACCTAACTGAAAGACCTCAATCTGTATACGCAGTTCTTGTTCGAATCGAGACAGAATGTAACTGTTCTGCCATGCGGACATACAATTCACACAAATTGTTTCAAGGAAATGAGGGACCATTTCCAGTTAGTGCTTCAGCTCAATCTCAGGATTTTACTATTACCTACTATTTTGTAACTACTCTATTATTGACTGATATTCCAATCACTTGAACAGATATGCCTGCCCTCTGTGCTCCAAATCGGTTTGTGACATGTCAAAGGTCTGGGAGAAATTCGACGAGGAGATCGCAGCTACACCAATGCCGGAACAGTACCAAAACAAAATGGTTCGTAATCGTGAATGACAAAGCCTTATACTAGTTAAGATTCATTTTCGTGGAACAAGTTTTACTTAGAAAATTCAATTGTGATTCAACAGGTCTCGATCCTTTGCAACGATTGCGAGACAAAATCTCTAGTTCGGTTTCATGTCCTGGCTCAGAAATGCCCGAATTGCAAGTCATACAATACTAGGCAAACACGAGGCTGA

Amino acid sequence coded by GhRCHY1 of SEQID2 target gene

MSFSMEEVEIKHSGAKELSYQQQNESYEVFEEEVRGSFSPQSGGNRVDKQESNDAEATELLDKGFMEYGCPHYRRRCRIRAPCCGEIFDCRHCHNEAKNNINVDQKLRHDLPRRQISKVICSLCGTEQEAQQVCINCGVCMGKYFCNSCKLFDDDTSKRQYHCDGCGICRIGGQENFFHCHKCGCCYSILLKKSHPCVEGAMHHDCPICFEFLFESRQNVTVLPCGHTIHTNCFKEMRDHFQYACPLCSKSVCDMSKVWEKFDEEIAATPMPEQYQNKMVSILCNDCETKSLVRFHVLAQKCPNCKSYNTRQTRG

Sequence listing

<110> Nanjing university of agriculture

<120> cotton drought-resistant related gene GhRCHY1 and application thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>948

<212>DNA

<213> Cotton (Gossypium spp)

<400>1

atgtcatttt caatggaaga agtggaaatt aagcattctg gagctaaaga gcttagctat 60

cagcaacaaa atgaaagcta cgaagtattt gaagaagagg tgaggggatc attctcacca 120

cagtcaggtg gaaaccgtgt ggataaacaa gaatcaaatg atgcagaagc aactgaattg 180

ctggacaagg ggtttatgga gtatggttgc ccacattatc gaagaaggtg ccggattaga 240

gctccctgtt gtggtgagat atttgattgt cgtcactgtc ataatgaggc aaagaacaat 300

atcaatgttg accagaagct cagacatgat ctcccacgcc gtcaaatcag taaggttatt 360

tgttctctat gtggcacaga acaagaggct caacaagttt gcatcaactg tggtgtttgt 420

atggggaagt atttctgcaa ctcctgcaaa ctttttgatg atgatacatc gaagagacag 480

tatcattgtg acggttgtgg gatctgtagg attggagggc aggagaactt cttccattgc 540

cacaagtgtg gttgctgcta ttcaattctt ctgaaaaaaa gccatccctg tgttgaagga 600

gcgatgcacc atgactgtcc catatgcttt gagttcttgt tcgaatcgag acagaatgta 660

actgttctgc catgcggaca tacaattcac acaaattgtt tcaaggaaat gagggaccat 720

ttccaatatg cctgccctct gtgctccaaa tcggtttgtg acatgtcaaa ggtctgggag 780

aaattcgacg aggagatcgc agctacacca atgccggaac agtaccaaaa caaaatggtc 840

tcgatccttt gcaacgattg cgagacaaaa tctctagttc ggtttcatgt cctggctcag 900

aaatgcccga attgcaagtc atacaatact aggcaaacac gaggctga 948

<210>2

<211>2272

<212>DNA

<213> Cotton (Gossypium spp)

<400>2

atgtcatttt caatggaaga agtggaaatt aagcattctg gagctaaaga gcttagctat 60

cagcaacaaa atgaaagcta cgaagtattt gaagaagagg tgaggggatc attctcacca 120

cagtcaggtg gaaaccgtgt ggataaacaa gaatcaaatg atgcagaagc aactgaattg 180

ctggacaagg ggtttatgga gtatgggtaa gttctgatct tttcctttac gttaatttgt 240

ttctgttcag gttccgttct tttatttgtt ggttgacgat gtgttgttga ttttcccctg 300

ttttctccag ttgcccacat tatcgaagaa ggtgccggat tagagctccc tgttgtggtg 360

agatatttga ttgtcgtcac tgtcataatg aggcaaaggt tagtttacgt ccttaacatt 420

ttatgatcaa cagtagttgc tatctatatt acactagtat gagaatgtta tttcattaat 480

ttgagtgtta tgttttttta ctttgtttat ggtaaccttt taaggccatc agatttcaat 540

atttatatgc tttaactgaa aatatgttgc gatagctata acaaattaat acattctaac 600

atgcaactgg caagtttaga tttatcatcc aaaaaacatc tttacctttt gttagtttca 660

ataatattaa catctaactg attattattg tgctcagaac aatatcaatg ttgaccagaa 720

gctcagacat gatctcccac gccgtcaaat cagtaaggta aatatatcca taaattcagc 780

ctagtttctt ggtgaaaatc tttttctttg tattggtggc atctctaccg tatgctccat 840

gttgctaaca tttatccata acttttacca ggttatttgt tctctatgtg gcacagaaca 900

agaggtaagt tatgcgatta attctagttt tcatgacatt cttgatgaca aggaaaattt 960

agttttgcag tgtttagcat tttagaggct ctttgtactt ggttggattt cttctgaggt 1020

tgtttgcttt tgatattgtt ttgaacaggc tcaacaagtt tgcatcaact gtggtgtttg 1080

tatggggaag tatttctgca actcctgcaa actttttgat gatgatgtaa gtggataacc 1140

aaatgcaaac caaagttttt ccgtgtttta tagttctgtg atttgttctg ttgtctcagc 1200

tctttatttt tgcgcaaaga gttaaaagat gcacgcaatg gcatactaat gtttgtttct 1260

accgtgcaga catcgaagag acagtatcat tgtgacggtt gtgggatctg taggtatgtt 1320

gttcatttcc tggttttctt cgccttaatttatgaaatta gttttactta tttcgccctc 1380

attcacttct ctttttatct tttaatcttg tcattttcac aactaaataa taatgttatt 1440

ttctcccagg attggagggc aggagaactt cttccattgc cacaagtgtg gtaagctaat 1500

ctgaatccat ctttatgtaa gcttttatta gtcttattgg ggtatttgaa catcactaat 1560

acttttatcc gtttgttttt atgttttttg ttgcacaaag gttgctgcta ttcaattctt 1620

ctgaaaaaaa gccatccctg tgttgaagga gcgatgcacc atgactgtcc catatgcttt 1680

gaggtaattt caagttctct tatttaccat caaatatgat aatgaattac tttgatattt 1740

tacctaactg aaagacctca atctgtatac gcagttcttg ttcgaatcga gacagaatgt 1800

aactgttctg ccatgcggac atacaattca cacaaattgt ttcaaggaaa tgagggacca 1860

tttccagtta gtgcttcagc tcaatctcag gattttacta ttacctacta ttttgtaact 1920

actctattat tgactgatat tccaatcact tgaacagata tgcctgccct ctgtgctcca 1980

aatcggtttg tgacatgtca aaggtctggg agaaattcga cgaggagatc gcagctacac 2040

caatgccgga acagtaccaa aacaaaatgg ttcgtaatcg tgaatgacaa agccttatac 2100

tagttaagat tcattttcgt ggaacaagtt ttacttagaa aattcaattg tgattcaaca 2160

ggtctcgatc ctttgcaacg attgcgagac aaaatctcta gttcggtttc atgtcctggc 2220

tcagaaatgc ccgaattgca agtcatacaa tactaggcaa acacgaggct ga 2272

<210>3

<211>315

<212>PRT

<213> Cotton (Gossypium spp)

<400>3

Met Ser Phe Ser Met Glu Glu Val Glu Ile Lys His Ser Gly Ala Lys

1 5 10 15

Glu Leu Ser Tyr Gln Gln Gln Asn Glu Ser Tyr Glu Val Phe Glu Glu

20 25 30

Glu Val Arg Gly Ser Phe Ser Pro Gln Ser Gly Gly Asn Arg Val Asp

35 40 45

Lys Gln Glu Ser Asn Asp Ala Glu Ala Thr Glu Leu Leu Asp Lys Gly

50 55 60

Phe Met Glu Tyr Gly Cys Pro His Tyr Arg Arg Arg Cys Arg Ile Arg

65 70 75 80

Ala Pro Cys Cys Gly Glu Ile Phe Asp Cys Arg His Cys His Asn Glu

85 90 95

Ala Lys Asn Asn Ile Asn Val Asp Gln Lys Leu Arg His Asp Leu Pro

100 105 110

Arg Arg Gln Ile Ser Lys Val Ile Cys Ser Leu Cys Gly Thr Glu Gln

115 120 125

Glu Ala Gln Gln Val Cys Ile Asn Cys Gly Val Cys Met Gly Lys Tyr

130 135 140

Phe Cys Asn Ser Cys Lys Leu Phe Asp Asp Asp Thr Ser Lys Arg Gln

145 150155 160

Tyr His Cys Asp Gly Cys Gly Ile Cys Arg Ile Gly Gly Gln Glu Asn

165 170 175

Phe Phe His Cys His Lys Cys Gly Cys Cys Tyr Ser Ile Leu Leu Lys

180 185 190

Lys Ser His Pro Cys Val Glu Gly Ala Met His His Asp Cys Pro Ile

195 200 205

Cys Phe Glu Phe Leu Phe Glu Ser Arg Gln Asn Val Thr Val Leu Pro

210 215 220

Cys Gly His Thr Ile His Thr Asn Cys Phe Lys Glu Met Arg Asp His

225 230 235 240

Phe Gln Tyr Ala Cys Pro Leu Cys Ser Lys Ser Val Cys Asp Met Ser

245 250 255

Lys Val Trp Glu Lys Phe Asp Glu Glu Ile Ala Ala Thr Pro Met Pro

260 265 270

Glu Gln Tyr Gln Asn Lys Met Val Ser Ile Leu Cys Asn Asp Cys Glu

275 280 285

Thr Lys Ser Leu Val Arg Phe His Val Leu Ala Gln Lys Cys Pro Asn

290 295 300

Cys Lys Ser Tyr Asn Thr Arg Gln Thr Arg Gly

305 310 315

Claims

1. The GhRCHY1 gene shown in SEQ ID NO.1 or SEQ ID NO.2 is used in raising the drought resistance of cotton and breeding new cotton variety.

2. Use according to claim 1, characterized in that: the GhRCHY1 gene is used as a target gene, and the GhRCHY1 gene is overexpressed in cotton by a gene engineering method, so that new cotton seeds with remarkably improved drought resistance are cultivated and are applied to production.

3. A method for improving drought resistance of cotton is characterized in that: over-expression of GhRCHY1 gene with nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 in cotton.

4. The GhRCHY1 gene can obviously improve the drought resistance of cotton, and has an ORF sequence shown as SEQ ID No.1 or a genome sequence shown as SEQ ID No. 2.

5. The GhRCHY1 gene coded protein, which has the amino acid sequence as shown in SEQ ID No. 3.

6. A recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the GhRCHY1 gene as claimed in claim 4.

7. The recombinant vector, expression cassette, transgenic cell line or recombinant strain of claim 6, for use in improving drought resistance of cotton and breeding new germplasm of cotton.