CN118185940A - RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers - Google Patents
RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers Download PDFInfo
- Publication number
- CN118185940A CN118185940A CN202410375248.XA CN202410375248A CN118185940A CN 118185940 A CN118185940 A CN 118185940A CN 202410375248 A CN202410375248 A CN 202410375248A CN 118185940 A CN118185940 A CN 118185940A
- Authority
- CN
- China
- Prior art keywords
- cotton
- green
- pexpa
- seq
- fiber
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000835 fiber Substances 0.000 title claims abstract description 106
- 238000000034 method Methods 0.000 title claims abstract description 50
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 47
- 108091030071 RNAI Proteins 0.000 title claims abstract description 31
- 230000009368 gene silencing by RNA Effects 0.000 title claims abstract description 31
- 230000006872 improvement Effects 0.000 title abstract description 7
- 229920000742 Cotton Polymers 0.000 claims abstract description 184
- 230000014509 gene expression Effects 0.000 claims abstract description 58
- 238000011161 development Methods 0.000 claims abstract description 28
- 230000018109 developmental process Effects 0.000 claims abstract description 28
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 claims abstract description 28
- 244000299507 Gossypium hirsutum Species 0.000 claims description 150
- 239000013598 vector Substances 0.000 claims description 101
- 241000196324 Embryophyta Species 0.000 claims description 99
- 230000009261 transgenic effect Effects 0.000 claims description 68
- 239000002773 nucleotide Substances 0.000 claims description 59
- 125000003729 nucleotide group Chemical group 0.000 claims description 59
- 239000012634 fragment Substances 0.000 claims description 42
- 230000003321 amplification Effects 0.000 claims description 27
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 27
- 238000012408 PCR amplification Methods 0.000 claims description 24
- 230000002452 interceptive effect Effects 0.000 claims description 24
- 241000894006 Bacteria Species 0.000 claims description 21
- 240000002024 Gossypium herbaceum Species 0.000 claims description 19
- 235000004341 Gossypium herbaceum Nutrition 0.000 claims description 19
- 238000001514 detection method Methods 0.000 claims description 18
- 239000013612 plasmid Substances 0.000 claims description 18
- 235000009429 Gossypium barbadense Nutrition 0.000 claims description 16
- 238000006243 chemical reaction Methods 0.000 claims description 16
- 235000018322 upland cotton Nutrition 0.000 claims description 16
- 238000003753 real-time PCR Methods 0.000 claims description 15
- 238000003752 polymerase chain reaction Methods 0.000 claims description 14
- 238000010276 construction Methods 0.000 claims description 13
- 239000002299 complementary DNA Substances 0.000 claims description 12
- 230000000295 complement effect Effects 0.000 claims description 10
- 238000012258 culturing Methods 0.000 claims description 8
- 238000009396 hybridization Methods 0.000 claims description 7
- 230000006801 homologous recombination Effects 0.000 claims description 6
- 238000002744 homologous recombination Methods 0.000 claims description 6
- 230000006798 recombination Effects 0.000 claims description 6
- 238000005215 recombination Methods 0.000 claims description 6
- 238000009331 sowing Methods 0.000 claims description 6
- 238000001976 enzyme digestion Methods 0.000 claims description 5
- 238000003776 cleavage reaction Methods 0.000 claims description 3
- 230000029087 digestion Effects 0.000 claims description 3
- 238000002156 mixing Methods 0.000 claims description 3
- 230000007017 scission Effects 0.000 claims description 3
- 229920002678 cellulose Polymers 0.000 abstract description 13
- 239000001913 cellulose Substances 0.000 abstract description 13
- 239000002023 wood Substances 0.000 abstract description 12
- 230000008021 deposition Effects 0.000 abstract description 6
- 238000004040 coloring Methods 0.000 abstract description 4
- 239000000049 pigment Substances 0.000 abstract description 4
- 238000009825 accumulation Methods 0.000 abstract description 3
- 238000009395 breeding Methods 0.000 abstract description 2
- 230000001488 breeding effect Effects 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 39
- 230000002829 reductive effect Effects 0.000 description 12
- 238000012257 pre-denaturation Methods 0.000 description 9
- 238000000137 annealing Methods 0.000 description 7
- 238000004925 denaturation Methods 0.000 description 7
- 230000036425 denaturation Effects 0.000 description 7
- 238000010586 diagram Methods 0.000 description 7
- 239000000463 material Substances 0.000 description 7
- 230000002068 genetic effect Effects 0.000 description 6
- 239000002609 medium Substances 0.000 description 6
- 101150036690 EXPA2 gene Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 4
- ZRWPUFFVAOMMNM-UHFFFAOYSA-N Patulin Chemical compound OC1OCC=C2OC(=O)C=C12 ZRWPUFFVAOMMNM-UHFFFAOYSA-N 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 241000589158 Agrobacterium Species 0.000 description 3
- 206010020649 Hyperkeratosis Diseases 0.000 description 3
- 238000007796 conventional method Methods 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 239000003292 glue Substances 0.000 description 3
- 210000001161 mammalian embryo Anatomy 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 239000000843 powder Substances 0.000 description 3
- 244000146553 Ceiba pentandra Species 0.000 description 2
- 235000003301 Ceiba pentandra Nutrition 0.000 description 2
- 108050000194 Expansin Proteins 0.000 description 2
- MHAJPDPJQMAIIY-UHFFFAOYSA-N Hydrogen peroxide Chemical compound OO MHAJPDPJQMAIIY-UHFFFAOYSA-N 0.000 description 2
- 238000002123 RNA extraction Methods 0.000 description 2
- 229930183415 Suberin Natural products 0.000 description 2
- 241001464837 Viridiplantae Species 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 210000002421 cell wall Anatomy 0.000 description 2
- 239000012881 co-culture medium Substances 0.000 description 2
- 238000004043 dyeing Methods 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 239000012877 elongation medium Substances 0.000 description 2
- 230000000408 embryogenic effect Effects 0.000 description 2
- 239000004744 fabric Substances 0.000 description 2
- 239000012869 germination medium Substances 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 241000589155 Agrobacterium tumefaciens Species 0.000 description 1
- 241000701489 Cauliflower mosaic virus Species 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 241000241602 Gossypianthus Species 0.000 description 1
- 238000002944 PCR assay Methods 0.000 description 1
- 241001052560 Thallis Species 0.000 description 1
- 108091023040 Transcription factor Proteins 0.000 description 1
- 102000040945 Transcription factor Human genes 0.000 description 1
- 230000003213 activating effect Effects 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 235000012343 cottonseed oil Nutrition 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 230000003111 delayed effect Effects 0.000 description 1
- 210000002257 embryonic structure Anatomy 0.000 description 1
- 238000005265 energy consumption Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000005284 excitation Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000002657 fibrous material Substances 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 230000035784 germination Effects 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000000670 limiting effect Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 239000006194 liquid suspension Substances 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000037361 pathway Effects 0.000 description 1
- 230000010152 pollination Effects 0.000 description 1
- 238000007639 printing Methods 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000035484 reaction time Effects 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 230000000717 retained effect Effects 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 238000010186 staining Methods 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 239000004753 textile Substances 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000011426 transformation method Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an RNAi interference method of a green fiber gene Lg and application thereof in improving green fibers, and belongs to the technical field of molecular breeding. Since Lg is expressed from 15 days after flowering, throughout the entire period of development of the secondary wall of the green cotton fiber, expression of Lg promotes mass accumulation of wood plug in the period of the secondary wall of the fiber, resulting in a decrease in cellulose content in the green fiber, and the secondary wall is thinned, ultimately resulting in a decrease in yield and quality of the green fiber. Based on the above, the promoter pEXPA of the invention can reduce the expression of Lg at the initial stage of the fiber secondary wall through expressing the RNAi interference sequence of Lg, delay the deposition of wood plug (pigment) in the fiber secondary wall, thereby reducing the influence of competition between wood plug and cellulose on the development of the fiber secondary wall, leading the cellulose to accumulate in more fibers and realizing the improvement of green fibers under the condition of not influencing the coloring of the green fibers.
Description
Technical Field
The invention belongs to the technical field of molecular breeding, and particularly relates to an RNAi interference method of a green fiber gene Lg and application thereof in improvement of green fibers.
Background
The natural colored cotton is a cotton fiber material which is not added with any later artificial modification, and can accumulate pigment in the growth and development process of the fiber, thereby presenting natural color. Compared with the conventional white cotton, the natural colored cotton fiber does not need the procedures of printing, rinsing and the like in the process of processing the natural colored cotton fiber into colored fabrics, has little chemical pollution and low energy consumption, and is an environment-friendly green ecological textile material. The demand of the color fabrics in the modern society is huge, and the health and environmental awareness of people is also increasing, so the natural color cotton has a very large market application prospect.
Green cotton is one of the existing natural colored cotton. The green cotton has green fiber gene Lg which promotes the color development of the fiber, and the Lg codes an R2R3-MYB transcription factor, and the gene Lg is specifically expressed at a high level in the secondary wall period of the green fiber, can obviously activate related genes of the wood plug pathway and promote the deposition of wood plug in the fiber, and the wood plug is the main color pigment of the green fiber. The expression of Lg in the green cotton fiber still has a very high expression level from 15 days after flowering to the later stage of the secondary wall development of the fiber (35 days after flowering), and the expression of Lg just runs through the whole period of the secondary wall development of the green cotton fiber, so that a large amount of kapok is promoted to accumulate in the secondary wall period, but the accumulation of kapok in the fiber can influence the deposition of cellulose in the fiber, so that the yield and quality of the green fiber are reduced, which is an important reason that the green cotton fiber cannot be improved at present.
Disclosure of Invention
The invention aims to provide an RNAi interference method of a green fiber gene Lg and application thereof in improving green fibers. According to the invention, the RNAi fragment of Lg is expressed by the expansin (Expansin) EXPA2 gene promoter pEXPA, so that the expression level of Lg is reduced in the early stage of green fiber secondary wall development, and the improvement of the yield and quality of green fibers under the condition of not changing the coloring of the green fibers is realized.
The invention provides a promoter pEXPA capable of highly expressing a target gene in the elongation period and the early development stage of secondary walls of cotton fibers, wherein the nucleotide sequence of the promoter pEXPA is shown as SEQ ID NO. 1.
The invention also provides application of the promoter pEXPA2 in improving the expression quantity of target genes in cotton; preferably, the expression part of the target gene is cotton fiber 5-20 days after the cotton is opened; further preferably, the site of expression of the target gene is cotton fiber 15 to 20 days after flowering.
The invention also provides an expression cassette capable of reducing the expression level of Lg at the early stage of the development of the fiber secondary wall of cotton, which comprises a promoter pEXPA and an RNAi fragment for disturbing Lg according to the scheme; preferably, the nucleotide sequence of the RNAi fragment for interference of Lg is shown in SEQ ID NO. 4.
The invention also provides an interference vector capable of reducing the expression level of Lg at the early stage of the development of the fiber secondary wall of cotton, which comprises a promoter pEXPA and an RNAi fragment for interference of Lg according to the scheme; preferably, the nucleotide sequence of the RNAi fragment for interference of Lg is shown in SEQ ID NO. 4; preferably, the backbone carrier of the interfering carrier comprises pLGN-35S; the promoter pEXPA is inserted between HindIII and BamHI cleavage sites of pLGN-35S to replace the original 35S promoter on pLGN-35S.
The invention also provides a construction method of the interference carrier, which comprises the following steps:
Taking genomic DNA of upland cotton Ji cotton 14' as a template, and carrying out PCR amplification by using primers pEXPA-F and pEXPA-R to obtain pEXPA fragment with a homologous arm;
double enzyme digestion is carried out on pLGN-35S vector by HindIII and BamHI, and the original 35S promoter on pLGN-35S vector is removed, so as to obtain a first linearization plasmid;
carrying out homologous recombination on the first linearization plasmid and the pEXPA fragment with the homology arm to obtain a pLGN recombinant vector containing pEXPA 2;
Double digestion is carried out on the pLGN recombinant vector containing pEXPA < 2 > by adopting BamHI and EcoRI to obtain a second linearization plasmid;
Taking genomic DNA of upland cotton 'T586' as a template, and carrying out PCR amplification by using primers ELgi-F1 and ELgi-R1 to obtain a complementary strand of the Lg-RNAi element; the nucleotide sequence of ELgi-F1 is shown in SEQ ID NO. 5; the nucleotide sequence of ELgi-R1 is shown as SEQ ID NO. 6;
Taking genomic DNA of upland cotton 'T586' as a template, and carrying out PCR amplification by using primers ELgi-F2 and ELgi-R2 to obtain an intron-positive strand of the Lg-RNAi element; the nucleotide sequence of ELgi-F2 is shown as SEQ ID NO. 7; the nucleotide sequence of ELgi-R2 is shown as SEQ ID NO. 8;
And mixing the second linearization plasmid, the complementary strand of the Lg-RNAi element and the intron-positive strand of the Lg-RNAi element, and carrying out recombination reaction to obtain the interference vector.
The invention also provides a host bacterium comprising the interference vector described in the scheme or the interference vector obtained by the construction method.
The invention also provides an RNAi interference method of the green fiber gene Lg, which comprises the following steps: the host bacteria described in the above protocol were introduced into cotton receptors.
The invention also provides the promoter pEXPA2, the expression cassette, the interference vector obtained by the construction method, the host bacterium or the application of the RNAi interference method in constructing transgenic cotton, improving green cotton fibers and/or improving the yield of the green cotton fibers.
The invention also provides a method for creating transgenic hybrid green cotton, which comprises the following steps:
Introducing the host bacteria into a cotton receptor, and culturing the cotton receptor to obtain transgenic cotton;
hybridization is carried out by taking the transgenic cotton as a male parent and green cotton as a female parent to obtain an F1 generation;
Sowing the F1 generation to obtain an F1 generation plant, reserving a plant with green mature fibers in the F1 generation plant, and collecting seeds to obtain an F2 generation;
sowing the F2 generation to obtain an F2 generation plant, and identifying whether the F2 generation plant contains an interference vector or not through a molecular biological means.
Preferably, after culturing the cotton receptor, the method further comprises identifying whether host bacteria containing interference vectors are successfully introduced into the cotton plant obtained by culturing; the method for identifying whether the host bacteria containing the interference vector is successfully introduced into the cotton plant obtained by culture preferably comprises the following steps: extracting genome DNA of a plant to be detected, carrying out PCR (polymerase chain reaction) amplification by using the genome DNA as a template and adopting primers ELgi-F3 and pEXPA-R1, and judging that an interference vector is successfully transferred into receptor cotton if 666bp fragments are obtained by amplification; the nucleotide sequence of ELgi-F3 is shown as SEQ ID NO. 9; the nucleotide sequence of pEXPA-R1 is shown as SEQ ID NO. 10;
After identifying that the host bacteria containing the interference vector are successfully introduced into the cotton plant obtained by culture, the invention preferably further comprises identifying whether the interference vector has functions in the cotton plant; the identification of whether the interfering vector is functionally preferred in cotton plants comprises the steps of: the method comprises the steps of carrying out quantitative PCR detection on transgenic cotton fiber cDNA 15 days after flowering by adopting primers RT-Lgi-F and RT-Lgi-R, and judging that an interference vector has a function in cotton plants when the expression level of Lg in positive plants to be detected is lower than that of wild plants 'Yuan early No. 1'; the nucleotide sequence of the RT-Lgi-F is shown as SEQ ID NO.11, and the nucleotide sequence of the RT-Lgi-F is shown as SEQ ID NO. 12; the internal reference gene detected by the quantitative PCR is preferably GhActin4, and the primers for amplifying the internal reference gene are preferably GhAct-F and GhAct-R; the nucleotide sequence of GhAct-F is shown as SEQ ID NO. 13; the nucleotide sequence of GhAct-R is shown as SEQ ID NO. 14;
After the F2 generation is obtained, preferably, the method further comprises the step of identifying whether the F2 generation plant contains an interference vector or not through a molecular biological means; the identification of whether the F2 generation plant contains the interference vector by the molecular biological means preferably comprises the following steps: extracting genome DNA of an F2 generation plant, taking the genome DNA of the F2 generation plant as a template, and carrying out PCR (polymerase chain reaction) amplification by using a primer ELgi-F3 and a primer pEXPA-R1, wherein if a 666bp fragment is obtained by amplification, the F2 generation plant is judged to contain an interference vector;
After identifying that the F2 generation plant contains the interference vector, preferably further comprising identifying whether the F2 generation plant is a offspring of the female parent; when the female parent is transgenic green cotton 'FLGT', identifying whether the F2 generation plant is a progeny of the female parent preferably comprises the steps of: extracting genome DNA of the F2 generation plant, taking the genome DNA of the F2 generation plant as a template, adopting primers FLgT-F and FLgT-R to carry out PCR amplification, and judging that the F2 generation plant is a offspring of a female parent if a 497bp fragment is obtained by amplification; the nucleotide sequence of FLgT-F is shown as SEQ ID NO. 15; the nucleotide sequence of FLgT-R is shown as SEQ ID NO. 16;
After identifying the progeny of the F2 generation plant that contains the interference vector and is female parent, the invention preferably further comprises identifying whether the interference vector in the F2 generation plant is functional; the identification of whether the interfering vector in the F2 generation plant plays a role preferably comprises the following steps: quantitative PCR detection is carried out on cotton fiber cDNA of F2 generation plants 15 days after flowering by adopting primers RT-Lgi-F1 and RT-Lgi-R1, if Lg is expressed in fibers 15 days after flowering, the interference vector plays a role; the nucleotide sequence of the RT-Lgi-F1 is shown as SEQ ID NO. 17; the nucleotide sequence of RT-Lgi-R1 is shown as SEQ ID NO. 18.
The invention provides a promoter pEXPA2 capable of high-expressing target genes in the fiber elongation period of cotton and the initial stage of secondary wall development (about 5-20 days after flowering). Since Lg expression runs through the whole period of the secondary wall development of the green cotton fiber, the mass accumulation of the wood plug in the period of the secondary wall is promoted, and the yield and quality of the green fiber are reduced. Based on this, by decreasing the expression of Lg at the initial stage of the fiber secondary wall, the deposition of wood plug (pigment) in the fiber secondary wall is delayed, thereby reducing the influence of competition between wood plug and cellulose on the development of the fiber secondary wall, and more cellulose is accumulated in the fiber, thereby realizing improvement of green fiber with less influence on the coloring of green fiber (schematic diagram see fig. 1). The invention can reduce the effect on fiber coloring after manipulating Lg and accumulate more cellulose by reducing the expression level of Lg in the early stage of fiber secondary wall development. Thus, the promoter pEXPA of the present invention is capable of reducing the effect of competition between wood plug and cellulose on the secondary wall development of fibers by altering the original Lg expression pattern in green cotton fibers, and thereby obtaining improved green cotton fibers.
The invention provides an interference vector capable of reducing the expression level of Lg at the early stage of the development of the fiber secondary wall of cotton, comprising a promoter pEXPA and an RNAi fragment (Lg-RNAi element) for interference of Lg. The invention also provides an RNAi interference method of the green fiber gene Lg, which comprises the following steps: the host bacteria containing the interference vector are introduced into a cotton receptor. Lg originally starts to be expressed in fibers around 15 days after flowering (15 DPA), but the green fibers thus obtained are very poor and cannot be basically used. According to the invention, the expression of Lg is interfered by EXPA gene promoter pEXPA2, so that the expression level of Lg in 15-20 DPA fiber is reduced, thus Lg can only be expressed at a higher level after 20DPA, then wood plug synthesized in fiber is very little at 15-20 DPA due to very low Lg expression level, cellulose can be accumulated at a high rate before secondary wall development (before 25DPA because Lg starts to be expressed at a high level until a large amount of wood plug is accumulated in fiber, and a reaction time is needed), more cellulose is deposited in fiber, and green fiber is improved. Since Lg was expressed from 15DPA to 20DPA and EXPA a was expressed from 5DPA to 20DPA, both Lg and EXPA2 were expressed in fibers from 15 days to 20 days after re-flowering (Lg was not expressed in fibers before 15 days, EXPA2 was not expressed or the expression level was low in fibers after 20 days), and therefore Lg-RNAi element was expressed using EXPA2 gene promoter and reduced in fibers from 15 to 20DPA (initial secondary wall development).
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions of the prior art, the drawings that are needed in the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a schematic diagram of Lg-RNAi elements;
FIG. 2 is a schematic diagram of pEXPA-Lg-RNAi-interfering vector T-DNA;
FIG. 3 is a schematic diagram of a pEXPA-Lg-RNAi vector construction procedure;
FIG. 4 is a graph of the results of a conventional PCR assay for ELgi materials, wherein the band of interest 666bp, M, marker, ELg-RNAi represents plants amplified with the band of interest, +, positive control, -, negative control;
FIG. 5 is a graph of results of measurement of Lg expression levels in fibers 15 days after ELgi white cotton flowers, DPA, days after flowers;
FIG. 6 is a flow chart for the acquisition of fine transgenic hybrid green cotton EGi;
FIG. 7 is a diagram of FLGT background detection results of EGi plants, wherein 497bp of the target band, M, markers, 1-3 represent plants amplified with the target band, +, positive control, -, negative control;
FIG. 8 is a graph showing the results of the levels of Lg expression in fibers 15 days after flowering of transgenic hybrid green cotton;
FIG. 9 is a diagram of transgenic hybrid green cotton EG, high quality transgenic hybrid green cotton EGi, transgenic green cotton FLGT, and conventional green cotton T2G2 mature fiber; BAR = 1cm;
FIG. 10 shows color difference data of mature fibers of transgenic hybrid green cotton EG, high-quality transgenic hybrid green cotton EGi, transgenic green cotton FLGT and conventional green cotton T2G2, wherein EG 1-4 are EG lines, EGi-4 are EGi lines, FLGT are transgenic green cotton (female parent), and T2G2 is high-quality green cotton material;
FIG. 11 is a diagram showing the T2G2 mature fiber fraction of transgenic hybrid green cotton EG, high quality transgenic hybrid green cotton EGi, transgenic green cotton FLGT, and conventional green cotton.
Detailed Description
The invention provides a promoter pEXPA capable of highly expressing a target gene in the elongation period and the early development stage of secondary walls of cotton fibers, wherein the nucleotide sequence of the promoter pEXPA is shown as SEQ ID NO.1, and the promoter is specifically as follows:
ggtgttcgaacggtttacaaaatgtaatttcaaaaattttgattattcgaagttggattaaattttatttttatttaatgtataattaattttaattttttatgacatacaaataaatattttatatttaaaataataaaaatactcttaggtgtgtttgggtgagaaatttgtaggatgaaattcatttgtaccaaagttttcgaaattttaaaaataaatctacttgtttgggtaaatatatttgaaaattttaaaatttgtgagtaatttcaagagagaattttaatagttcaatttttttttcatattccatttaaatagatggttttcaaaatttcccacaattttatttgattaatacacatgatctcactataaggtaaaaatttaaacttcaaaattcatttttttaattataatatatatttttaaaatttattttattaaaaatatttaaattttttttacaaatataatgatatccatattacatttttatattatttatttttaatataattattcttttttaattattttaaaaattttaaatttccattaacctaattatttttataaataacttatttatataaataaagaaattaaaaatcctaacattttaaaattttcagaaattcgttcttggaaaattattgttttctagaaatatatgaaaaatactttaaaattttgtcaaataatatttaaaattcataaaataaagctcattttgtcaacataagtttagaaataaaaatccaaaaatgaatatgaaaaaaaattaagaaccaaatcaaattaaattatgattagaagttcaaaaaatctaaaatatcccatcaaaccaatatcacccctaaattaaatgaggtcatatttaacatattaaaaaaatattttgaaactctagaaaaatatataaaagtaaatttattggtgagagattagacagtcaatgcacccctcaatgaatagatattattcccaatgaaagttatgtttttaaccctaccaaaaactcaaatgtctcaagagacgcggcctgagtagtgactaggtagcgggtaacaatactacaacccataagtgctttatagcatatggatcatgggtttagctttgaatcccataaagtacaaatactgaggtttctttagtgatgatcatgcatggacacatgatgtctctttttaggcatttgataaactcttcattttttcatacaatttcttcactcactcaaattcttaaattttcaataaaattagaaaacaatcctcaaaaataatatccatacgttgaacgatttatcaattttcgactaacgacacttcaaaaaattagaaaatcataaaaaaatttcttaaaaaaaaattatactaactttctaattttagttaattaaattttaattattttattattttattactattaaaagtgtaacttacactcaactattagtaagtttacgttttgatcacttaattttaaaaagttaaaaaatggtctttgaactattcgaaagttttcatttaagttattggaatatttaaaagtttttatttaagtcactgggttgttaagtttttttttaaaagttcggttagcaagtcccaagccacgatttgataattggtacaatggattagtacttattgacgagtagaacatacattaggtccaagttgatatgacagtcagtgtcgaaaatcgaaaagaaagctatttggattttgattcgtaaattcatgacttgaaagttggttcataaaaaagaactaaagtgtaggaggaaaggggaagaaaagcttttgattggcgcaagtggtgcgaataaagaagaccgcacaacaacgattttaataacttagtaatttaaatgtaaagttttcaataatttaatgaccattttataatattttcaagttaggtgaggaaaacttactaagagttagttacccctgttaacataactttcatgaagtaatagaaacttttagtatcatcttatatagaacaatttctattttcacaaagtcaagaaaattgtattctaaaaaatggcgacttcttcaccttcagtccttccctgatcagcgcttgtgaaaaacgaaaaacctgagtctgattggctgactgaaaatgaacctactcatcaccattcactattaccaacttcaaatgataggggaattaactggtaaagtgtaactccaccgatggttgaggtggttggctggagttaaatgagattttttttagttttgttttaagtggcttcaattgcaagcaattaggatactgcgctggaacaactccttgctcaaccttccgccattgttatggtttaattaaacattatgtttccatccatctatatttatatccattaaaacaagtcgttgagcaaataatggatactggataccatcatatctatgattaaaattttgcatgtgcccttttaatgtatagcttaattatcctccaaatttgtactctttcaccactaattagctacgtacgttacttagctttgcttgtcgtcatcttctgtactacaaactctttctctttttgtataaatagctatacactttttctctcctcaaatcaataaggttaggtcagcc.
The invention also provides application of the promoter pEXPA2 in improving the expression quantity of target genes in cotton.
In the present invention, the expression site of the target gene is preferably cotton fibers 5 to 20 days after flowering, that is, the expression site of the target gene is cotton fibers in the elongation stage and/or in the early stage of secondary wall development, and more preferably cotton fibers 15 to 20 days after flowering.
In the invention, the promoter pEXPA is preferably obtained by amplifying a upland cotton Ji cotton 14' genome DNA serving as a template; the amplification primers of the promoter pEXPA2 preferably include pEXPA2-F and pEXPA2-R; the pEXPA-F is preferably shown as SEQ ID NO.2, specifically: GCCCGGGACTAGTACGGATCCGTGGCTGACCTAACCTTATTGA; the pEXPA-R is preferably shown as SEQ ID NO.3, specifically: AAGGTTAAATTAGAAAAGCTTGGTGTTCGAACGGTTTACAA. In the invention, the sequence directions are all 5 'end to 3' end, and the same applies below. The primers pEXPA-F and pEXPA-R of the invention add homology arms (lowercase) for subsequent construction of homologous recombinant vectors. In the present invention, the amplification system of the promoter pEXPA is preferably: 2X PrimeSTARMAX Premix. Mu.l of pEXPA-F/R primer each at a concentration of 2. Mu. Mol/L was added to 1. Mu.l of each of the template DNA 80ng, and ddH 2 O was added to 50. Mu.l. The amplification procedure of the promoter pEXPA is preferably a pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 58℃for 30s, extension at 72℃for 3min,35 cycles; finally, the extension is carried out for 10min at 72 ℃.
The invention also provides an expression cassette capable of reducing the expression level of Lg at the early stage of the development of the fiber secondary wall of cotton, which comprises the promoter pEXPA and RNAi fragments for disturbing Lg.
In the present invention, the nucleotide sequence characteristics of the RNAi fragment for interference of Lg (Lg-RNAi element) are shown in FIG. 2; the nucleotide sequence of the RNAi fragment for interference of Lg is preferably shown as SEQ ID NO.4, specifically:
gagttgctcttcttcactagaaaaattgcctctcttaatattaggtctcaaataattagtccatcgaagcctgcaactttttccacacctgtttaaaccagctaaagctggtactgatttccatttgctatgaccatgtttctgaatgtaatctacaagaatcctgtcttcctcaggtgtccatggcccttttttcaggccatttttatcgttgcccttcatccctgcaaaacacaaaaagctatcatatgatatgatcatcacaaaaaatgttgctcatttacattggttgaaagcttttcaaacctttgaattggattatgggagaagagaataatgatgggatgtagttcaagtgttggaattgtgagaaagtgggatgaagggcaacgataaaaatggcctgaaaaaagggccatggacacctgaggaagacaggattcttgtagattacattcagaaacatggtcatagcaaatggaaatcagtaccagctttagctggtttaaacaggtgtggaaaaagttgcaggcttcgatggactaattatttgagacctaatattaagagaggcaatttttctagtgaagaagagcaactc.
the invention also provides an interference vector pEXPA-Lg-RNAi capable of reducing the expression level of Lg in the early stage of the development of the fiber secondary wall of cotton, which comprises a promoter pEXPA and an RNAi fragment for interference of Lg.
In the present invention, the nucleotide sequence of the RNAi fragment for interference of Lg is preferably as shown in SEQ ID NO. 4; the backbone carrier of the interfering carrier preferably comprises pLGN-35S, see patent CN 111826386B; the promoter pEXPA is preferably inserted between the HindIII and BamHI cleavage sites of pLGN-35S, replacing the original 35S promoter on pLGN-35S.
In the present invention, the T-DNA segment of the interfering vector pEXPA-Lg-RNAi is shown in FIG. 3; the T-DNA of the interfering vector pEXPA2-Lg-RNAi preferably has the following characteristics: 5'-LB left border-fusion gene expression cassette of cauliflower mosaic virus 2X35S promoter-reporter gene GUS and marker gene NPTII-Agrobacterium opine synthase gene terminator Nos-promoter pEXPA-LgRNAi nucleotide sequence expression cassette-Agrobacterium opine synthase gene terminator Nos-RB right border-3'.
The invention also provides a construction method of the interference carrier, which comprises the following steps:
Taking genomic DNA of upland cotton Ji cotton 14' as a template, and carrying out PCR amplification by using primers pEXPA-F and pEXPA-R to obtain pEXPA fragment with a homologous arm;
double enzyme digestion is carried out on pLGN-35S vector by HindIII and BamHI, and the original 35S promoter on pLGN-35S vector is removed, so as to obtain a first linearization plasmid;
carrying out homologous recombination on the first linearization plasmid and the pEXPA fragment with the homology arm to obtain a pLGN recombinant vector containing pEXPA 2;
Double digestion is carried out on the pLGN recombinant vector containing pEXPA < 2 > by adopting BamHI and EcoRI to obtain a second linearization plasmid;
Taking genomic DNA of upland cotton 'T586' as a template, and carrying out PCR amplification by using primers ELgi-F1 and ELgi-R1 to obtain a complementary strand of the Lg-RNAi element; the nucleotide sequence of ELgi-F1 is shown in SEQ ID NO. 5; the nucleotide sequence of ELgi-R1 is shown as SEQ ID NO. 6;
Taking genomic DNA of upland cotton 'T586' as a template, and carrying out PCR amplification by using primers ELgi-F2 and ELgi-R2 to obtain an intron-positive strand of the Lg-RNAi element; the nucleotide sequence of ELgi-F2 is shown as SEQ ID NO. 7; the nucleotide sequence of ELgi-R2 is shown as SEQ ID NO. 8;
And mixing the second linearization plasmid, the complementary strand of the Lg-RNAi element and the intron-positive strand of the Lg-RNAi element, and carrying out recombination reaction to obtain the interference vector.
The construction flow of the construction method of the invention is shown in fig. 4.
The invention uses the genome DNA of upland cotton Ji cotton 14' as a template, and uses primers pEXPA-F and pEXPA-R to carry out PCR amplification to obtain pEXPA2 fragment with homologous arm. After the PCR amplification, the target fragment is recovered for standby, as follows. The method for extracting the genome DNA is not particularly limited, and a conventional method is adopted. In the present invention, the 'Ji cotton 14' is given away by Hebei university of agriculture.
The invention adopts HindIII and BamHI to double enzyme cut pLGN-35S carrier, removes the original 35S promoter on pLGN-35S carrier, and gets the first linearization plasmid. The original 35S promoter on pLGN-35S vector was excised by the double enzyme and linearized. The double enzyme digestion conditions are not particularly limited, and the conditions conventional in the art can be adopted.
After pEXPA fragment with homology arm and first linearization plasmid are obtained, the first linearization plasmid and pEXPA fragment with homology arm are subjected to homologous recombination to obtain pLGN recombinant vector containing pEXPA 2. The system of the homologous recombination is not particularly limited, and the present invention may employ conditions conventional in the art.
After obtaining pLGN recombinant vector containing pEXPA2, the present invention uses BamHI and EcoRI to double cleave the pLGN recombinant vector containing pEXPA2 to obtain a second linearized plasmid.
The invention uses the genomic DNA of cotton-upland green cotton 'T586' as a template, and uses primers ELgi-F1 and ELgi-R1 to carry out PCR amplification to obtain the complementary strand of the Lg-RNAi element (figure 2); the nucleotide sequence of ELgi-F1 is shown in SEQ ID NO.5, and specifically comprises the following steps: TGGAATTGTGAGAAAGTGGGATGAAGGGCAACGATAAAAAT; the nucleotide sequence of ELgi-R1 is shown as SEQ ID NO.6, and specifically comprises the following steps: AGGTTAGGTCAGCCACGGATCCACGAGTTGCTCTTCTTCACTAG.
The invention uses the genomic DNA of upland cotton 'T586' as a template, and uses primers ELgi-F2 and ELgi-R2 to carry out PCR amplification to obtain an intron-positive strand of the Lg-RNAi element (figure 2); the nucleotide sequence of ELgi-F2 is shown as SEQ ID NO.7, and specifically comprises the following steps: CTCATTAAAGCAGGGAATTCGATTGAGTTGCTCTTCTTCACTAG; the nucleotide sequence of ELgi-R2 is shown as SEQ ID NO.8, and specifically comprises the following steps: CCCACTTTCTCACAATTCCA. In the present invention, the system for PCR amplification using primers ELgi-F2 and ELgi-R2 is preferably: 2X PrimeSTARMAX Premix. Mu.l of F/R primer at a concentration of 2. Mu. Mol/L each, about 80ng of template DNA, and ddH 2 O to 50. Mu.l were added. The amplification procedure for PCR amplification using primers ELgi-F2 and ELgi-R2 is preferably: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 58℃for 30s, extension at 72℃for 3min,35 cycles; finally, the extension is carried out for 10min at 72 ℃.
After the second linearization plasmid, the complementary strand of the Lg-RNAi element and the intron-positive strand of the Lg-RNAi element are obtained, the invention mixes the second linearization plasmid, the complementary strand of the Lg-RNAi element and the intron-positive strand of the Lg-RNAi element, and carries out recombination reaction to obtain the interference vector.
The method of the gel recovery and recombination reaction in the present invention is not particularly limited, and those skilled in the art can adopt a conventional method.
The invention also provides a host bacterium comprising the interference vector described in the scheme or the interference vector obtained by the construction method. In the present invention, the original strain of the host strain is preferably Agrobacterium.
The invention also provides an RNAi interference method of the green fiber gene Lg, which comprises the following steps: the host bacteria described in the above protocol were introduced into cotton receptors.
In the present invention, the cotton receptor is preferably white cotton, more preferably seedling hypocotyl of white cotton; the variety of the white cotton is preferably upland cotton 'Yuzao No. 1', and the obtained transgenic cotton is the transgenic ELgi white cotton.
In the present invention, the introduction of the host bacteria into the cotton receptor is preferably accomplished by the Agrobacterium-dip method. The method for the agro-bacterial dip-dyeing is not particularly limited, and a person skilled in the art can adopt a conventional agro-bacterial dip-dyeing method.
The invention also provides the promoter pEXPA2, the expression cassette, the interference vector obtained by the construction method, the host bacterium or the application of the RNAi interference method in constructing transgenic cotton, improving green cotton fibers and/or improving the yield of the green cotton fibers.
In the present invention, the modified green cotton fiber preferably comprises one or more of 1) to 5): 1) Increasing the length of green cotton fibers; 2) The breaking specific strength of the green cotton fiber is increased; 3) Increasing the micronaire value of the green cotton fiber; 4) The elongation of the green cotton fiber is increased; 5) The content of the green cotton fiber clothing component is improved. In the present invention, the cotton in the modified green cotton fiber preferably comprises green cotton. The color of the cotton fiber after improvement of the invention does not change obviously.
The invention also provides a method for creating transgenic hybrid green cotton, which comprises the following steps:
Introducing the host bacteria into a cotton receptor, and culturing the cotton receptor to obtain transgenic cotton;
hybridization is carried out by taking the transgenic cotton as a male parent and green cotton as a female parent to obtain an F1 generation;
Sowing the F1 generation to obtain an F1 generation plant, reserving a plant with green mature fibers in the F1 generation plant, and collecting seeds to obtain an F2 generation;
sowing the F2 generation to obtain an F2 generation plant, and identifying whether the F2 generation plant contains an interference vector or not through a molecular biological means.
The host bacteria of the scheme are firstly introduced into a cotton receptor, and the cotton receptor is cultured to obtain transgenic cotton. The method of the present invention is not particularly limited, and conventional methods in the art may be employed.
After culturing the cotton receptor, the invention preferably further comprises identifying whether the host bacteria containing the interference vector are successfully introduced into the cotton plant obtained by culture. In the present invention, the identification of whether the host bacteria containing the interference vector is successfully introduced into the cotton plant obtained by culture preferably comprises the following steps: extracting genome DNA of a plant to be detected, carrying out PCR amplification by using the genome DNA as a template and adopting primers ELgi-F3 and pEXPA-R1, and judging the plant to be detected as a positive plant (transgenic ELgi plant) if 666bp fragments are obtained by amplification, namely, successfully transferring an interference vector into receptor cotton. In the invention, the nucleotide sequence of ELgi-F3 is shown as SEQ ID NO.9, and specifically comprises the following steps: AAGTGGGATGAAGGGCAACG; the nucleotide sequence of pEXPA-R1 is shown as SEQ ID NO.10, and specifically comprises the following steps: CACCGATGGTTGAGGTGGTT; the reaction system for PCR amplification using primers ELgi-F3 and pEXPA-R1 is preferably: 2X Phanta Max MasterMix. Mu.L; 1. Mu.L of each primer F/R at a concentration of 2. Mu.M; about 80ng of template DNA; add ddH 2 O to 10 μl; the amplification procedure for PCR amplification using primers ELgi-F3 and pEXPA-R1 is preferably: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 20s, extension at 72℃for 50s,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
After identifying successful introduction of the host strain containing the interfering vector into the cotton plant obtained by the cultivation, the present invention preferably further comprises identifying whether the interfering vector is functional in the cotton plant. In the present invention, the identification of whether the interfering vector is functionally preferred in cotton plants comprises the steps of: the primers RT-Lgi-F and RT-Lgi-R are adopted to carry out quantitative PCR detection on transgenic cotton fiber cDNA 15 days after flowering, when the expression level of Lg in a positive plant to be detected is lower than that of a wild plant 'Yu early No. 1', the interference vector is judged to have functions in a cotton plant, the plant is considered to have an effect, the introduction of the interference vector pEXPA-Lg-RNAi is proved, the Lg gene can be successfully interfered, and the expression level of the Lg gene in fibers 15-20 days after flowering is reduced. In the invention, the nucleotide sequence of RT-Lgi-F is shown as SEQ ID NO.11, and specifically comprises the following steps: TCATGCACTTATGGGCAACAAC; the nucleotide sequence of RT-Lgi-F is shown as SEQ ID NO.12, and specifically comprises the following steps: TCAGGTGAGTCTTTGGGCTG. In the present invention, the reaction system for quantitative PCR detection is preferably: 1. Mu.L of cDNA template, 0.5. Mu.L of each F/R primer at a concentration of 2. Mu.M, 2xSYBR-Green PCR Mastermix. Mu.L, and ddH 2 O to 10. Mu.L. In the present invention, the reaction procedure for quantitative PCR detection is preferably: pre-denaturation at 95℃for 3min;95 ℃ for 5s,57 ℃ for 20s,40 cycles; 65-95 ℃ (in 0.5 ℃ inc), 10s/step; the internal reference gene detected by the quantitative PCR is preferably GhActin4, and the primers for amplifying the internal reference gene are preferably GhAct-F and GhAct-R; the nucleotide sequence of GhAct-F is shown as SEQ ID NO.13, and specifically comprises the following steps: TTGCAGACCGTATGAGCAA; the nucleotide sequence of GhAct-R is shown as SEQ ID NO.14, and specifically comprises the following steps: ATCCTCCGATCCAGACACTG.
In the invention, the Lg expression level of the constructed transgenic cotton can be reduced in cotton fibers about 15-20 days after flowering, and various indexes of the obtained transgenic cotton fibers are improved.
In the present invention, the transgenic cotton is preferably transgenic white cotton.
After the transgenic white cotton is obtained, the transgenic hybrid green cotton can be obtained by utilizing the hybridization of the transgenic white cotton and the transgenic green cotton.
After the transgenic cotton is obtained, the invention uses the transgenic cotton as a male parent and green cotton as a female parent to carry out hybridization to obtain F1 generation. In the present invention, the green cotton may be wild type green cotton or transgenic green cotton, wherein the transgenic green cotton is transgenic green cotton having no altered Lg expression pattern. In the present invention, the varieties of transgenic green cotton preferably include 'FLGT'; sources of 'FLGT' materials see (Chen,Z.,Li,Y.,Teng,Z.,Zhang,Y.,Liu,Y.,Suo,Q.,Wang,Y.,Zeng,J.,Liang,A.,Yan,Q.,Liu,D.,Liu,N.,Fang,N.,Liu,H.,Zhang,Z.,Xiao,Y.,2023.Cotton green fiberpromotes suberin synthesis interfering cellulose deposition in the secondary cell wall.Industrial Crops and Products 194,10.1016/j.indcrop.2023.116346). in the present invention, the crossing is preferably artificial pollination of pollen from the male parent into the female parent.
After the F1 generation is obtained, the F1 generation is sown to obtain an F1 generation plant, the mature fiber in the F1 generation plant is reserved to be a green plant, and seeds are collected to obtain an F2 generation.
F2 generation is obtained through separation and screening of F1 generation, and the excellent genetically modified hybrid green cotton strain with stable inheritance can be obtained through selfing, separation and screening of F2 generation.
After the F2 generation is obtained, the invention preferably further comprises the step of identifying whether the F2 generation plant contains an interference vector or not through a molecular biological means.
In the present invention, the identification of whether the F2 generation plant contains the interfering vector by means of molecular biology preferably comprises the following steps: extracting genome DNA of an F2 generation plant, taking the genome DNA of the F2 generation plant as a template, and carrying out PCR (polymerase chain reaction) amplification by using a primer ELgi-F3 and a primer pEXPA-R1, wherein if a 666bp fragment is obtained by amplification, the F2 generation plant is judged to contain an interference vector; the nucleotide sequence of ELgi-F3 is shown as SEQ ID NO. 9; the nucleotide sequence of pEXPA-R1 is shown as SEQ ID NO. 10. In the present invention, the system and procedure for PCR amplification using primer ELgi-F3 and primer pEXPA-R1 are described above, and are not described in detail herein.
After identifying that the F2 generation plant contains the interference vector, the invention preferably also comprises identifying whether the F2 generation plant is a offspring of the female parent, namely identifying whether the F2 generation plant has the genetic background of the female parent. In the present invention, when the female parent is transgenic green cotton 'FLGT', identifying whether the F2 generation plant is a progeny of the female parent preferably comprises the steps of: extracting genome DNA of the F2 generation plant, taking the genome DNA of the F2 generation plant as a template, adopting primers FLgT-F and FLgT-R to carry out PCR amplification, and judging that the F2 generation plant is a offspring of a female parent if a 497bp fragment is obtained by amplification; the nucleotide sequence of FLgT-F is shown as SEQ ID NO.15, and specifically comprises the following steps: AGTCCATCGAAGCCTGCAAC; the nucleotide sequence of FLgT-R is shown as SEQ ID NO.16, and specifically comprises the following steps: ACACATACACAACAATCCACACAC. In the present invention, the reaction system for PCR amplification using primers FLgT-F and FLgT-R is preferably: 2X PhantaMax Master Mix. Mu.L; 1. Mu.L of each primer F/R at a concentration of 2. Mu.M; 80 ng of template DNA; ddH 2 O was added to 10. Mu.L; the reaction procedure for PCR amplification using primers FLgT-F and FLgT-R is preferably: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 20s, extension at 72℃for 50s,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
After identifying the progeny of the F2 plant that contains the interfering vector and is female, the present invention preferably also includes identifying whether the interfering vector in the F2 plant is functional. In the present invention, the identification of whether the interfering vector in the F2 generation plant plays a role preferably comprises the following steps: quantitative PCR detection is carried out on cotton fiber cDNA of F2 generation plants 15 days after flowering by adopting primers RT-Lgi-F1 and RT-Lgi-R1, if the expression of Lg at 15DPA is reduced, the interference element (interference vector) of Lg plays a role; the nucleotide sequence of RT-Lgi-F1 is shown as SEQ ID NO.17, and specifically comprises the following steps: TTTGGTTCTTCTTCGTCATCA; the nucleotide sequence of RT-Lgi-R1 is shown as SEQ ID NO.18, and specifically comprises the following steps: CATGGTGATCATCTACAATAGTC. The detection system and the program for quantitative PCR detection of cotton fiber cDNA of positive plants 15 days after flowering by adopting primers RT-Lgi-F1 and RT-Lgi-R1 are the same as the quantitative PCR detection method of positive plants in the scheme.
For further explanation of the present invention, the following description will be given in detail of an RNAi interference method of green fiber gene Lg and its application in modifying green fiber with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.
Example 1: pEXPA2 construction of 2-Lg-RNAi interference vector
Since the expression of Lg in green cotton fibers is still high from 15 days after flowering to the later stage of the entire fiber secondary wall development (35 days after flowering), for improving green cotton fibers, it is appropriate to reduce the expression level of Lg in the earlier stage of the fiber secondary wall development, which can reduce the influence on fiber coloration after manipulating Lg and accumulate more cellulose. Transcriptome data of tissues of the whole development period of white cotton 'Ji cotton 14' and green cotton 'T586' (including cotton fibers of different periods) are analyzed, and the EXPA gene is mainly expressed at a high level in fibers 5-20 days after flowering, and the expression of the EXPA gene can be detected in fibers 25 days after flowering, but the expression level is lower. The analysis result shows that the EXPA gene and Lg have an overlapping period of about 5 to 10 days (the main overlapping period is about 5 days), so that the promoter of EXPA gene is selected to manipulate the expression level of Lg in this example for improving green cotton fiber.
Taking genomic DNA of upland cotton 'Ji cotton 14' as an amplification template, utilizing pEXPA-F/R primers (table 2), the sequence characteristics are shown as SEQ ID NO.2 and SEQ ID NO.3, obtaining pEXPA fragment with a homology arm, recovering glue for standby, carrying out double enzyme digestion on a pLGN vector by HindIII and BamHI, removing an original 35S promoter on the vector, linearizing the promoter, carrying out homologous recombination on the vector with the fragment pEXPA2 after recovering the glue, obtaining pLGN recombinant vector containing pEXPA2, carrying out double enzyme tangential linearization on the pLGN recombinant vector containing pEXPA2 by enzymes BamHI and EcoRI, and recovering glue for standby; the complementary strand of the Lg-RNAi element was amplified using the genomic DNA of upland cotton 'T586' as a template with primer ELgi-F1/R1 (Table 2) (FIG. 2), and the intron-positive strand of the Lg-RNAi element was amplified using primer ELgi-F2/R2 (Table 2), with the following system: 2X PRIMESTAR MAX PREMIX. Mu.l of F/R primer (2. Mu. Mol/L) each 1. Mu.l, about 80ng of template DNA, and ddH 2 O was added to 50. Mu.l. Preferred amplification procedures are: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 58℃for 30s, extension at 72℃for 3min,35 cycles; finally, the amplified fragment gel is recovered after being extended for 10min at 72 ℃, and then the amplified fragment gel is subjected to recombination reaction with the linearized pLGN vector containing pEXPA to obtain a pEXPA2-Lg-RNAi interference vector (figures 3 and 4).
Example 2, ELGi acquisition of transgenic cotton
The obtained pEXPA-Lg-RNAi interference vector is introduced into agrobacterium LBA4404 by an electric excitation transformation method, and then genetic transformation of cotton is carried out by a method mediated by agrobacterium tumefaciens, wherein the cotton receptor is upland cotton 'Yu Zao 1'. Firstly, cotton seeds are removed from cotton hulls, sterilized with 75% alcohol for 5min, sterilized with 10% hydrogen peroxide for 15min, sterilized with water for 5-6 times, placed in a germination medium for germination for 2 days, and then the germinated seeds are inserted into the germination medium for further dark culture for 3 days. Activating the agrobacterium with interference carrier, and expanding culture to make the concentration OD600 reach 0.8-1.0. Cutting the hypocotyl of cotton seedling into small sections of about 1cm, then re-suspending the thalli by using a co-culture medium, putting the cut hypocotyl small sections into the re-suspension for infection for 1-2 h, discarding bacterial liquid, putting the hypocotyl on a solid co-culture medium, and culturing in dark for 2 days. The hypocotyl was then transferred to a sieve medium, 15 days later to the hypocotyl medium, and 15 days later for a second time until callus was grown. The calli were transferred to the callus induction medium for 15 days for a further time until embryogenic calli were differentiated. Embryogenic callus was placed in liquid suspension medium and spread on embryo elongation medium after 15 days, and green embryos were grown after one week. The embryo is selected onto new embryo elongation medium, embryoid is grown after 15 days, embryoid is inserted into seedling medium, leaves are differentiated, new root is grown, and complete plantlet is obtained.
Table 1, medium formulations used in example 2
Example 3 identification of ELgi transgenic plants
In example 2, the obtained transgenic cotton plant also needs to identify whether it is a ELgi transgenic plant of the pEXPA-Lg-RNAi interference vector which is successfully recombined, firstly, extracting genomic DNA from all obtained tissue culture seedlings, and amplifying the extracted genomic DNA of the tissue culture seedlings by using a primer ELgi-F3 and a primer pEXPA2-R1 (table 2), wherein the extraction method of the genomic DNA is not particularly limited, and the PCR reaction system is as follows: 2X Phanta Max MasterMix. Mu.L of primer F/R1. Mu.L (2. Mu.M) each, about 80ng of template DNA, and ddH 2 O to 10. Mu.L. The amplification procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 20s, extension at 72℃for 50s,35 cycles; finally, the amplification is carried out at 72 ℃ for 5min, 666bp fragments are obtained, and positive ELgi plants can be identified through electrophoresis analysis (figure 5).
The identified positive ELgi plants also need to detect whether pEXPA-Lg-RNAi elements exert corresponding functions, so that positive ELgi cotton fibers 15 days after flowering need to be subjected to RNA extraction, then reverse transcription is performed to obtain total cDNA, and the quantitative expression detection of Lg is performed by using a primer RT-Lgi-F/R (Table 2), when the expression level of Lg in transgenic ELgi plants is lower than that of wild type plants 'Yu early 1', the plants are considered to be effective, so that the introduction of interference vector pEXPA2-Lg-RNAi can be successfully performed, the Lg genes can be interfered, the expression level of the Lg genes in fibers 15-20 days after flowering can be reduced, hybridization can be performed with green cotton, and the next material creation is performed (FIG. 6). PCR reaction system: 1. Mu.L of cDNA template, 0.5. Mu.L of F/R primer (2. Mu.M) each, 2xSYBR-Green PCR Mastermix. Mu.L, and ddH 2 O to 10. Mu.L. PCR reaction procedure: pre-denaturation at 95℃for 3min;95 ℃ for 5s,57 ℃ for 20s,40 cycles; 65-95 ℃ (in 0.5 ℃ inc), 10s/step. The reference gene was GhActin4 and the amplification primer was GhAct-F/R (Table 2).
Table 2 primers used in the examples
Example 4 hybridization acquisition of good transgenic Green Cotton fibers
The identified transgenic ELgi white cotton was used as male parent, its pollen was artificially fed into female parent transgenic green cotton 'FLGT', the 'FLGT' was all sown for the F1 generation obtained by transgenic green cotton (Chen et al.,2023)(Chen,Z.,Li,Y.,Teng,Z.,Zhang,Y.,Liu,Y.,Suo,Q.,Wang,Y.,Zeng,J.,Liang,A.,Yan,Q.,Liu,D.,Liu,N.,Fang,N.,Liu,H.,Zhang,Z.,Xiao,Y.,2023.Cotton green fiber promotes suberin synthesis interfering cellulose deposition in the secondary cell wall.Industrial Crops and Products 194,10.1016/j.indcrop.2023.116346),, the fiber color was checked after fiber maturation, the F1 generation plants of white fibers were removed, all the mature fiber green plants were retained, and seeds were harvested (FIG. 7). Taking a part of seeds (about 400 seeds) to be planted in a seedling raising tray, numbering plants after true leaves grow, firstly carrying out GUS staining, reserving stained positive plants, then extracting genome DNA of the reserved plants, and amplifying the extracted genome DNA by adopting a primer ELgi-F3 and a primer pEXPA-R1 (table 2), wherein if 666bp fragments are obtained by amplifying sample DNA, the obtained fragments are regarded as positive ELgi plants.
Plants considered positive ELgi also required amplification of their genomic DNA with primer FLgT-F/R (table 2) to confirm that the green cotton obtained was a progeny of FLGT, but not wild-type, i.e., that the progeny green cotton had a FLGT genetic background; the PCR reaction system is as follows: 2X PhantaMax Master Mix. Mu.L of primer F/R1. Mu.L (2. Mu.M) each, about 80ng of template DNA, and ddH 2 O to 10. Mu.L. The amplification procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 20s, extension at 72℃for 50s,35 cycles; finally, the strain is extended for 5min at 72 ℃, 497bp fragments are obtained through amplification, and positive FLGT plants can be identified through electrophoresis analysis (FIG. 8). The plants obtained so far can be considered FLGT plants containing ELgi genetic background.
Example 5 identification of Excellent transgenic hybrid Green Cotton EGi
FLGT plants which are considered to contain ELgi genetic background are only characterized by genetic material, but it is also necessary to determine whether the genetic material plays a corresponding role from a molecular level, so that fibers 15 days after flowering of these plants are subjected to RNA extraction, reverse transcription to obtain total cDNA, and then quantitative PCR detection of cDNA is carried out by using primers RT-Lgi-F1 and RT-Lgi-R1 (Table 2), respectively, with the same detection system and procedure as those of the quantitative PCR detection method of transgenic ELgi white cotton. The results show that: the reduced expression of Lg at 15DPA suggests that the Lg interfering element functions, and that we obtained cotton was transgenic hybrid cotton EGi containing Lg interfering element and FLGT a genetic background, and reduced Lg expression levels in 15DPA fibers (fig. 9).
Example 6, yield and quality analysis of good transgenic hybrid Green cotton EGi
Mature fiber display of excellent transgenic hybrid green cotton EGi is shown in fig. 10, mature fibers of the material in fig. 10 are ground into fine powder, the fine powder passes through a 80-mesh screen, and detection and comparison are carried out on various green cotton fiber powders by using a portable color difference meter, and data show that the value a of the excellent transgenic hybrid green cotton EGi is smaller and is reduced by 0.95-1.68 (EGi maximum value 0.13, minimum value-0.15 and 1.52 of comparative FLGT and 1.08 of T2G 2) compared with FLGT and T2G2, and the value a is the red-green degree reaction of the fibers, and the smaller the value a is, the more green the fibers are indicated. In addition, the brightness L value of EGi fibers is also generally better (larger L values indicate higher fiber brightness), and EGi strain 2 fibers can reach 72.47, in contrast to 62.06 of FLGT and 65.20 of T2G2 (fig. 11). The statistical analysis of the coat-fraction of the mature various fibers shows that the coat-fraction of the excellent transgenic hybrid green cotton EGi is between 34 and 36 percent, the coat-fraction of the EG strain and 'FLGT' is only between 22 and 25 percent, and the coat-fraction of the high-quality green cotton material 'T2G2' is 33 percent and is lower than EGi. In addition, the mature fibers are sent to a cotton quality supervision and test center (Henan Anyang) in the rural agricultural department for quality detection, and the result shows that compared with green cotton 'FLGT' and 'T2G2', the fiber length, the fiber breaking specific strength, the micronaire value and the elongation of EGi are increased remarkably, and especially the fiber breaking specific strength can reach 28-31 cN-tex -1, EG and FLGT can only reach 19-21 cN-tex -1, and T2G2 can only reach 27 cN-tex -1 at most (table 3). In summary, the EGi strain of the invention can be obtained by genetic engineering (Lg interference) for 2 years, and the yield and quality are higher than those of T2G2.
TABLE 3 results of fiber examination of transgenic hybrid Green Cotton EG, high quality transgenic hybrid Green Cotton EGi, transgenic Green Cotton FLGT, conventional Green Cotton T2G2 and white Cotton mature fiber No. 1
According to the embodiment, the transgenic hybrid green cotton with good color, high yield and excellent quality can be obtained.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Claims (10)
1. A promoter pEXPA for high expression of target gene in the elongation phase and early development stage of secondary wall of cotton fiber features that the nucleotide sequence of promoter pEXPA is shown in SEQ ID NO. 1.
2. Use of the promoter pEXPA2 according to claim 1 to increase expression of a gene of interest in cotton;
preferably, the expression part of the target gene is cotton fiber 5-20 days after the cotton is opened;
Further preferably, the site of expression of the target gene is cotton fiber 15 to 20 days after flowering.
3. An expression cassette capable of reducing the expression level of Lg at the early stage of the development of the fiber secondary wall of cotton, comprising the promoter pEXPA of claim 1 and an RNAi fragment for interfering with Lg;
Preferably, the nucleotide sequence of the RNAi fragment for interference of Lg is shown in SEQ ID NO. 4.
4. An interfering vector capable of reducing the expression level of Lg at the early stage of the development of the fiber secondary wall of cotton, comprising the promoter pEXPA of claim 1 and an RNAi fragment for interfering with Lg;
preferably, the nucleotide sequence of the RNAi fragment for interference of Lg is shown in SEQ ID NO. 4;
Preferably, the backbone carrier of the interfering carrier comprises pLGN-35S; the promoter pEXPA is inserted between HindIII and BamHI cleavage sites of pLGN-35S to replace the original 35S promoter on pLGN-35S.
5. The method for constructing an interference vector as claimed in claim 4, comprising the steps of:
Taking genomic DNA of upland cotton Ji cotton 14' as a template, and carrying out PCR amplification by using primers pEXPA-F and pEXPA-R to obtain pEXPA fragment with a homologous arm;
double enzyme digestion is carried out on pLGN-35S vector by HindIII and BamHI, and the original 35S promoter on pLGN-35S vector is removed, so as to obtain a first linearization plasmid;
carrying out homologous recombination on the first linearization plasmid and the pEXPA fragment with the homology arm to obtain a pLGN recombinant vector containing pEXPA 2;
Double digestion is carried out on the pLGN recombinant vector containing pEXPA < 2 > by adopting BamHI and EcoRI to obtain a second linearization plasmid;
Taking genomic DNA of upland cotton 'T586' as a template, and carrying out PCR amplification by using primers ELgi-F1 and ELgi-R1 to obtain a complementary strand of the Lg-RNAi element; the nucleotide sequence of ELgi-F1 is shown in SEQ ID NO. 5; the nucleotide sequence of ELgi-R1 is shown as SEQ ID NO. 6;
Taking genomic DNA of upland cotton 'T586' as a template, and carrying out PCR amplification by using primers ELgi-F2 and ELgi-R2 to obtain an intron-positive strand of the Lg-RNAi element; the nucleotide sequence of ELgi-F2 is shown as SEQ ID NO. 7; the nucleotide sequence of ELgi-R2 is shown as SEQ ID NO. 8;
And mixing the second linearization plasmid, the complementary strand of the Lg-RNAi element and the intron-positive strand of the Lg-RNAi element, and carrying out recombination reaction to obtain the interference vector.
6. A host bacterium comprising the interference vector of claim 4 or the interference vector obtained by the construction method of claim 5.
7. An RNAi interference method of green fiber gene Lg, which is characterized by comprising the following steps: a method of introducing the host bacterium of claim 6 into a cotton receptor.
8. Use of the promoter pEXPA of claim 1, the expression cassette of claim 3, the interference vector of claim 4, the interference vector obtained by the construction method of claim 5, the host bacterium of claim 6 or the RNAi interference method of claim 7 in constructing transgenic cotton, improving green cotton fiber and/or increasing green cotton fiber yield.
9. A method for creating transgenic hybrid green cotton, comprising the steps of:
introducing the host strain of claim 6 into a cotton receptor, and culturing the cotton receptor to obtain transgenic cotton;
hybridization is carried out by taking the transgenic cotton as a male parent and green cotton as a female parent to obtain an F1 generation;
Sowing the F1 generation to obtain an F1 generation plant, reserving a plant with green mature fibers in the F1 generation plant, and collecting seeds to obtain an F2 generation;
sowing the F2 generation to obtain an F2 generation plant, and identifying whether the F2 generation plant contains an interference vector or not through a molecular biological means.
10. The method of claim 9, further comprising identifying whether the cultured cotton plant has been successfully introduced into a host strain containing an interfering vector after culturing the cotton receptor;
The method for identifying whether the host bacteria containing the interference vector is successfully introduced into the cotton plant obtained by culture preferably comprises the following steps: extracting genome DNA of a plant to be detected, carrying out PCR (polymerase chain reaction) amplification by using the genome DNA as a template and adopting primers ELgi-F3 and pEXPA-R1, and judging that an interference vector is successfully transferred into receptor cotton if 666bp fragments are obtained by amplification; the nucleotide sequence of ELgi-F3 is shown as SEQ ID NO. 9; the nucleotide sequence of pEXPA-R1 is shown as SEQ ID NO. 10;
after identifying that the host bacteria containing the interference vector are successfully introduced into the cotton plant obtained by culture, the invention preferably further comprises identifying whether the interference vector has functions in the cotton plant;
The identification of whether the interfering vector is functionally preferred in cotton plants comprises the steps of: the method comprises the steps of carrying out quantitative PCR detection on transgenic cotton fiber cDNA 15 days after flowering by adopting primers RT-Lgi-F and RT-Lgi-R, and judging that an interference vector has a function in cotton plants when the expression level of Lg in positive plants to be detected is lower than that of wild plants 'Yuan early No. 1'; the nucleotide sequence of the RT-Lgi-F is shown as SEQ ID NO.11, and the nucleotide sequence of the RT-Lgi-F is shown as SEQ ID NO. 12; the internal reference gene detected by the quantitative PCR is preferably GhActin4, and the primers for amplifying the internal reference gene are preferably GhAct-F and GhAct-R; the nucleotide sequence of GhAct-F is shown as SEQ ID NO. 13; the nucleotide sequence of GhAct-R is shown as SEQ ID NO. 14;
after the F2 generation is obtained, preferably, the method further comprises the step of identifying whether the F2 generation plant contains an interference vector or not through a molecular biological means;
The identification of whether the F2 generation plant contains the interference vector by the molecular biological means preferably comprises the following steps: extracting genome DNA of an F2 generation plant, taking the genome DNA of the F2 generation plant as a template, and carrying out PCR (polymerase chain reaction) amplification by using a primer ELgi-F3 and a primer pEXPA-R1, wherein if a 666bp fragment is obtained by amplification, the F2 generation plant is judged to contain an interference vector;
After identifying that the F2 generation plant contains the interference vector, preferably further comprising identifying whether the F2 generation plant is a offspring of the female parent;
When the female parent is transgenic green cotton 'FLGT', identifying whether the F2 generation plant is a progeny of the female parent preferably comprises the steps of: extracting genome DNA of the F2 generation plant, taking the genome DNA of the F2 generation plant as a template, adopting primers FLgT-F and FLgT-R to carry out PCR amplification, and judging that the F2 generation plant is a offspring of a female parent if a 497bp fragment is obtained by amplification; the nucleotide sequence of FLgT-F is shown as SEQ ID NO. 15; the nucleotide sequence of FLgT-R is shown as SEQ ID NO. 16;
After identifying the progeny of the F2 generation plant that contains the interference vector and is female parent, the invention preferably further comprises identifying whether the interference vector in the F2 generation plant is functional;
The identification of whether the interfering vector in the F2 generation plant plays a role preferably comprises the following steps: quantitative PCR detection is carried out on cotton fiber cDNA of F2 generation plants 15 days after flowering by adopting primers RT-Lgi-F1 and RT-Lgi-R1, if Lg is expressed in fibers 15 days after flowering, the interference vector plays a role; the nucleotide sequence of the RT-Lgi-F1 is shown as SEQ ID NO. 17; the nucleotide sequence of RT-Lgi-R1 is shown as SEQ ID NO. 18.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410375248.XA CN118185940A (en) | 2024-03-29 | 2024-03-29 | RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410375248.XA CN118185940A (en) | 2024-03-29 | 2024-03-29 | RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118185940A true CN118185940A (en) | 2024-06-14 |
Family
ID=91392649
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410375248.XA Pending CN118185940A (en) | 2024-03-29 | 2024-03-29 | RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118185940A (en) |
-
2024
- 2024-03-29 CN CN202410375248.XA patent/CN118185940A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103328635B (en) | fiber-selective promoter | |
| CN107090464B (en) | Insect-resistant herbicide-resistant corn transformation event and creation method and detection method thereof | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN108623665A (en) | Application of the GhHUB2 albumen in regulation and control cotton fiber length and intensity | |
| CN105039353B (en) | A kind of capsicum pollens development related gene CaMS1 and its application | |
| CN112126707B (en) | Nucleic acid molecules from corn event CA09328 and methods for detecting same | |
| CN117757836A (en) | Application of OsHR mutant gene in improving resistance of rice to brown planthopper | |
| CN103772495B (en) | A cotton macrofiber cance high-expression gene (GhLFHE1) and application thereof | |
| CN109112227A (en) | Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application | |
| CN116574724B (en) | Insect-resistant glyphosate-resistant transgenic corn event KJ1003 and detection method thereof | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN115772212A (en) | Alfalfa chloroplast MsSAP22 gene and application thereof in improving drought resistance of plants | |
| CN113151258B (en) | Flanking sequence of exogenous insertion fragment of insect-resistant transgenic maize AM63 insertion site and application thereof | |
| CN108715854A (en) | Applications of the cotton AINTEGUMENTA genes GhANT in cotton breeding | |
| CN118185940A (en) | RNAi interference method of green fiber gene Lg and application of RNAi interference method in improvement of green fibers | |
| CN109852626B (en) | GhOR gene, protein coded by GhOR gene, expression vector, transformed plant and application of GhOR gene | |
| CN108018286A (en) | Initiative, detection and the application of corn transformation event ZM8-143 | |
| CN105039398B (en) | A method of preparing male sterile pepper | |
| CN112251445B (en) | Gene GhZFP8 for regulating cotton fiber elongation and application thereof | |
| NL2030997B1 (en) | Zea mays receptor-like kinase 7 (zmrlk7) gene related to kernel and plant type development of maize and use thereof | |
| CN115976072B (en) | Histone deacetylase GhHDT3_A01 gene and application thereof, recombinant expression vector and recombinant expression method | |
| CN112813076B (en) | sgRNA composition for knocking out cotton GhTSTs gene and application of sgRNA composition in creating cotton short-fiber-free mutant | |
| CN112342218B (en) | Application of BOC1 protein in regulation and control of rice callus browning | |
| CN111088259B (en) | PhDof4 gene related to petunia anther development and application thereof | |
| AU2019460919C1 (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |