CN112251445A - Gene GhZFP8 for regulating cotton fiber elongation and application thereof - Google Patents
Gene GhZFP8 for regulating cotton fiber elongation and application thereof Download PDFInfo
- Publication number
- CN112251445A CN112251445A CN202010995643.XA CN202010995643A CN112251445A CN 112251445 A CN112251445 A CN 112251445A CN 202010995643 A CN202010995643 A CN 202010995643A CN 112251445 A CN112251445 A CN 112251445A
- Authority
- CN
- China
- Prior art keywords
- ghzfp8
- gene
- cotton
- plant
- fiber
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of cotton genetic engineering, and discloses a method for regulating and controlling cotton fiber elongation developmentGhZFP8The gene and the application thereof, wherein the nucleotide sequence of the gene is shown as SEQ ID No. 1. By applying the inventionGhZFP8The gene is introduced into cotton and over-expressed to obtain transgenic cotton with elongated fiber cell. The invention provides a new method for the fiber development mechanism of cottonThe method has important significance in cultivating excellent cotton fiber varieties or researching.
Description
Technical Field
The invention belongs to the field of cotton genetic engineering, and particularly relates to application of a gene GhZFP8 in cotton fiber cell elongation.
Background
Previous studies have shown that gibberellins play an important role in cotton fiber development. Exogenous application of gibberellin can remarkably promote the initiation and elongation of fibrocyte, and exogenous application of gibberellin synthesis inhibitor paclobutrazol can remarkably inhibit fibrogenesis[1]. Two key proteins GID1 and SLR1 in gibberellin signaling pathway are specifically expressed in fibroblasts[2]. GhSLR1 can interact with GhGID1 and respond to gibberellin treatment, and overexpression of GhSLR1 causes dwarfing of Arabidopsis plants and increase of gibberellin response gene expression level[3]. In addition, overexpression of GA20-oxidase (GA20ox), a key enzyme in gibberellin synthesis, significantly increased gibberellin content and promoted fibroblast initiation and elongation[4]. These studies indicate that the gibberellin signaling pathway is closely related to cotton fiber cell development, but it is unclear how the gibberellin signaling pathway regulates cotton fiber development. The research team obtains 16 transcription factors with obviously increased expression level after gibberellin treatment by analyzing the transcriptome data of the ovules after the gibberellin treatment, and screens and discovers that the transcription factors GhZFP8 can interact with DELLA (GhSLR1) protein of cotton by utilizing a yeast two-hybrid system. The expression of the GhZFP8 gene is remarkably induced by gibberellin treatment, and the expression of the GhZFP8 gene is remarkably inhibited by paclobutrazol. The expression quantity of the GhZFP8 gene is the highest in the rapid elongation stage of the fiber cells. Overexpression of GhZFP8 promotes fiber elongation; the cotton fiber length after the intervention of GhZFP8 is obviously shortened.
[1]Liao W B,Ruan M B,Cui B M,et al.Isolation and characterization of a GAI/RGA-like gene from Gossypium hirsutum[J].Plant Growth Regulation,2009,58(1):35-45.
[2]Aleman L,Kitamura J,Abdel-Mageed H,et al.Functional analysis of cotton orthologs of GA signal transduction factors GID1 and SLR1[J].Plant Molecular Biology,2008,68(1-2):1.
[3]Griffiths J,Murase K,Rieu I,et al.Genetic characterization and functional analysis of the GID1gibberellin receptors in Arabidopsis[J].The Plant Cell,2006,18(12):3399-3414.
[4]Xiao Y H,Li D M,Yin M H,et al.Gibberellin 20-oxidase promotes initiation and elongation of cotton fibers by regulating gibberellin synthesis[J].Journal of Plant Physiology,2010,167(10):829-837。
Disclosure of Invention
The invention aims to solve the technical problem of how to regulate the fiber elongation development of cotton, and after the GhZFP8 gene is transferred into cotton, the development of cotton fiber cells can be regulated, so that the length of cotton fibers is obviously increased, based on the principle that in the presence of gibberellin, DELLA protein GhSLR1 is degraded through a proteasome pathway and releases GhZFP8 interacting with the DELLA protein GhSLR1 to activate the expression of GhMYB 2.
In order to solve the technical problem, the invention provides a GhZFP8 gene for regulating and controlling plant development, and the nucleotide sequence of the gene is shown as SEQ ID No. 1.
The invention also provides an expression cassette, a recombinant expression vector and a transgenic cell line of the gene; the recombinant expression vector is preferably a plant expression vector, and is preferably a recombinant plasmid pBI121-GhZFP8 or pHellsgate4-GhZFP8 obtained by connecting the gene fragment to a vector pBI121 or pHellsgate 4.
Meanwhile, the invention also provides the application of the GhZFP8 gene or the recombinant expression vector in regulating and controlling plant development.
The application is the application in the regulation of the fiber cell development; preferably in the regulation of the elongation of fibroblasts.
The application is to introduce the GhZFP8 gene into a target plant for overexpression to obtain a transgenic plant with elongated fiber cells.
The plant is dicotyledonous plant, monocotyledonous plant, gramineae plant, cruciferae plant, arabidopsis thaliana, wild type arabidopsis thaliana Columbia; the plant is preferably cotton, more preferably Asian cotton, upland cotton, or Ramengder cotton.
The nucleotide sequence of the gene GhZFP8 of the invention can be mutated by a known method, and the nucleotide obtained by artificial modification has 75 percent or higher identity with the nucleotide sequence of the gene GhZFP8 of the invention, and the nucleotide is derived from the nucleotide sequence of the invention and is identical with the sequence of the invention as long as the nucleotide encodes the gene GhZFP8 and has the function of the gene GhZFP 8.
The invention also provides a method for cultivating the transgenic plant, which comprises the following steps: introducing a coding gene GhZFP8 into a receptor plant to obtain a transgenic plant with different growth and development from the receptor plant.
In the above method, the "introduction of the gene GhZFP8 into the recipient plant" may be carried out by introducing a recombinant plasmid into the recipient plant.
The recombinant plasmid can be specifically regarded as recombinant plasmid pBI121-GhZFP8, pHellsgate4-GhZFP8 and the like.
The invention has the following beneficial effects:
in the presence of GA, DELLA protein GhZFP8 is degraded through a proteasome pathway and releases GhZFP8 interacting with DELLA protein GhSLR1 to activate expression of GhMYB2, so that cotton fiber development is regulated and cell elongation is promoted. The invention firstly provides the evolutionary relationship between the GhZFP8 protein and the homologous protein of model plant Arabidopsis thaliana, the homology with AtZFP8 protein is 42%, secondly the invention determines the possible expression region of the GhZFP8 gene, and the result proves that the GUS gene driven by the GhZFP8 promoter has high expression quantity in the leaf epidermal hair, flowers and main roots, and the result is shown in figure 1. And transferring the GhZFP8 overexpression vector and the gene interference vector into cotton, and screening to obtain GhZFP8 transgenic cotton. Meanwhile, the fiber lengths of wild-type cotton, over-expressed cotton and gene interference strains are detected. The result shows that the over-expression of the GhZFP8 obviously increases the fiber length, and the interference of the GhZFP8 gene obviously inhibits the fiber length, which indicates that the GhZFP8 gene regulates the fiber cell development.
The invention provides application of a GhZFP8 gene in regulation and control of cotton fiber development, and after the GhZFP8 gene is transferred into cotton, cotton fibers can be elongated, so that the GhZFP8 gene has great significance for research on the quality of the cotton fibers.
Drawings
FIG. 1: GUS transgenic Arabidopsis GUS staining, wherein, A is a leaf; b, E, locally amplifying the blade; c, inflorescence; d, silique; f, root; g, 10 days of seedlings; h, root hair.
FIG. 2: analysis of expression of GhZFP8 in different developmental stages of cotton fibers shows that GhZFP8 is significantly highly expressed in the fiber initiation stage (0DPA) and elongation stage (15DPA), and is very low in 20 DPA.
FIG. 3 (A) molecular identification of GhZFP8 overexpression transgenic cotton plants; (B) identifying GhZFP8 RNAi transgenic cotton plant molecules; (C) a transgenic cotton fiber phenotype; (D) transgenic cotton fiber length measurements.
Detailed Description
The invention is described in further detail below with reference to specific embodiments, which are given by way of illustration only and are not intended to limit the scope of the invention.
In the following examples, the test methods, unless otherwise specified, are conventional; the materials, reagents and the like used, unless otherwise specified, are commercially available; quantitative experiments are carried out, three times of repeated experiments are set, and the results are averaged; the material is selected from cotton fiber tissue of 0, 3, 5, 10, 15 and 20 days after flowering, which is respectively referred to as 0DPA, 3DPA, 5DPA, 10DPA, 15DPA and 20 DPA.
The cotton variety xuzhou cotton 142 is a well-known variety.
Wild type arabidopsis thaliana Columbia is described in the following documents:
A Gigon，AR Matos，D Laffray，Y Zuily-Fodil，AT Pham-Thi.Effect of drought stress on lipid metabolism in the leaves of Arabidopsis thaliana(ecotype Columbia).Annals of Botany,2004,94(3):345-351.
agrobacterium tumefaciens GV3101 is described in: xiaoweimin, Gem, Zhoumai, Sucheng, Du soldier Arabidopsis Thaliana injured and inoculated with Agrobacterium tumefaciens GV3101 on transcription, proceedings of agricultural Biotechnology, 2013,21(5):537 and 545.
Plasmid pBI121 is described in the following documents: the rapid identification of expression vector and its transformed plant from Caojia tree, Chi, Yu Xiao Lin, Ye Wan Zhi, pBI121, Zhejiang university Proc. 2008.34(2): 137-142).
Plasmid pCAMBIA2300 is described in the following documents: sclera, brave, von yongkun, nianwei, luo hong mei, guo shui, liu lai hua. And (3) constructing and verifying a plant expression vector pCAMBIA 2300-35S-GUS-CaMVterm. Journal of biological engineering in China, 2013,33(3) 86-91.
The light-dark alternate culture is light culture and dark culture alternate, and the specific culture period can be as follows: 14 hours light culture/10 hours dark culture.
The invention carries out cotton fiber high-throughput sequencing by cotton ovule in vitro culture and large-scale sequencing technology, 16 transcription factors with obviously increased expression amount after GA treatment are screened, GhZFP8 is one of the transcription factors, and the nucleotide sequence of the transcription factor GhZFP8 gene is shown in SEQ ID No. 1.
Example 1: expression pattern of GhZFP8 gene in different cotton fiber development periods
1. Extracting the RNA of the fibrous tissues of 0DPA, 3DPA, 5DPA, 10DPA, 15DPA and 20DPA in different periods of fiber development of Xuzhou cotton 142, reverse-transcribing the RNA into first-strand cDNA, and designing primers according to the dominant gene sequence, namely GhZFP8-QRT-F: CACCAATCACTTACCCTTCA and GhZFP8-QRT-R: ATGTGAGGATGAGGATGATG for Q-PCR amplification.
2. The procedure used to carry out the above experiment was a pre-denaturation at 95 ℃ for 15 s; denaturation at 95 ℃ for 5s, renaturation at 60 ℃ for 34s, and extension at 72 ℃ for 40s (data acquisition); for a total of 40 cycles.
3. The internal reference gene used for completing the test is GhUBQ7, and the primer sequence is GhUBQ7-F: GGCATTCCACCTGACCAACAA, GhUBQ7-R: CCGCATTAGGGCACTCTTTTC.
5. Each reaction is provided with 3 biological repetitions and 3 technical repetitions, and the differential expression analysis of relative quantification adopts 2–ΔΔCTThe method is described in the following literature (Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2–ΔΔCT Method.Livak and Schmittgen,2001:25,402-408.
6. The results of the quantitative expression analysis are shown in FIG. 2.
7. The results prove that: GhZFP8 was significantly highly expressed at fiber initiation (0DPA) and elongation (15DPA), while expression was very low at 20DPA, suggesting that GhZFP8 may be involved in fiber elongation development.
