CN105039398B - A method of preparing male sterile pepper - Google Patents

Abstract

The invention belongs to pepper breeding technical fields, disclose a kind of method preparing male sterile pepper.This method comprises the following steps：S1. structure is containing such as SEQ ID NO:Shown in 1 ~ 2CaMS1The recombinant RNA i interference carriers of gene；S2. recombinant RNA i interference carriers S1 obtained convert Agrobacterium, obtain recombinational agrobacterium；S3. capsicum explant is transfected with recombinational agrobacterium, obtains transformed plant through culture, screening obtains male sterile pepper.This method prepares the material of pollen activity reduction, can further prepare hot pepper male sterile material with optimization by the improvement to the material, have important value to the selection and breeding of capsicum new varieties by building the recombinant vector containing anther specific gene.

Description

A method of preparing male sterile pepper

Technical field

The invention belongs to pepper breeding technical fields, and in particular, to a method of preparing male sterile pepper.

Background technology

Capsicum（Capsicum annum）Belong to Solanaceae（Solanaceae）Capsicum 1 year or herbaceos perennial, Fruit is a kind of global vegetables and processing and seasoning product.Capsicum is Constantly allogamous plant, and hybrid vigour is clearly, excellent The first generation of hybrid can increase production 30% ~ 50% than conventional variety.The utilization of hybrid vigour, it has also become improve yield and increasing in capsicum production Add the important means of economic benefit.But current China hybrid seeding mostly uses flower bud phase artificial emasculation, pollination, and not only breeding cost is high And it is difficult to ensure that seed purity.Half-blood is prepared using male sterile line, can not only simplify production of hybrid seeds program, reduces seed Production cost, and the purity of hybrid can be improved.Therefore, the selection and breeding and its application study of male sterile line are increasingly by people Attention.

Pollen abortion is that the phenotype that plants male sterility occurs embodies, and understands fully that the overall process of pollen development and molecule mechanism are Study basis and the key point of plants male sterility.Pollen development is related to many polygenic expression regulations, to pollen development phase The research of correlation gene is not only it will be seen that the molecular mechanism of pollen development, can also provide theoretical base for artificially creating male sterility Plinth.The knockout of these genes can lead to plant part or completely infertility, however be ground to pollen development related gene in capsicum Study carefully very few.The developmental related gene of capsicum pollens can be knocked out by RNA perturbation techniques, formulate male sterile capsicum material Material.

Invention content

In view of the deficiencies of the prior art, the present invention provides a kind of method preparing male sterile pepper, this method passes through The recombinant vector containing anther specific gene is built, the material of pollen activity reduction is prepared, passes through the improvement to the material Hot pepper male sterile material can be further prepared with optimization, has important value to the selection and breeding of capsicum new varieties.

The above-mentioned purpose of the present invention is achieved by the following technical programs.

A method of male sterile pepper is prepared, is included the following steps：

S1. structure is containing such as SEQ ID NO:Shown in 1 ~ 2CaMS1The recombinant RNA i interference carriers of gene；

S2. recombinant RNA i interference carriers S1 obtained convert Agrobacterium, obtain recombinational agrobacterium；

S3. capsicum explant is transfected with recombinational agrobacterium, obtains transformed plant through culture, it is peppery that screening obtains male sterility Green pepper.

Described in S1CaMS1The cDNA sequence of gene such as SEQ ID NO:Shown in 1, long 1919bp；GeneCaMS1Opening Reading frame sequence such as SEQ ID NO:Shown in 2, long 1758bp.

Preferably, the construction method of RNAi interference carriers described in S1 is：

S11. SEQ ID NO are utilized:Sense primer shown in 3 ~ 4 expands to obtainCaMS1The sense fragment of gene, utilizes SEQ ID NO:Antisense primer shown in 5 ~ 6 expands to obtainCaMS1The antisense fragments of gene；

S12. sense fragment and antisense fragments are successively connected to same RNAi interference carriers, are madeCaMS1The weight of gene Group RNAi interference carriers.

Step S11 clones the primer pair such as SEQ ID NO of the gene sense fragment:Shown in 3 ~ 4, the gene antisense piece is cloned The primer pair such as SEQ ID NO of section:Shown in 5 ~ 6.It is positive and negative justice sequence primer pair be respectively：

UP-SP4-1：5′-CGGATTTAAATAGTCAGTGGAGCAAGCAA-3 ',

UP-SP4-2：5′- CGCGGATCCAGTCAGTGGAGCAAGCAA-3′；

DW-SP4-1：5′-CATGCCATGGTTAGCCCTGGAATGTGGA-3 ',

DW-SP4-2：5′-TCCCCCGGGTTAGCCCTGGAATGTGGA-3′。

Preferably, the RNAi interference carriers are pFGC5941 carriers.

Preferably, it is introduced at the both ends of sense fragmentSwaI andNcoI restriction enzyme restriction enzyme sites, in antisense fragments Both ends introduceSmaI andBamHI restriction enzyme restriction enzyme sites, it is by digestion connection reaction that sense fragment and antisense fragments is first After be connected in pFGC5941 carriers.

Preferably, capsicum explant described in S3 is：By the side cotyledon of the aseptic seedling of culture from petiole base together with terminal bud And peripheral meristem is all cut, and only stays side cotyledon.

Preferably, the OD described in S3 when recombinational agrobacterium transfection Agrobacterium capsicum explant₆₀₀It is 0.4 ~ 0.8, transfection time For 12min.

Preferably, culture described in S3 includes the following steps：

S31. explant and bacterium solution, which shake up, is seeded in differential medium, under the conditions of 25 ± 1 DEG C constant temperature dark culturing 2 ~ 3d；

S32. micro-organisms：It is inoculated in 27 DEG C of 4~5d of culture in micro-organisms base；

S33. screening and culturing：It is inoculated on PPT screening and culturing mediums, subculture is primary every two weeks, subculture 2~3 times；Until Only a little explant physical efficiency grows resistant buds on screening and culturing medium, and most of explant is on the screening and culturing medium containing PPT Chlorisis, until flavescence coking；

S34. culture of rootage：When the Elongation of adventitious bud of differentiation is to 1.5~2.5 cm, it is cut from base portion, is inoculated in It is induced to take root in root media, 2~3 d of finishing scouring seedling, transplanting obtains male sterile pepper.

Above-mentioned differential medium, micro-organisms base, screening and culturing medium, root media are common using capsicum tissue culture field Culture medium.

Preferably, a concentration of 2 mg/L of the PPT of screening and culturing medium in S33.

Preferably, before bacterium solution dip dyeing, the capsicum explant is put into the differential medium, is trained in advance in 27 DEG C of dark Support 2~3 d.

Preferably, the method for acquisition capsicum aseptic seedling is：By pepper seed after 75% alcohol, 2% hypochlorite disinfectant, use Sterile water impregnate, remove sterile water, suck the moisture of the surface of the seed, under 25~28 DEG C of dark conditions cultivate 5~6d, then Seed taking-up is put into 27 DEG C, cultivates under 2000 lx of illumination, 14 h/d condition of culture, wait for capsicum seedling grow two panels cotyledon and Capsicum aseptic seedling is obtained when growing point will expose.

Compared with prior art, advantageous effect of the present invention is：A kind of method preparing male sterile pepper is provided, it should Method prepares the material of pollen activity reduction, by the material by building the recombinant vector containing anther specific gene Improvement and optimization can further prepare hot pepper male sterile material, have important value to the selection and breeding of capsicum new varieties.This Invention is screened by 2 ~ 3 generations, obtains resistance capsicum, T₀For transgenic positive rate up to 39.6%, T₁It is reached for transgenic positive rate 29.2%；T₀GenerationCaMS1It is 21.84% to interfere the pollen germination rate of plant, and wild type control is 52.63%, and explanation is prepared Transfer-gen plant have certain male sterility.

Description of the drawings

Fig. 1 is eight grade mixing bud RNA plain agar sugar gel electrophoresis figures of capsicum fertile plant or sterile plant of extraction； Wherein, F is fertile plant, and S is sterile plant.

Fig. 2 isCaMS1CDNA overall lengths and derivation amino acid sequence；Initiation codon and terminator codon black matrix table Show；Double setting-out parts are that FAR-N-SDR-e guards domain；Single underscore part is that STERILE guards domain.

Fig. 3 isCaMS1In the expression of capsicum bud different development stage；A. RT-PCR is analyzed,Actin For internal reference base Cause；B. qRT-PCR is analyzed；F1 ~ 8, S1 ~ 8 are respectively 1 ~ 8 grade of bud of fertile plant and sterile plant.

Fig. 4 isCaMS1Expression analysis at capsicum different tissues position；A. RT-PCR is analyzed,ActinFor internal reference base Cause；B. qRT-PCR is analyzed；F1 ~ 8, S1 ~ 8 are respectively fertile plant and sterile plant root, stem, leaf, open flower, calyx, petal, anther And gynoecium.

Fig. 5 isCaMS1Positive and negative justice segment PCR electrophoretograms；M：DL2000 Marker；1- sense fragments；2- antisense fragments.

Fig. 6 isCaMS1Sense fragment sequencing result.

Fig. 7 isCaMS1Antisense fragments sequencing result.

Fig. 8 isCaMS1Target fragment be sequenced blastn comparison results.

Fig. 9 isCaMS1 The restriction enzyme digestion and electrophoresis figure of pFGC5941-B plasmids（BamHⅠ、SmaⅠ）；M：DL2000；1~5 is recombination Plasmid.

Figure 10 isCaMS1RNAi carrier conversion Agrobacterium bacterium solution PCR electrophoretograms；M：DL2000；CK：Negative control：1 ~13 areCaMS1PFGC5941-B bacterium solutions.

Figure 11 isCaMS1 T₀For the PCR detections of transformed plant（Bar gene primers）；M：DL2000 Marker；1- is positive Control；2- blank controls；3- negative controls；4 ~ 24 areCaMS1 T₀For resistant plant.

Figure 12 isCaMS1 T₀For the PCR detections of transformed plant（35S promoter primer）；M：DL2000 Marker；1- sun Property control；2- blank controls；3- negative controls；4 ~ 24 areCaMS1 T₀For resistant plant

Figure 13 is transfer-gen plant amplified fragments sequence alignment result.

Figure 14 be transfer-gen plant with compare upgrowth situation.

Figure 15 isCaMS1It interferes plant and compares flower organ morphology.

Figure 16 is in-vitro pollen germination microscopical view；A-CaMS1Silence plant；B- wild types.

Figure 17 isCaMS1T0 is detected for the PCR of transformed plant（35S promoter primer）；M：DL2000；1- negative controls； 2- positive controls；3~9 areCaMS1 T₁For transfer-gen plant.

Specific implementation mode

The present invention is described in further details with specific embodiment with reference to the accompanying drawings of the specification, but embodiment is not right The present invention limits in any form.Unless stated otherwise, the present invention uses reagent, method and apparatus are normal for the art Advise reagent, method and apparatus.

The extraction of 1 chilli kernel male sterile dual purpose lines RNA of embodiment and the synthesis of cDNA

Using chilli kernel male sterile dual purpose lines AB114 as material, using Trizol methods extract respectively the material fertile plant and Totally 8 grade buds of sterile plant（Respectively：1 lobus cardiacus crimps into strips, and calyx wraps tightly corolla；2 lobus cardiacuses half are opened up, and calyx wraps tightly Corolla；3 lobus cardiacuses are unfolded, and calyx wraps tightly corolla, and anthocaulus is upright；4 calyx slightly split, micro- dew corolla, anthocaulus bending；5 calyx with Corolla flushes；6 corollas stretch out the half that calyx part is about calyx length；7 corollas stretch out calyx part and calyx is isometric；8 next day The flower that will be opened）And the total serum IgE of root, stem, leaf, open flower, calyx, petal, anther and gynoecium, it is as follows：

S1. 1 mL Trizol extracting solutions are added into 2.0 mL centrifuge tubes, it is rapid in liquid nitrogen to weigh 0.1 g materials It is transferred to after being ground into powder in the centrifuge tube equipped with extracting solution, vibrates mixing, stand 5 min on ice；

S2. 0.25 mL chloroforms are added, acutely vibrates 30 s, stands 5 min on ice；

S3. at 4 DEG C, 13000 rpm centrifuge 15 min；

S4. it is primary to repeat step S2, S3；

S5. supernatant is transferred to another new centrifuge tube, 2/3 volume isopropanol is added, vibrated mixing, stand on ice 10 min, at 4 DEG C, 12000 rpm centrifuge 10 min；

S6. supernatant is abandoned, precipitation is washed 2 ~ 3 times with 75% ethyl alcohol；

S7. 10000 rpm centrifugations, 5 min collect precipitation, thoroughly remove 75% ethyl alcohol, with appropriate RNase- after slightly drying Free water dissolutions RNA, -75 DEG C save backup.

Learnt from else's experience DNase I（RNase Free）Eight grade mixing flowers of capsicum fertile plant or sterile plant of processing and purifying Flower bud total serum IgE sample is detected into row agarose gel electrophoresis, 28S and 18S bands are clear, see Fig. 1.

By capsicum bud total serum IgE sample with after TE solution suitably dilution, A260/A280 ratios are measured with nucleic acid-protein instrument Value is more than 2.0 in 2.0 or so, A260/A230 ratios, shows that RNA purity is high, integrality is good, and concrete outcome is shown in Table 1.

The RNA absorbance values of eight grade mixing buds of 1 capsicum fertile plant of table or sterile plant measure

Then, using the RNA of extraction as template, the synthesis of each tissue site cDNA of capsicum is completed using commercial reagent box, is obtained To 8 grade buds of sterile plant and fertile plant and the cDNA of root, stem, leaf, open flower, calyx, petal, anther and gynoecium.

Embodiment 2CaMS1The synthesis and sequencing of gene

Rna expression difference is carried out to eight grades mixing bud of capsicum fertile plant and sterile plant using RNA-Seq methods Analysis finds that the est sequence of a 983bp is only expressed in fertile plant, analytical table is compared in NCBI using the sequence as probe It is bright, the EST and many male sterility GAP-associated protein GAPs 2（male sterility 2）There is higher similitude（About 75%）, these Male sterility 2 play an important role during pollen development, thus it is speculated that the gene may be related to pollen development. The gene is expanded by electronic cloning, 3 ' RACE and 5 ' RACE, cDNA splicing sequences is obtained, is named asCaMS1, core Nucleotide sequence such as SEQ ID NO:Shown in 1.

Speculate to verify, devises a pair of of special primer：

Upstream (5 ' -3 '): CTATAATCTTTCCTTCCATTCCCTTTG

Downstream (5 ' -3 '): AATCACAAGTCCTTCGGAAAGAAAA

Using the cDNA of eight grade mixing mixing buds of fertile plant capsicum as template, specific PCR is carried out using above-mentioned primer. The reaction system of amplification is：1 μ L, 10 × cDNA PCRbuffer of cDNA templates, 2.5 μ L, dNTP Mix（2.5 mmol/L） 2 μ L, 1 μ L of sense primer, downstream primer（10 μmol/L）1.0 μ L,TaqEnzyme 0.25 μ L, ddH₂17.25 μ L of O, always 25.0 μ L of volume.PCR amplification programs are：94 DEG C of 3 min of pre-degeneration；94 DEG C denaturation 50 s, 50 ~ 54 DEG C annealing 40 s, 72 DEG C Extend 2 min, 72 DEG C of 5 min of extension again after 35 cycles.Recycle PCR product, and cloning and sequencing.

Above-mentioned PCR has obtained the band of a treaty 2000bp, recycles the band, and cloning and sequencing, obtainsCaMS1's CDNA sequence overall length 1919bp includes the maximum open reading frame of a 1758bp, as shown in Fig. 2, the amino acid sequence of its coding Row such as SEQ ID NO:Shown in 2.Through analysis, it is found that the sequence is correct, and demonstrate splicing result.

Embodiment 3 RT-PCR and qRT-PCR analysisCaMS1The spatial and temporal expression characteristic of gene

RT-PCR is analyzed：

8 grade buds of sterile plant and fertile plant and root for being obtained respectively with embodiment 1, stem, leaf, open flower, calyx, Petal, anther and one chain cDNA of gynoecium are template, withActinSemi-quantitative RT-PCR analysis is carried out for internal reference, detects each pollen The expression of development related gene.

CaMS1 gene specific primers：

Upstream：5' -AAATCTTCCCTCAGGAGTCAATCAG-3'；

Downstream：5' -AATCACAAGTCCTTCGGAAAGAAAA-3'

AndActinSpecial primer：

Upstream：5'-CCTCTTCACTCTCTGCTCTCTCCTCA-3'；

Downstream：5' -GTCATTTTCTCTCTATTTGCCTTGGG-3'

The reaction system of RT-PCR is：1.0 μ L, 10 × PCR buffer2.0 μ L of cDNA templates, upstream and downstream special primer （10μM）Each 1.6 μ L of 0.6 μ L, dNTPs (2.5 mM),TaqDNA polymerase（5 U/μL）0.2 μ L, are supplied ddH₂O to 20 μ L.RT-PCR program therebies are：94 DEG C of 3 min of pre-degeneration；94 DEG C of denaturation 30 s, 50 ~ 55 DEG C of 30 s of annealing, 72 DEG C of 60 s of extension, 72 DEG C of 5 min of extension again after 26 ~ 30 cycles, preserve at 10 DEG C.1.5% Ago-Gel of PCR product Electrophoresis detection is taken pictures.

WithActinFor reference gene, useCaMS1Gene specific primer pairCaMS1Carried out flower bud development different times and The RT-PCR expression analysis at different tissues position, the results showed that,CaMS1There is different expression water in the different development stage of bud It is flat.It almost can not see the expression of the gene in the 1st ~ 4 grade of bud of fertile plant.In the 5th grade of bud, expression is strong suddenly, and Its expression is can't detect in the bud of the 6th grade of bud and its later grade.It is detected not in the buds at different levels of sterile plant To its expression（Fig. 3 a）.This explanationCaMS1It is expressed in the mid-term of capsicum flower bud development, thus it is speculated thatCaMS1Carpet may be taken part in The development of layer.In addition, found after the expression to Different Organs is analyzed,CaMS1The table only in the anther of fertile plant It reaches, and is not expressed at other positions, such as root, stem, leaf, calyx, petal, gynoecium.The portion of all detections in sterile plant The position gene is not expressed（Fig. 4 a）, also illustrate that the gene may be related with anther development.

Analysis：

In order to further verify RT-PCR's as a result, this research has carried out qRT-PCR analyses to the gene.First with capsicum The cDNA of buds at different levels is that template carries out qRT-PCR, then again with the root of capsicum, stem, leaf, open flower, calyx, petal, anther, The cDNA of gynoecium is template, carries out qRT-PCR reactions, and each reaction sets 3 repetitions.

CaMS1 gene specific primers：

Upstream：5' -ATGATGGCGAAAGAGGTTGACG-3'；

Downstream：5' -CCATTTACATACGCTGTGGATACTTG-3'

AndActinSpecial primer：

Upstream：5' -AATCAATCCCTCCACCTCTTCACTC-3'；

Downstream：5' -CATCACCAGCAAATCCAGCCTT-3'

QRT-PCR reaction systems are as follows：1.0 μ L of cDNA templates, 10 μ 2 × SYBR of L GreenI MIX, 15 μm of ol L^-10.2 μ L of forward primer, 15 μm of ol L^-10.2 μ L of reverse primer add water to total volume and reach 20 μ L.PCR programs：94 ℃ 2 min；94 DEG C of 10 s, 56 DEG C of 20 s, 72 DEG C of 35 s, 40 cycles；Product is analyzed with melt curve analysis, and agarose is used in combination Gel electrophoresis is verified.The IQ5 softwares of BIO-RAD companies collect data.Relative expression quantity of each gene between different materials is used The 2 of CT values^-△△CTMethod processing obtains（Livak et al,2001）.

The result shows that in fertile plant,CaMS1Expression detect faint expression in the 4th grade of bud first, 5th grade of expression quantity reaches maximum value, and also only has faint expression in the 6th grade of bud.Fertile line the 7th, 8 grades, with And the 1st ~ 8 grade of sterile plant can't detect the expression of the gene（Fig. 3 b）.The RT-PCR result classes of this result and front Seemingly, the result of front is demonstrated.RightCaMS1When expression in Different Organs is analyzed, qRT-PCR is equally verified The result of front RT-PCR（Fig. 4 b）, i.e.,CaMS1It is only expressed in the anther of fertile plant, is the special gene of an anther.

Embodiment 4 is builtCaMS1The RNAi interference carriers of gene

1. CaMS1The clone of the positive and negative adopted segment of gene RNAi

According in embodiment 2CaMS1The sequencing result of full length gene, is compared by Blast, is chosen respectively one among gene The sequence design 2 of Duan Hanyou intrones introduces special primer at the both ends of sense fragmentSwaI andNcoI restriction enzymes Enzyme site introduces at the both ends of antisense fragmentsSmaI andBamHI restriction enzyme restriction enzyme sites, it is mixed with eight grade mixing of capsicum It is template to close bud cDNA, and PCR amplification goes out justice, antisense gene segment, and target fragment size is about 200bp.

It is positive and negative justice sequence primer be：

UP-SP4-1：5′-CGGATTTAAATAGTCAGTGGAGCAAGCAA-3 ',

UP-SP4-2：5′- CGCGGATCCAGTCAGTGGAGCAAGCAA-3′；

DW-SP4-1：5′-CATGCCATGGTTAGCCCTGGAATGTGGA-3 ',

DW-SP4-2：5′-TCCCCCGGGTTAGCCCTGGAATGTGGA-3′。

（1）Amplification system：

（2）Reaction condition

94 DEG C, 5 min；94 DEG C, 1min, 54 DEG C, 1 min, 72 DEG C, 2 min, 30 cycles；72 DEG C, 10 min；16℃ It preserves.

PCR product is recycled with DNA gel QIAquick Gel Extraction Kit.Take 20 μ L PCR recovery products that sequencing company is sent to be sequenced.

It is above-mentionedCaMS1The PCR amplification of target fragment amplifies the positive and negative adopted segment of size about 210bp（Fig. 5）, it is connected to On pMD19-T carriers, sequencing result is for 215bp, 212 bp respectively（Fig. 6, Fig. 7）, through Blast analysis shows amplified fragments just Really（Fig. 8）.

2. the insertion of sense fragment

（1）The double digestion of pFGC5941 empty plasmids and sense fragment

Using the pFGC5941 empty plasmids in alkaline lysis method of extracting Escherichia coli, then all use respectivelySwaI andNcoThe bis- enzymes of I It cuts pFGC5941 empty plasmids and recycles obtained sense fragment, 37 DEG C of digestions are stayed overnight.Double digestion system is as follows：10×buffer （K）44 μ L of μ L, BSA, 10 11 μ L of μ L, NcoI of μ L, SwaI of Plasmid DNA, add ddH₂O is to 40 μ L, mixing.

（2）The connection of pFGC5941 empty plasmids and sense fragment

Double digestion product recycling large fragment and sense fragment are first taken, the T of Takara is then used₄16 DEG C of connections of DNA ligase Overnight.Coupled reaction system is as follows：T₄2.5 μ L of buffer, 10 μ L of sense fragment, plasmid vector 2 μ L, T₄DNA ligase 1 μ L, add ddH₂O is to 25 μ L, mixing.

（3）Connection product converts Escherichia coli

It preparesDH5 α competent cells, connection product is convertedDH5 α competence, the 37 DEG C of cultures of Km 100mg/L LB tablets Overnight.Second day picking single bacterium colony is shaken bacterium with 100 37 DEG C of the mg/L LB liquid containing Km and is stayed overnight, and bacterium solution extracts plasmid.Plasmid is usedNcoI andSwaI double digestions detect.The carrier for being inserted into sense fragment is named as pFGC5941-A.

3. the insertion of antisense fragments

（1）The double digestion of pFGC5941-A plasmids and antisense fragments

With the pFGC5941-A plasmids in alkaline lysis method of extracting Escherichia coli, then all use respectivelyBamHI andSmaThe bis- enzymes of I PFGC5941-A plasmids and the antisense fragments of recycling are cut, 30 DEG C of digestions are stayed overnight.Double digestion system is as follows：10×buffer（T）2μ 4 μ L of L, BSA, 10 μ L of Plasmid DNA,Bam1 μ L of HI,Sma1 μ L of I, add ddH₂O is to 40 μ L, mixing.

（2）The connection of pFGC5941-A plasmids and antisense fragments

Double digestion product recycling large fragment and antisense fragments are first taken, the T of Takara is then used₄16 DEG C of connections of DNA ligase Overnight.Coupled reaction system of the coupled reaction system with aforementioned pFGC5941 empty plasmids and sense fragment.

（3）Connection product converts Escherichia coli

The connection product of pFGC5941-A plasmids and antisense fragments converts the extraction of Escherichia coli and plasmid with reference to aforementioned The method that connection product converts Escherichia coli.Same plasmid is used respectivelyBamHI、SmaI andSwaI、NcoTwo sets of double digestion detections of I, As a result the purpose band that expected size is 200bp is cut out（Fig. 9）, illustration purpose gene has been successfully plugged into plant expression vector In pFGC5941, it is named as pFGC5941-B.

4. recombinant plasmid transformed Agrobacterium

（1）Convert Agrobacterium competent cell

1）Freshly prepared or -70 DEG C of preservations 200 μ L Agrobacterium competent cells are taken, are set on ice, it is light after thawing completely Gently cell is suspended；

2）5 μ L are addedCaMS1 30 min are placed on ice after pFGC5941-B plasmid mixings；

3）Centrifuge tube is put into quick-frozen 5 min in liquid nitrogen, 1 min of heat shock in 37 DEG C of water-baths will be gone to rapidly on ice, ice bath 2 min；

4）1 mL YEP fluid nutrient mediums, 28 DEG C of 1 h of shaken cultivation are added；

5）4000 rpm centrifuge 5 min, stay 100 μ L YEP culture solution suspension cells；

6）Bacterium solution is coated on the YEP tablets containing 100 mg/L+Str of Km, 100 mg/L, 28 DEG C of culture 24- 48 h。

（2）Recon is identified

28 DEG C of the YEP liquid for 100 mg/L+Str of Agrobacterium bacterium colony Km, 100 mg/L that picking is grown shakes bacterium 24 H extracts plasmid, then carries out PCR detections with plasmid, can obtain target fragment（Figure 10）, illustrate that plant expression vector has succeeded It is transferred in Agrobacterium, expression vector establishment success creates condition for later genetic transformation.

The pepper transformation of the agriculture bacillus mediated PFGC5941-CaMS1 of embodiment 5

（1）The acquisition of capsicum aseptic seedling

Pepper seed full, that grain is big aseptic water washing 2-3 times is selected first, is removed impurity, is then disappeared with 75% alcohol Then malicious 1min, aseptic water washing 2~3 times sterilize 12 min with 2% liquor natrii hypochloritis（Period constantly shakes）, use sterile water It washes 3 times, removes sterile water, then the min of 10 min~15 are impregnated with sterile water, finally remove sterile water, kind is sucked with sterilizing filter paper Sublist face residual moisture is sowed in 1/2 MS culture mediums, and artificial culturing room's culture is placed in.It is placed under 25~28 DEG C of dark conditions Culture, 5~6d be both observed that hypocotyl was emerged, and seed taking-up is then put into 27 DEG C or so of temperature, 2000 lx of illumination It is cultivated under 14 h/d condition of culture, explant can be produced when capsicum seedling grows two panels cotyledon and growing point will expose Body, explant can be prepared by, which being seeded into from seed, takes around 14 d or so.

（2）Preculture

By the high Bill of Fleming（Flamingo-bill）Outer explant is put into differential medium, in 27 DEG C of artificial culturing room 2~3 d of dark preculture.The Flamingo-bill explants are：By the side cotyledon of the aseptic seedling of culture from petiole base Portion is all cut together with terminal bud and peripheral meristem, only stays side cotyledon.

（3）Agrobacterium infects and co-cultures

4d takes out the Agrobacterium containing expression vector being stored in -80 DEG C of ultra low temperature freezer before infecting, in YEP solids On culture medium（100 mg/L of Str 100 mg/L, Km）Draw tablet, 28 DEG C of 24~48h of constant temperature incubation.Picking single bacterium colony is placed in 10mL 100mg/L containing Str, Km 100mg/L and AS 200mg/L YEP fluid nutrient mediums in, 200rpm vibrated at 28 DEG C Night, next day go in 50mL YEP fluid nutrient mediums, continue culture to OD₆₀₀It is 0.4 ~ 0.8.

After capsicum explant preculture 2d, 12 min, phase are disseminated with ready Agrobacterium bacterium solution on superclean bench Between shake frequently, be then put in the newspaper through autoclave sterilization up to half-dried, inoculate in same differential medium, every bottle The explant of inoculation 15 or so, and 2 ~ 3d of constant temperature dark culturing under the conditions of (25 ± 1) DEG C.

（4）Micro-organisms

The Flamingo-bill explants for co-culturing 2d are inoculated in micro-organisms base, 27 DEG C of artificial culturing room is placed on Cultivate 4~5d.

（5）Screening and culturing

It after explant micro-organisms, is inoculated on screening and culturing medium, subculture is primary every two weeks, subculture 2~3 times.Until Only a little explant physical efficiency grows resistant buds on screening and culturing medium, and most of explant is on the screening and culturing medium containing PPT Chlorisis, until flavescence coking.

This experiment is screened with PPT, since PPT is larger to plant poisoning effect, finds the screening pressure of suitable capsicum very It is important.It is divided to two groups to be provided with 11 concentration gradients altogether in experiment（Table 3）, the results showed that：It is peppery when PPT concentration is more than 3 mg/L By strong inhibition, most of browning is withered for the differentiation of green pepper Flamingo-bill explant adventitious buds；When PPT concentration is less than When 1.5mg/L, the good differentiation of capsicum Flamingo-bill explant adventitious buds, but false positive is more, therefore the screening used Concentration is 2 mg/L, and smoothly obtains resistant plant.

Sensitivity experiments of the 3 Flamingo-bill explants of table to PPT

（6）Culture of rootage

When the Elongation of adventitious bud of differentiation is to 1.5~2.5 cm, it is cut from base portion, is inoculated in root media and lures It is led to take root.When root long to 1.5 cm or so, after quantity reaches 5 or more, about 30d or so, 2~3 d of corkage lid hardening, so After move to equipped in autoclaved perlite and peat soil mixotrophism alms bowl or flowerpot, finally obtain 48 plants of resistance seedlings.30 plants It is 612 kind of capsicum, 18 plants are 59 kinds of capsicum.

Embodiment 6CaMS1Gene interferes the molecule of plant to be identified with botany

1. T₀For the PCR detections of transfer-gen plant

（1）Primer sequence

1）According toBarGene primer sequence（Zang Ning etc., 2008）

bar-UP：5′-ATGAGCCCAGAACGACGC-3′

bar-DW：5′-TCTCAAATCTCGGTGACG-3′

2) according to CaMV35S promoter primer sequences

S1-UP：5′-GAGGACCTAACAGAACTCG-3′

S2-DW：5′-GTCTTGCGAAGGATAGTGG-3′

（2）Pcr amplification reaction system

1 μ L, 10 × DNA PCR buffer of DNA templates, 2.5 μ L, dNTP Mix（2.5 mmol/L）2 μ L, upstream Primer（10μmol/L）1 μ L, downstream primer（10μmol/L）1 μ L, rTaq enzyme 0.25 μ L, ddH₂17.25 μ L of O, it is overall 25.0 μ L of product.

（3）Pcr amplification reaction program

94 DEG C of 5 min of pre-degeneration；94 DEG C of 30 s of denaturation, 58 DEG C of 30 s of annealing, 72 DEG C of 1 min of extension, 32 recycle；72 DEG C extend 5 min；12 DEG C of preservations.

（4）PCR positive rates and conversion data statistical method

The genomic DNA for extracting 5 transformed plant of embodiment, is used respectivelyBarTwo couple of gene and CaMV 35S promoters draws 48 plants of object pair turnsCaMS1The resistance capsicum of gene（30 plants are 612 kinds of capsicum, and 18 plants are 59 kinds of capsicum）PCR detections are carried out, As a result 19 plants can amplify about 550bp purpose bands（Figure 11, Figure 12）, PCR positive rates are respectively 39.6%, preliminary to demonstrate,prove Bright RNAi carrier has been transferred to capsicum.

It chooses and turnsCaMS13 plants of gene carries out PCR amplification, the bright band gel extraction that will be obtained（CaMV35S promoters are drawn Object）, it is connected on pMD19-T carriers, by conversion, blue hickie screening, chooses hickie and carry out shaking bacterium and plasmid extraction.It will recombination Son is sent to sequencing company sequencing, has measured full gene sequence, identical as expection（Figure 13）, it is determined as transfer-gen plant.

2. T₀For the pollen activity detection of transfer-gen plant（The in vitro rudiment measuring method of agar-agar）

The preparation of culture medium：10% sucrose, 100mg/kg boric acid (HB0₃), 5mg/kg gibberellin, 100mg/kg calcium nitrate (Ca(NO₃)₂·4H₂O), 0.8% agar.

The acquisition of pollen：Divide 3 days and collect flower, as 3 repetitions, acquisition time is at the morning 10 or so.Acquire flower Standard be to have bloomed but not yet loose powder, pollen is shaken off on template after picking flowers, and mixes well.

Concrete operations：By in the culture dish of falling people after culture medium heating fusing, the thin uniform layer of about 0.5cm thickness is congealed into, is made into Solid medium.Pollen is uniformly applied on culture medium with dissecting needle, covers to be put into incubator and cultivate.Culture medium is placed on black Secretly, it is cultivated 3 hours under the conditions of constant temperature (25 scholar l) DEG C, then observes germination rate under an optical microscope.Culture medium is all provided with 3 weights Multiple, the visual field of 3 non-overlapping copies of each repeated measures, the sprouting situation of statistics 200 or more pollen grain is surpassed with pollen tube length L/2 pollen diameter is crossed as sprouting standard.

Pollen germination rate=(the pollen grain number sprouted/total pollen grain number) × 100%.

All transgenic peppers that makes discovery from observation all show normal nutrient growth and reproductive growth（Figure 14）.Phase For wild type and control,CaMS1The anther dehiscence of repressed transfer-gen plant is slower, and pollen tube is than wild type It is short, and the pollen in anther is less（Figure 15）.Finally choose that PCR bands are brighter and much the same 3 plants of brightnessCaMS1 RNAi Transfer-gen plant carries out cultured in vitro and detects its pollen activity, the result is that the pollen germination rate of interference plant is 21.84%, and it is wild Raw type is 52.63%（Figure 16）.

3、T₁For the PCR detections of transfer-gen plant

T is extracted according to Ezup pillar Plant Genome extracts kits₁For the DNA of transgenic pepper, opened with CaMV 35S 24 plants of capsicums of primer pair of mover carry out PCR detections, as a result there is 7 plants of T₁About 550bp mesh can be amplified for transgenic pepper Band（Figure 17）, segregation ratio 17：7, positive rate 29.2%.

SEQUENCE LISTING

<110>Agricultural University Of South China

<120>A method of preparing male sterile pepper

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 1919

<212> DNA

<213>The cDNA sequence of gene C aMS1

<400> 1

ctataatctt tccttccatt ccctttgaac ttttttctcc cttgtttctc tttgcatcta 60

tggcggctat gggtagtcta tgttcttcct cttgtatatc aaaaactgtg atgaaattgt 120

ctaagaattg gagatggtgc cctcccaaga aggtatattg tcaaactagt ggtacaaagt 180

ctggtaatgt ttcttctgtt gtaacagaga gatcatcggt gattagctcg gaaactttag 240

gaagtttggt tttgagtcca aatgccgaaa tcaaagtcaa ggatttggtg ccttatggtc 300

agtcaaggca tgatgatggt ataggcatta ccaagtttct gagagggaaa gcatttctca 360

ttactggtgc aactggtttt ctgggaaaag ttctaattga gaagatctta aggacagcac 420

ctgatgtgaa caaaatattc atcttgatca aggcaaagaa caaagaagtt gctatgcaga 480

gattgaagaa tgaaatcctc aatgctgata tattcaactg cctcaaacaa gttcatggga 540

aatcctatca gactttcatg ttgagcaagt tggtacctct gttaggaaat gtttgtgaag 600

ctaaccttgg aattgatgaa gacacagcca acatgatggc gaaagaggtt gacgtaattg 660

taaattctgc tgcgaatacc actttcgatg aaaggtacga tatttcactt gatataaata 720

ctgaaggacc tagccgcctt atgaactttg caaaacaatg tcgcaacctt aaactctttc 780

ttcaagtatc cacagcgtat gtaaatggac agcgacaagg tagaattatg gaaaaggcat 840

tcggcattgg agacagtata gcaagggaaa atcttccctc aggagtcaat cagagctcct 900

ccccctcttt gaatgttgaa gatgagataa agttagtttt ggagtccaaa caaggtttag 960

aagataattc agtggctcag aaaatgaaag agattggttt aaggagagct aacaaatttg 1020

gatggcaaga cacttacgta ttcacaaagg caatgggaga gatgatgata gacagcatga 1080

gaggtgatat tccggtagta attattcgac caagtgttat tgagagcacc tacaaggaac 1140

catttcctgg atggatggaa gggagcagga tgatggatcc aatcatcttg tactatggta 1200

aaggacagct cacagggttt ctcgtagacc ctaatggagt tcttgatgtg gttccagctg 1260

acatggttgt gaatgcaacc ttggcagcca tggcaaaaca tgggacagaa ggaaaaccag 1320

gaagtagcag tgtttaccag gttgcttcat ctgctgtaaa tccattagtc ttcaaggacc 1380

tggccagaat gctatttgag cacttcaatc gttcacccta tattgattcc aaaggaagac 1440

caattcatgt tccaaaaatg tcgctgctca gatccatgga ggacttatca tcccatctat 1500

ggcgagacgc cattaacaga agtggcctaa cagatttgac agatccaaat gggaagttgt 1560

ccaggaaact tgagaatatc tgtaggaagt cagtggagca agcaaagtac cttgctaata 1620

tttatgaacc gtacactttt tatggaggaa gatttgacaa cagcaatacc cagaggttga 1680

tggaatgcat gtctaaagaa gaaagatggc aatttggatt tgatgtagaa agcatagatt 1740

ggaaagatta catctctaat gtccacattc cagggctaag gaagcatgtg atgaaaggaa 1800

gaggatcatg cagttaatgc cagtctgtcc tttatgtttc tgcatcttat cttaactgta 1860

atacaagtat acgaccgctg gttttattta tactttttct ttccgaagga cttgtgatt 1919

<210> 2

<211> 1758

<212> DNA

<213>The open reading frame sequence of gene C aMS1

<400> 2

atggcggcta tgggtagtct atgttcttcc tcttgtatat caaaaactgt gatgaaattg 60

tctaagaatt ggagatggtg ccctcccaag aaggtatatt gtcaaactag tggtacaaag 120

tctggtaatg tttcttctgt tgtaacagag agatcatcgg tgattagctc ggaaacttta 180

ggaagtttgg ttttgagtcc aaatgccgaa atcaaagtca aggatttggt gccttatggt 240

cagtcaaggc atgatgatgg tataggcatt accaagtttc tgagagggaa agcatttctc 300

attactggtg caactggttt tctgggaaaa gttctaattg agaagatctt aaggacagca 360

cctgatgtga acaaaatatt catcttgatc aaggcaaaga acaaagaagt tgctatgcag 420

agattgaaga atgaaatcct caatgctgat atattcaact gcctcaaaca agttcatggg 480

aaatcctatc agactttcat gttgagcaag ttggtacctc tgttaggaaa tgtttgtgaa 540

gctaaccttg gaattgatga agacacagcc aacatgatgg cgaaagaggt tgacgtaatt 600

gtaaattctg ctgcgaatac cactttcgat gaaaggtacg atatttcact tgatataaat 660

actgaaggac ctagccgcct tatgaacttt gcaaaacaat gtcgcaacct taaactcttt 720

cttcaagtat ccacagcgta tgtaaatgga cagcgacaag gtagaattat ggaaaaggca 780

ttcggcattg gagacagtat agcaagggaa aatcttccct caggagtcaa tcagagctcc 840

tccccctctt tgaatgttga agatgagata aagttagttt tggagtccaa acaaggttta 900

gaagataatt cagtggctca gaaaatgaaa gagattggtt taaggagagc taacaaattt 960

ggatggcaag acacttacgt attcacaaag gcaatgggag agatgatgat agacagcatg 1020

agaggtgata ttccggtagt aattattcga ccaagtgtta ttgagagcac ctacaaggaa 1080

ccatttcctg gatggatgga agggagcagg atgatggatc caatcatctt gtactatggt 1140

aaaggacagc tcacagggtt tctcgtagac cctaatggag ttcttgatgt ggttccagct 1200

gacatggttg tgaatgcaac cttggcagcc atggcaaaac atgggacaga aggaaaacca 1260

ggaagtagca gtgtttacca ggttgcttca tctgctgtaa atccattagt cttcaaggac 1320

ctggccagaa tgctatttga gcacttcaat cgttcaccct atattgattc caaaggaaga 1380

ccaattcatg ttccaaaaat gtcgctgctc agatccatgg aggacttatc atcccatcta 1440

tggcgagacg ccattaacag aagtggccta acagatttga cagatccaaa tgggaagttg 1500

tccaggaaac ttgagaatat ctgtaggaag tcagtggagc aagcaaagta ccttgctaat 1560

atttatgaac cgtacacttt ttatggagga agatttgaca acagcaatac ccagaggttg 1620

atggaatgca tgtctaaaga agaaagatgg caatttggat ttgatgtaga aagcatagat 1680

tggaaagatt acatctctaa tgtccacatt ccagggctaa ggaagcatgt gatgaaagga 1740

agaggatcat gcagttaa 1758

<210> 3

<211> 29

<212> DNA

<213> UP-SP4-1

<400> 3

cggatttaaa tagtcagtgg agcaagcaa 29

<210> 4

<211> 27

<212> DNA

<213> UP-SP4-2

<400> 4

cgcggatcca gtcagtggag caagcaa 27

<210> 5

<211> 28

<212> DNA

<213> DW-SP4-1

<400> 5

catgccatgg ttagccctgg aatgtgga 28

<210> 6

<211> 27

<212> DNA

<213> DW-SP4-2

<400> 6

tcccccgggt tagccctgga atgtgga 27

Claims (7)

1. a kind of method preparing male sterile pepper, which is characterized in that include the following steps：

S1. structure is containing such as SEQ ID NO:The recombinant RNA i interference carriers of CaMS1 genes shown in 1 or 2；

S2. recombinant RNA i interference carriers S1 obtained convert Agrobacterium, obtain recombinational agrobacterium；

S3. capsicum explant is transfected with recombinational agrobacterium, obtains transformed plant through culture, screening obtains male sterile pepper；

The construction method of RNAi interference carriers described in S1 is：

S11. SEQ ID NO are utilized:Sense primer shown in 3~4 expands to obtain the sense fragment of CaMS1 genes, utilizes SEQ ID NO:Antisense primer shown in 5~6 expands to obtain the antisense fragments of CaMS1 genes；

S12. sense fragment and antisense fragments are successively connected to same RNAi interference carriers, the recombination of CaMS1 genes is made RNAi interference carriers；

The RNAi interference carriers are pFGC5941 carriers；

SwaI and NcoI restriction enzyme restriction enzyme sites are introduced at the both ends of sense fragment, SmaI is introduced at the both ends of antisense fragments With BamHI restriction enzyme restriction enzyme sites, sense fragment and antisense fragments are successively connected to by digestion connection reaction In pFGC5941 carriers.

2. the method for preparing male sterile pepper according to claim 1, which is characterized in that capsicum explant described in S3 is： The side cotyledon of the aseptic seedling of culture is all cut from petiole base together with terminal bud and peripheral meristem, only stays side sub Leaf.

3. the method for preparing male sterile pepper according to claim 1, which is characterized in that recombinational agrobacterium described in S3 transfects OD when Agrobacterium capsicum explant₆₀₀It is 0.4~0.8, transfection time 12min.

4. the method for preparing male sterile pepper according to claim 1, which is characterized in that culture described in S3 includes following step Suddenly：

S31. explant shakes up with bacterium solution and is seeded in differential medium, 2~3d of constant temperature dark culturing under the conditions of 25 ± 1 DEG C；

S32. micro-organisms：It is inoculated in 27 DEG C of 4~5d of culture in micro-organisms base；

S33. screening and culturing：It is inoculated on PPT screening and culturing mediums, subculture is primary every two weeks, subculture 2~3 times；Until only few Perhaps explant physical efficiency grows resistant buds on screening and culturing medium, and most of explant chlorisis on the screening and culturing medium containing PPT, becomes Until yellow coking；

S34. culture of rootage：When the Elongation of adventitious bud of differentiation is to 1.5~2.5cm, it is cut from base portion, is inoculated in training of taking root Supporting in base induces it to take root, finishing scouring 2~3d of seedling, and transplanting obtains male sterile pepper.

5. the method for preparing male sterile pepper according to claim 4, which is characterized in that the PPT of screening and culturing medium in S33 A concentration of 2mg/L.

6. the method for preparing male sterile pepper according to claim 2, which is characterized in that, will be described peppery before bacterium solution dip dyeing Green pepper explant is put into differential medium, in 27 DEG C of 2~3d of dark preculture.

7. the method for preparing male sterile pepper according to claim 2, which is characterized in that the method for obtaining capsicum aseptic seedling For：By pepper seed after 75% alcohol, 2% hypochlorite disinfectant, is impregnated with sterile water, remove sterile water, suck the surface of the seed Moisture, 5~6d is cultivated under 25~28 DEG C of dark conditions, seed taking-up is then put into 27 DEG C, illumination 2000lx14h/d training It is cultivated under the conditions of supporting, capsicum aseptic seedling is obtained when capsicum seedling grows two panels cotyledon and growing point will expose.