Example 2: obtaining and phenotypic identification of transgenic arabidopsis GUS vector
1. The promoter sequence (the nucleotide sequence is shown in SEQ ID No. 2) of the GhZFP8 gene upstream about 1501bp is obtained by cloning from cotton genome DNA by using primers. Primer sequences are shown in the following table:
2. the promoter is connected to the upstream of GUS coding sequence by means of homologous recombination to constitute recombinant vector pCAMBIA2300-35S-GUS-GhZFP 8.
3. Transferring the recombinant vector into agrobacterium-mediated GV3101 to form recombinant agrobacterium, transfecting wild arabidopsis via agrobacterium-mediated flower soaking method, screening to obtain positive seedling, transplanting in nutrient soil, and collecting T2After seed generation.
4. Will T2The seeds were histochemically stained. The results are shown in figure 1, the GUS gene driven by the GhZFP8 promoter is highly expressed in leaf epidermal hair, flowers and main roots, the cotton fiber is similar to the Arabidopsis epidermal hair in development, and the gene is deduced to possibly influence the cotton fiber cell development.
Example 3: acquisition and phenotypic analysis of GhZFP8 transgenic Cotton plants
Construction of recombinant plasmid pBI121-GhZFP8 overexpression
1. The target gene fragment is obtained by amplification with primers whose sequence is shown in the following table.
The full length of the GhZFP8 gene is obtained by PCR amplification by using a cotton genome (https:// cottonfgd. org /) sequence as a reference design primer. Using cDNA of cotton 15-day fiber (cotton fiber tissue after cotton blossom 15 days) as template, amplifying to obtain the full length of GhZFP8 gene with enzyme cutting site, the first 9 nucleotides in the primer in the following table are protection base and enzyme cutting site, the underlined is the sequence of target gene,
2. the homologous recombination method connects the target gene fragment to the vector pBI121 to obtain the recombinant plasmid pBI121-GhZFP 8.
3. The recombinant plasmid pBI121-GhZFP8 is introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens.
Second, construction of recombinant plasmid pHellsgate4-GhZFP8 gene interference vector
1. A specific fragment of approximately 500bp of the target gene was amplified using primers containing adaptor sequences.
The cDNA of cotton 15-day fiber is used as a template, and a GhZFP8 gene fragment with a pHellsgate4 vector homologous arm is obtained by amplification, and the underlined sequence is a target gene sequence.
2. The RNAi interference vector pHellsgate4 was ligated by the BP enzyme, and the primer sequences are shown in the following table.
3. The ligation product is transformed into Trans1-T1 competent cells, and is identified by single digestion with Xho I and Xba I respectively, and if the sizes of the fragments obtained by the single digestion are consistent, the construction of the vector is successful.
4. The recombinant plasmid pHellsgate4-GhZFP8 is introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens.
Thirdly, obtaining transgenic plants
Infecting the hypocotyl section of cotton with the two obtained recombinant agrobacteria to obtain embryonic callus and aseptic seedling, grafting, identifying the positive seedling to obtain positive plant, and performing generational propagation to obtain T3Generation homozygous transgenic plants. The molecular detection result is shown in figure 3A, B, and the result shows that the overexpression vector and the gene interference vector of GhZFP8 have been successfully transferred into cotton plants.
Measurement of fiber length of GhZFP8 transgenic cotton
Randomly selecting 10 mature fibers of over-expression cotton strains and gene interference strains respectively, randomly selecting 15 cotton bolls from each strain, pulling the fibers for multiple times to enable the fibers to be parallel, and removing the attached fibers. The fiber bundles were placed on a black wool board and the length was measured with a ruler, see fig. 3C, fig. 3D, with the following statistics:
| Wlid type | ZFP8-OE | ZFP8-RNAi | |
| fiber length (mm) | 26.4±0.4 | 29.6±0.6 | 23.5±0.5 |
The statistical result shows that the fiber length of wild plants is 27mm on average, the fiber length of GhZFP8 overexpression plants is 31mm, and the fiber length of overexpression plants is increased by 15%; the length of the fiber of the GhZFP8 gene interference strain is 24mm, which is shortened by 10 percent compared with the length of the wild fiber. The over-expression of the GhZFP8 is proved to obviously increase the fiber length, and the interference of the GhZFP8 gene obviously inhibits the fiber length, so that the GhZFP8 gene regulates the fiber cell development.
<110> university of Shanxi university
<120> gene GhZFP8 for regulating cotton fiber elongation and application thereof
<160> 2
<210> 1
<211> 747
<212> DNA
<400> 1
ATGGAGAAGAACGAAAGGGAGACTCACGACTTCATGAACGTAGAATCCTTCTCTCAGCTTCCCTTTATCCGCCCTGCCCCCAGCAAAGAAAAGGGCATCCGTTTGTTCGGCAAGGAATTTGGTGGTGTTGACCCAGCTACGCCCAGCAACGAGTCCGACTCAGCCGAGAACAACGAAGATACCACCAAGGAGAACGAGAACAATGGTGATAACAGCAGAAGGTTTGAGTGCCATTATTGTTGCAGAAACTTCCCCACCTCCCAAGCTTTAGGTGGTCACCAAAACGCTCACAAAAGGGAACGCCAACATGCGAAACGAGCTCATCTTCAGTCAGCAATGGTGCACACCTCTTTATCTGATGCTCATATTTATGGACTTGTTAACTACAGGCTAGGCTCAGCTCCAACACCACCAATCACTTACCCTTCATGGAACTCTAGCTTTACCCGTAGTACCAGTAGGTTTTATGGGAACCATACCTCCTTTTCTCATCACCCACCCATCAATGGCAGCCCACTGGGGTTATGGAGAATTCCTTCTACCCTTCAAAATAACTCTTCTAATTTCAATCCTGACCGTTCCTCATCATCCTCATCCTCACATCCCTTGCCTTTGTTTGCCGGCGATGAGTTGAAGCCGCCCTCTCAGGTTGTTGCTGGCGGTGGTGGTTCAAGCTCCCAGAGTCGGTACGTTTATGAATCCAAGCCAAGATTGCAAGACCATGTGAGTTTGGATCTACATCTGTAA
<210> 2
<211> 1501
<212> DNA
<400> 2
TATCCCTCCTATTTTCTTTCCTTCCACTTTTCTTCCATAGACTCAAAATTTATTTTCTTTTTACTTTTTCACTCACTCCTCTCGTCCTTCTACTTTTCCACCCAACTAAATGCACCCTTAATCTCAACCACCTAAAGTGTTGTATAAACTCGAAACCTTCCCGAAACATCTCTATATTTCATGATATATCTAACAAAGTCACAAATAAAATAATGATGTATTGACAAAAACTTTGATATTATTTGGGTTAGATCTATATTACTCTCGGTATTGTAAATAAACTAAAAATTGAATAATATTTAAAAGAAATAATAGGGTATTTATAATTTTAATAATTTTATAATTTTCTATAAATTATAAATAGGAACATTAAAACAAATCTTGAGATAGATTAGCGGATGTTTTAGTTTAGGTTGAATTATTGATTTTATATAAACAAATTTCCTTCATAATTAAAAAAAAGAAAGTTAAACTCACAAGTGTGGTAAATAATGAAGATGTTAGGAGGGTGTGGCAGATGTTTCCAACACACGGTAAACATTTAAGTGAAAGGAGGCCAAGGTAGTCCTTTTGACAAACCCACTCTCATCGATCGGACCACAACTTCTCAGATCATGTGCCATGGCTTGCCTCCAACCCTTTTGTCCATGCTTCCCTCTTCCATAACCATAACCTTTCCCTCTCTATAGCCCCATTAGCCAACCCCCCCCCCCTTTTCTTTCCTCCTCCTTTTCCCAAACACTTCAACCCACCCTTTCTTCTCTTGTTTAATCATGGAGAAGAACGAAAGGGAGACTCACGACTTCATGAACGTAGAATCCTTCTCTCAGCTTCCCTTTATCCGCCCTGCCCCCAGCAAAGAAAAGGGCATCCGTTTGTTCGGCAAGGAATTTGGTGGTGTTGACCCAGCTACGCCCAGCAACGAGTCCGACTCAGCCGAGAACAACGAAGATACCACCAAGGAGAACGAGAACAATGGTGATAACAGCAGAAGGTTTGAGTGCCATTATTGTTGCAGAAACTTCCCCACCTCCCAAGCTTTAGGTGGTCACCAAAACGCTCACAAAAGGGAACGCCAACATGCGAAACGAGCTCATCTTCAGTCAGCAATGGTGCACACCTCTTTATCTGATGCTCATATTTATGGACTTGTTAACTACAGGCTAGGCTCAGCTCCAACACCACCAATCACTTACCCTTCATGGAACTCTAGCTTTACCGGTAGTACCAGTAGGTTTTATGGGAACCATACCTCCTTTTCTCATCACCCACCCATCAATGGCAGCCCACTGGGGTTATGGAGAATTCCTTCTACCCTTCAAAATAACTCTTCTAATTTCAATCCTGACCGTTCCTCATCATCCTCATCCTCACATCCCTTGCCTTTGTTTGCCGGCGATGAGTTGAAGCCGCCCTCAGGTTGTTGCTGGCGGTGGTGGTTCAAGCTCCCAGAGTCGGTACGTTTATGAATCCAAGCCAAGATTGCAAGACCATGTGAGTT
Claims (10)
1. Regulating plant developmentGhZFP8The nucleotide sequence of the gene is shown in SEQ ID No. 1.
2. An expression cassette, a recombinant expression vector, a transgenic cell line comprising the gene of claim 1.
3. A recombinant plasmid pBI121- GhZFP8Or pHellsgate4-GhZFP8。
4. The method of claim 1GhZFP8Use of a gene, or a recombinant expression vector according to claim 2 or 3, for modulating plant development.
5. Use according to claim 4, for modulating fibroblast development.
6. Use according to claim 4, for modulating the elongation of a fibre cell.
7. Use according to any one of claims 4 to 6, characterized in that it consists in subjecting saidGhZFP8The gene is introduced into a target plant and is overexpressed to obtain a transgenic plant with elongated fiber cells.
8. Use according to any one of claims 4 to 6, wherein the plant is a dicotyledonous plant, a monocotyledonous plant, a graminaceous plant, a cruciferous plant.
9. Use according to any one of claims 4 to 6, wherein the plant is cotton.
10. The use of claim 9, wherein: the plant is Asian cotton, upland cotton, or Ramengde cotton.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010995643.XA CN112251445B (en) | 2020-09-21 | 2020-09-21 | Gene GhZFP8 for regulating cotton fiber elongation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010995643.XA CN112251445B (en) | 2020-09-21 | 2020-09-21 | Gene GhZFP8 for regulating cotton fiber elongation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112251445A true CN112251445A (en) | 2021-01-22 |
| CN112251445B CN112251445B (en) | 2023-03-17 |
Family
ID=74231411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010995643.XA Active CN112251445B (en) | 2020-09-21 | 2020-09-21 | Gene GhZFP8 for regulating cotton fiber elongation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251445B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1818065A (en) * | 2005-10-14 | 2006-08-16 | 山东农业大学 | Cotton GhZFP1 gene sequence, its clone and use |
| US20090178161A1 (en) * | 2004-11-26 | 2009-07-09 | Chantal Arar | Method for directing nucleic acids to plastids |
| CN110791523A (en) * | 2019-12-13 | 2020-02-14 | 南京农业大学 | Cotton drought-resistant related gene GhRCHY1 and application thereof |
| CN111499706A (en) * | 2020-04-03 | 2020-08-07 | 湖南科技学院 | Cotton zinc finger protein GhZFPH4, and coding gene and application thereof |
-
2020
- 2020-09-21 CN CN202010995643.XA patent/CN112251445B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090178161A1 (en) * | 2004-11-26 | 2009-07-09 | Chantal Arar | Method for directing nucleic acids to plastids |
| CN1818065A (en) * | 2005-10-14 | 2006-08-16 | 山东农业大学 | Cotton GhZFP1 gene sequence, its clone and use |
| CN110791523A (en) * | 2019-12-13 | 2020-02-14 | 南京农业大学 | Cotton drought-resistant related gene GhRCHY1 and application thereof |
| CN111499706A (en) * | 2020-04-03 | 2020-08-07 | 湖南科技学院 | Cotton zinc finger protein GhZFPH4, and coding gene and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| COTTONGEN.ORG: "CotAD_42933，CotAD_42933_BGI-AD1_v1.0 (mRNA) Gossypium hirsutum", 《COTTONGEN.ORG》 * |
| COTTONGEN.ORG: "Gh_D04G111300.1, Gh_D04G111300.1_CRI-TM1_v1 (mRNA) Gossypium hirsutum", 《COTTONGEN.ORG》 * |
| PENG HE ET AL.: "Comprehensive analyses of ZFP gene family and characterization of expression profiles during plant hormone response in cotton", 《BMC PLANT BIOLOGY》 * |
| RAKESH KUMAR ET AL.: "Identification and Expression Pattern Analysis of Two Gossypium hirsutum Zinc Finger Transcription Factors During Cotton Fiber Initiation", 《NATL. ACAD. SCI. LETT.》 * |
| 马晓梅等: "早熟陆地棉品种与气候因子互作对棉纤维品质的影响", 《新疆农业科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112251445B (en) | 2023-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210054396A1 (en) | Polynucleotides and polypeptides involved in plant fiber development and methods of using same | |
| CN101489375A (en) | Compositions for silencing the expression of gibberellin 2-oxidase and uses thereof | |
| CN110066774B (en) | Corn receptor kinase gene ZmRLK7 and application thereof | |
| CN111676235B (en) | Application of GTP-binding protein gene GhROP6 in regulation and control of cotton fiber properties | |
| CN113462690A (en) | Application of soybean gene promoters pRPS28 and pRPS28-I in soybeans, arabidopsis thaliana and tobaccos | |
| CN113462689A (en) | Application of soybean gene promoters pEIF1 and pEIF1-I in soybeans, arabidopsis thaliana and tobaccos | |
| CN106755004B (en) | Application of GhPME36 gene in regulation and control of plant secondary wall development | |
| CN112251445B (en) | Gene GhZFP8 for regulating cotton fiber elongation and application thereof | |
| CN106893731B (en) | Soybean xyloglucan transferase hydrolase geneGmXTH1And applications | |
| CN112301046A (en) | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof | |
| CN112251446A (en) | Gene GhBLH1 for regulating cotton fiber elongation and application thereof | |
| CN108715854A (en) | Applications of the cotton AINTEGUMENTA genes GhANT in cotton breeding | |
| NL2030997B1 (en) | Zea mays receptor-like kinase 7 (zmrlk7) gene related to kernel and plant type development of maize and use thereof | |
| CN108841839B (en) | Application of protein TabZIP60 in regulation and control of nitrogen absorption of plants | |
| CN115976072B (en) | Histone deacetylase GhHDT3_A01 gene and application thereof, recombinant expression vector and recombinant expression method | |
| CN112481274B (en) | Transcription factor gene LOC _ OS04G54330 for causing rice dwarfing and application thereof | |
| CN113416747B (en) | Method for creating temperature-sensitive male sterile plant | |
| CN111235178B (en) | Application of BpVND1 gene | |
| CN117625646A (en) | GhRSL1-2 gene, method for cultivating transgenic plant and application thereof in regulating cotton development | |
| AU2016202762B2 (en) | Polynucleotides and Polypeptides Involved in Plant Fiber Development and Methods of Using Same | |
| CN114752602A (en) | Application of gene GhKNOX6 in cotton fiber cell elongation | |
| CN118185940A (en) | RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers | |
| AU2013206379B2 (en) | Polynucleotides and Polypeptides Involved in Plant Fiber Development and Methods of Using Same | |
| CN117947045A (en) | Tobacco low-temperature response gene NtSAP and application thereof | |
| CN111270005A (en) | Rice OsIDEF1 gene strong stress-resistant genotype molecular marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |