CN106755004B

CN106755004B - Application of GhPME36 gene in regulation and control of plant secondary wall development

Info

Publication number: CN106755004B
Application number: CN201611179312.9A
Authority: CN
Inventors: 商海红; 袁有禄; 李伟杰; 范森淼; 葛群; 刘爱英; 石玉真; 巩万奎; 龚举武; 李俊文; 陈婷婷
Original assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2016-12-19
Filing date: 2016-12-19
Publication date: 2020-08-18
Anticipated expiration: 2036-12-19
Also published as: CN106755004A

Abstract

The invention discloses an application of PME36 gene in regulating and controlling the secondary wall development of plants. The gene sequence is shown in SEQ ID No.1, and experiments prove that compared with wild arabidopsis thaliana, the PME36 gene is overexpressed in a plant, so that the cell development of the plant can be changed, particularly the secondary wall development period is obviously changed.

Description

Application of GhPME36 gene in regulation and control of plant secondary wall development

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to application of a gene GhPME36 in regulation and control of secondary wall development of plants.

Background

The secondary wall is the layer of cell walls that continues to accumulate inside the primary wall after the cells stop growing. Secondary walls occur within the primary wall, are generally thick and rigid, and often occur in plant cells that serve as mechanical support and transport, such as ducts, tracheids, sclerenchyma cells, fibroblasts, and the like. The main structure of cotton fiber is cell wall, its main components are cellulose and pectin substances, pectin is an important component of cell wall, and its metabolism is closely related to fiber quality. Pectin methylesterase is an important pectinase, is widely existed in plants and some microorganisms with cell wall degradation, and can change the structure of a cell wall by generating carboxyl groups or carrying out methyl esterification reaction to regulate the growth and development of the cell wall. In recent years, people systematically study the development of cell walls from the aspects of physiology, biochemistry, metabolism and the like, and the traditional method has limitation on the study because of the complexity of the development of the cell walls, particularly secondary walls.

Cotton is one of the world's important natural fiber crops and an important raw material for the textile industry. With the increasing requirements of the textile industry on the quality of cotton fibers, the improvement of the quality of the cotton fibers, especially the specific strength of the fibers, becomes increasingly important, and has become an important research hotspot in the field of cotton biology. The fiber cells of cotton are developed from single cells, the cell walls are the key of the whole cell development, the secondary wall is the key period of the fiber development, the thickening period of the secondary wall of the cotton fiber development is closely related to the specific strength of the cotton fiber, and the specific strength of the fiber is an important index of the fiber quality, so the research on the thickening period of the secondary wall of the fiber has important significance for improving the fiber quality.

Disclosure of Invention

The invention aims to solve the technical problem of how to regulate and control the growth and development of plants, which is based on the fact that pectin substances in a secondary wall are changed under the action of pectin methylesterase to change the structure of a cell wall, so that the growth and development of cells are influenced.

In order to solve the technical problem, the invention provides application of a GhPME36 gene in regulation and control of plant development, wherein the GhPME36 gene is a gene coded by a sequence shown in SEQ ID No. 1. The invention firstly provides the application of the gene family PME for analyzing and coding the substances in the aspects of function and structure evolution in regulating and controlling the growth and development of plants, wherein the protein has two structure types which are respectively type I: including 21 alpha-helices, 4 beta-sheets or 25 alpha-helices, 6 beta-sheets, indicate a high degree of conservation of the PME protein family in tertiary structure, presumably a high degree of conservation of the PME family in function.

To illustrate the above problems, the present invention also provides a method for measuring the total enzyme activity to observe the role of the enzyme in plant development.

The nucleotide sequence of the gene GhPME36 of the present invention can be mutated by a known method by those skilled in the art, and those nucleotides obtained by artificial modification which have 75% or higher identity with the nucleotide sequence of the gene GhPME36 of the present invention are derived from the nucleotide sequence of the present invention and are identical with the sequence of the present invention as long as they encode the gene GhPME36 and have the function of the gene GhPME 36.

In the above application, the plant may be any one of the following plants:

dicotyledonous plants, monocotyledonous plants, gramineae plants, cruciferous plants, cotton, upland cotton, gossypium barbadense, gossypium asianum, arabidopsis thaliana, wild-type arabidopsis thaliana Columbia.

The plant development described in the above application is cell wall development or secondary wall development.

In order to solve the problems, the invention also provides a method for cultivating the transgenic plant

The method for cultivating the transgenic plant comprises the following steps: introducing the coding gene GhPME36 into a receptor plant to obtain a transgenic plant with different growth and development from the receptor plant.

In the above method, the "introduction of the gene GhPME36 into the recipient plant" may be carried out by introducing a recombinant plasmid into the recipient plant.

The recombinant plasmid can be specifically regarded as a recombinant plasmid pBI121-GhPME 36.

The invention has the following beneficial effects:

the PMEs gene reduces the extracellular pH through methyl esterification reaction, so that the activity of various hydrolytic enzymes with loose cell walls is excited, such as polygalacturonase, pectin lyase and the like, pectin is degraded under the action of the enzymes, so that the molecular structure is destroyed, the cell walls are relaxed, and the cell growth is promoted.

Drawings

FIG. 1 is a fluorescent quantitative test chart of 4 selected pairs of dominantly expressed pectin methylesterase genes and their orthologous genes. Relative quantification of 4 genes histone 3 was used as reference gene and error bars indicate standard deviations of at least three technical replicates per sample; 10DPA 15DPA 20DPA

25DPA 30DPA fibers

10, 15, 20, 25 and 30 days after flowering.

FIG. 2 is a graph of the enzyme activity of pectin methylesterase enzyme in cotton fibers, which was measured 10, 15, 20, 25 and 30 days after flowering.

FIG. 3 is a CDS region diagram of the GhPME36 gene amplified by PCR, wherein 1 is the CDS full length 1368bp of the GhPME36 gene obtained by amplification, and M represents Marker 2000.

FIG. 4 is a plot of transgenic Arabidopsis kana resistance screens, in which shoots are the resistant shoots screened.

FIG. 5 is a diagram showing the expression of GhJAZ in transgenic Arabidopsis thaliana, wherein 1-4 are transgenic Arabidopsis thaliana, 5-7 are WT negative controls, 8 are plasmid positive controls, and M represents Marker 2000.

FIG. 6 is a phenotype comparison of the transgenic line GhPME36 with wild type Arabidopsis thaliana, where a indicates increased root length, b and c respectively indicate delayed bolting and flowering time, d indicates increased leaf width, and e indicates transgenic plant lodging resistance.

FIG. 7 is an electron microscope scan of the cell walls of the transgenic line GhPME36 and wild type Arabidopsis thaliana, f and g indicating stalk thickening, Bar =1 cm.

Detailed Description

The invention is described in further detail below with reference to specific embodiments, which are given by way of illustration only and are not intended to limit the scope of the invention.

In the following examples, the test methods, unless otherwise specified, are conventional; the materials, reagents and the like used, unless otherwise specified, are commercially available; quantitative experiments are carried out, three times of repeated experiments are set, and the results are averaged; the materials are selected from

cotton fiber tissues

10, 15, 20, 25 and 30 days after flowering respectively, and are abbreviated as 10DPA,15DPA and the like in the text, and the like.

TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal), TransStart Tip Green qPCR SuperMix is a product of gold corporation; pMD-18T Vector, PrimeScript RT reagent kit with gDNA Eraser (Perfect Real Time) are products of Takara corporation; the plant polysaccharide polyphenol RNA extraction kit is a product of Tiangen company.

Cotton varieties gossypium barbadense S-6, gossypium hirsutum 69307, gossypium barbadense of asian, No.1, raymond, are described in: bioinformatics analysis of the wana, white-senna, merchant marine red, yuan source asian cotton NAC transcription factor family and cloning and functional studies of related NAC genes, southwest university, master graduate thesis 2015. The biological material can be obtained by the public from the cotton research institute of Chinese academy of agricultural sciences, is only used for repeating the relevant experiments of the invention, and cannot be used for other use purposes. Hereinafter, upland cotton 69307 is abbreviated as 69307, sea island cotton S-6 is abbreviated as S-6, and Asian cotton-stone series No.1 is abbreviated as Asian cotton.

Wild type arabidopsis thaliana Columbia is described in the following documents: a gin, AR Matos, D Laffray, YZuily-Fodil, AT Pham-Thi. Effect of gravity stress on lipid metabolism in the vitamins of Arabidopsis (ecological Columbia). Annals of Botany,2004,94(3): 345. 351.

Agrobacterium tumefaciens GV3101 is described in: xiaoweimin, Gem, Zhoumai, Sucheng, Du soldier Arabidopsis Thaliana injured and inoculated with Agrobacterium tumefaciens GV3101 on transcription, proceedings of agricultural Biotechnology, 2013,21(5):537 and 545.

Plasmid pBI121 is described in the following documents: the plant gene library is a Liwei, a Gossypium hirsutum GhAQP and GhNAC family related gene cloning, expression and function preliminary study, Master thesis of southwest university, 2013.

The light-dark alternate culture is light culture and dark culture alternate, and the specific culture period can be as follows: 14 hours light culture/10 hours dark culture.

Example 1 real-time fluorescent quantitative expression analysis of PME family dominant expression genes

1. According to transcriptome analysis, 11, 5 and 3 PMEs genes which are preferentially expressed in 15DPA (belonging to the secondary wall thickening period) in fiber development are respectively found in upland cotton, Asian cotton and Redmond cotton.

2. 69307 and fibrous tissues of 10DPA,15DPA, 20DPA, 25DPA and 30DPA in different periods of Asian cotton fiber development are extracted, reverse transcription is carried out to form first strand cDNA, primers are designed according to dominant gene sequences, and Q-PCR amplification is carried out.

3. The procedure used to carry out the above experiment was a pre-denaturation at 95 ℃ for 15 s; denaturation at 95 ℃ for 5 s, renaturation at 60 ℃ for 34s, and extension at 72 ℃ for 40 s (data acquisition); (total 40 cycles).

4. The reference gene used for completing the above test is Histon-3, the primer sequences are Histon-F: GAAGCCTCATCGATACCGTC, Histon-R: CTACCACTACCATCATGGC

5. Each reaction is provided with 3 biological repetitions and 3 technical repetitions, and the differential expression analysis of relative quantification adopts 2^–ΔΔCTThe method is described in the following literature (Analysis of Relative Gene Expression Real-Time Quantitative PCR and the 2^–ΔΔCTMethod.Livak and Schmittgen,2001: 25, 402-408.

6. The results of the quantitative expression were analyzed in FIG. 1.

7. The results prove that: the expression levels of pectate methylase genes of Asian cotton and upland cotton have a peak value in the fiber development process, the peak value of the Asian cotton is mainly 20DPA in the fiber development process, the peak value of the upland cotton is mainly 25DPA, and the 25DPA in the fiber development process shows that the upland cotton is higher than the Asian cotton, which indicates that the PME family is really involved in the development process of the secondary wall.

Example 2 determination of PME Total enzyme Activity

1. The enzyme activity is determined by reference to the Hagerman test method, which is described in the following documents: hagerman, A.E.A., P.J. (1986) Continuous optometric assay for plant specimen show J.Agr. food. chem. 34, 440-444.

2. The results of the above experiment are shown in FIG. 2. The results show that: the activity of pectin methylesterase in different stages of cotton fiber development is different, the activity of pectin methylesterase in Asian cotton from fiber development of 10DPA to 25DPA is gradually increased along with the increase of development time, but the activity of pectin methylesterase in 30DPA is reduced. While the pectin methylesterase activity in upland cotton rose continuously from 10 to 30 DPA.

Example 3 cloning of the GhPME36 Gene

The present inventors cloned the gene GhPME36 from Asian cotton and 69307. The specific method comprises the following steps:

1. obtaining a template: total RNA from cotton fibers of Asia was extracted from 10DPA,15DPA, 20DPA, 25DPA and 30DPA of Asia cotton and 69307, respectively, using the kit, and then reverse-transcribed to obtain first strand cDNA using PrimeScript RT reagent kit with gDNA Eraser (perfect Real Time).

2. Artificially synthesizing a primer GhPME 36-F:CGCGGATCCGCGGGCATTGGCACGTCTTCAAAT (recognition sequence for restriction enzyme BamHI underlined) and GhPME 36-R:CGAGCTCGTAAAGCCCTGAAGTGAAAGGC (recognition sequence for the restriction endonuclease SacI is underlined).

3. After the

steps

1 and 2 are completed, PCR amplification is carried out by taking the cDNA obtained in the step 1 as a template and the GhPME36-F and GhPME36-R synthesized in the step 2 as primers, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, and 72 ℃ for 2 min; at 72 ℃ for 10min, the experimental result is shown in figure 3, and the result obtains double-stranded DNA molecules of about 1368bp, and then the DNA fragments are obtained after purification and recovery.

4. Ligating the double-stranded DNA molecule obtained in step 3 to pMD18^TM(simple) T vector to obtain recombinant plasmid pMD18-GhPME 36.

5. Through sequencing, the recombinant plasmid pMD18-GhPME36 contains a DNA molecule shown as a sequence 1 in a sequence table.

Example 4 acquisition and phenotypic characterization of plants transformed with GhPME36 Gene

Construction of recombinant plasmid pBI121-GhPME36

1. The recombinant plasmid pMD18-GhPME36 was digested with restriction enzymes BamHI and SacI, and the DNA fragment was recovered and purified.

2. Plasmid pBI121 was double digested with restriction enzymes BamHI and SacI, and the vector backbone of about 13K was recovered.

3. The DNAs obtained in

steps

1 and 2 were ligated with T4 ligase at 16 ℃ overnight to obtain recombinant plasmid pBI121-GhPME 36.

4. According to the sequencing results, the recombinant plasmid pBI121-GhPME36 was described as follows: the insertion of the nucleotide sequence between the restriction enzyme BamHI and SacI cleavage sites of plasmid pBI121 is a DNA molecule shown in sequence 1 in the table.

Second, the acquisition of GhPME36 transgenic plant

1. The recombinant plasmid pBI121-GhPME36 is introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens.

2. The recombinant agrobacterium obtained in the step 1 is transferred into wild arabidopsis thaliana to obtain T1 generation GhPME36 gene arabidopsis thaliana seeds by adopting an arabidopsis thaliana inflorescence floral dip transformation method (described in the following documents: high building strength, Lianghua, Zhaojun. plant genetic transformation agrobacterium floral dip research progress, Chinese agronomy report, 2010,26(16): 22-25).

3. And (3) sowing the T1 generation transgenosis-simulating arabidopsis seeds obtained in the step (2) on an MS culture medium containing 50mg/L kanamycin, wherein arabidopsis (resistant seedlings) capable of growing normally is positive seedlings of the T1 generation transgenosis GhPME36 genes, and the seeds received from the T1 generation transgenosis GhPME36 gene positive seedlings are T2 generation transgenosis GhPME36 gene arabidopsis seeds.

4. And (3) sowing the arabidopsis seeds of T2 generation simulated GhPME36 gene of different strains obtained by screening in the step (3) on an MS culture medium containing 50mg/L kanamycin for growth, wherein if the ratio of the number of arabidopsis seeds (resistant seedlings) capable of normally growing in a certain strain to the number of arabidopsis seeds (non-resistant seedlings) incapable of normally growing in the strain is 3:1, the strain is a strain with one copy of the GhPME36 gene inserted, and the seeds received by the resistant seedlings in the strain are T3 generation homozygous GhPME36 gene-transformed arabidopsis.

5. And (3) sowing the arabidopsis seeds of the T3 generation simulated GhPME36 gene screened in the step (4) on a 1/2MS culture medium containing 50mg/L kanamycin to screen, wherein all the arabidopsis seeds are resistant seedlings, namely the arabidopsis seeds of the T3 generation homozygous simulated GhPME36 gene. Arabidopsis lines in which 2T 3 generations were homozygous for the GhPME36 gene were designated L1 and L2, respectively.

III, transformation of No-load Arabidopsis

Replacing the recombinant plasmid pBI121-GhPME36 with pBI121 according to the method of the second step, and obtaining T3 generation homozygous empty vector Arabidopsis thaliana, namely the pseudo-transgenic empty vector Arabidopsis thaliana for short, with the same other steps.

Four, molecular detection

The PCR amplification was carried out using genomic DNA of wild type Arabidopsis thaliana, T3 generation plant of Arabidopsis thaliana with a pseudo-empty vector, T3 generation plant of L1, or T3 generation plant of L2 as a template, and primers GhPME36-F and GhPME36-R artificially synthesized in example 3 as primers.

The PCR amplification experiment result is shown in FIG. 5, and the result shows that the genome DNA of the T3 generation plant of L1 or the T3 generation plant of L2 is taken as a template, and a 1368bp band can be obtained through amplification; however, genomic DNA of wild Arabidopsis and pseudo-empty vector Arabidopsis are used as templates, and a 1368bp band cannot be obtained by amplification. Therefore, T3 generation plants of L1 and T3 generation plants of L2 are identified as T3 generation homozygous transgenic GhPME36 gene Arabidopsis thaliana, and pseudo-transgenic empty vector Arabidopsis thaliana is identified as transgenic empty vector Arabidopsis thaliana.

Phenotypic identification of GhPME36 transgenic Arabidopsis thaliana

1. Identification of root length

The experiment was repeated three times and the average was taken, 30 seeds were repeated per line.

And (3) taking wild type arabidopsis seeds, T3 generation seeds of empty vector arabidopsis and T3 generation seeds of L1, sowing the seeds on an MS culture medium, alternately culturing for two weeks in light and dark at 20 ℃, and counting the root length.

The results of the experiment are shown in FIG. 6. The root length results were identified as follows: the transgenic line of GhPME36 showed a 19.5% increase in root length compared to the control wild type.

2. Identification of bolting morning and evening

And (3) sowing seeds of wild arabidopsis thaliana, seeds of T3 generation of empty vector arabidopsis thaliana and seeds of T3 generation of L1 on an MS culture medium, alternately culturing for two weeks in light and dark at 20 ℃, and recording bolting time.

The results of the experiment are shown in FIG. 6. The bolting time of the GhPME36 is about one week later than that of the wild type.

3 characterization of blade Width

Taking wild type Arabidopsis seeds, T3 generation seeds of empty vector Arabidopsis, and T3 generation seeds of L1, sowing on an MS culture medium, culturing alternately in light and dark at 20 ℃, and measuring the leaf length and the leaf width of 1-, 3-, 5-, 7-, 9-, 11-th rosette leaves of 30-day-sized seedlings.

The results of the experiment are shown in FIG. 6. The leaf length of the GhPME36 is 8%, 70%, 76%, 57%, 28% and 11.5% higher than the height of wild type Arabidopsis thaliana respectively; the 1-, 3-, 5-and 7-leaf widths of the GhPME36 are respectively 25%, 26%, 78% and 60% wider than that of wild type Arabidopsis thaliana.

4. Identification of stalk diameter

The wild type arabidopsis seeds, the T3 generation seeds of the empty vector arabidopsis and the T3 generation seeds of the L1 are taken, sowed on an MS culture medium, and are alternately cultured in light and dark at the temperature of 20 ℃, and the stems are taken for scanning by a fluorescence electron microscope.

The results of the experiment are shown in FIG. 7. The stem of the GhPME36 plant is 5% thicker than the wild type.

<110> Cotton research institute of Chinese academy of agricultural sciences

Application of <120> GhPME36 gene in regulation and control of plant secondary wall development

<160>1

<210>1

<211>1368

<212>DNA

<400>1

ATGGTGAAATCCATCCTCGACTCCTCCAAAGGCAACCTCAACCGCTCTAA

CGCCGCCGCCATCTGTCTCAACATCCTTTCTAATTCTGATTACCGCATAA

GATCGACCAATGACGCTCTGGCACGTGGCAAGATCAAGGACGCTCGTGCG

TGGATGAGCGCGGCCCTTTGCTACCAATACGATTGTTGGAGCGCGCTCAA

GTACGTAAATGACACCAAATTGGTCGGTGAAACGATGGCGTTTTTGGACT

CTTTAACGCAACACAGCAGCAACGCGTTGAGCATGATGGTCGCCTACGAT

AATAACGGGGAGGACATAGCCGCGTGGGTCCCTCCCAAGACGGAACGGGA

CGGGTTCTACGAGAACGGGTCGGGTGGGACGGAGCTGGGGTTTAACGGGG

GTTTACCGTCAAACTTGAAGACGGACGTAACGGTGTGTAAAGACGGGAGC

GGAGGGTGTTACAAGACAGTGCAAGAGGCCGTCAACACAGCACCGGCAAA

TGCAGAGAGTACACGCCGTTTCGTGATATATATAAAGGAAGGTGTGTACG

AAGAAACGGTGAGGGTGCCACTGGAGAAGAAAAATGTGGTCTTTTTGGGG

GATGGAATGGGTAAAACCATCATTACGGGTGCTTTAAATGCAGGGATGCC

TGGACTTACCACTTATGAGACTGCTACTGTCGGGGTTCTTGGGGATGGAT

TTATGGCCAGTGGACTCACAATCCGGAACACAGCAGGCCCTGATGCCCAC

CAAGCCGTAGCCTTTAGATCAGATAGTGATCTTTCTGTCATTGAGAACTG

TGAATTCCTAGGCAACCAAGATACTCTCTACGCTCACTCCCTCCGCCAGT

TCTACAGGAAGTGCCGTATTCAGGGGAACGTGGACTTCATCTTCGGGAAT

TCTGCCTCGGTGTTCCAAGATTGTGAAATTTTGGTTGCTCCCCGGCAGGT

AAAACCCGAAAAAGGTGAGAACAATGCTGTGACAGCTCATGGTAGAACTG

ATCCTGCTCAATCGACTGGTCTGGTTTTCCAGAACTGCTTGATCAACGGA

ACTGATGAATACATGAGATACTATTATAGCAAGCCTAAAGTGCACAAGAA

CTTTTTGGGAAGGCCATGGAAGGAATATTCAAGGACAGTTTTTATAAATT

GTGTTATGGAAGCACTTATTAATCCAAATGGATGGATGCCATGGAAGGGT

GACTTTGCATTGAAAACACTCTTCTATGGAGAATTTGGGAATTCTGGTCT

TGGATCCATTCCATTGAACAGAGTTCCATGGAGTACTCAAATTCCACCCC

AGCATGTACATACATTTTCAGTCCAAAATTTCATTCAAGGAGATCAATGG

ATTCCAACATCATCTTGA

Claims

The application of GhPME36 gene in regulating plant development is characterized in that: the nucleotide sequence of the GhPME36 gene is shown in SEQ ID No. 1.
2. Use according to claim 1 for regulating plant cell wall development.
3. Use according to claim 2, for modulating the development of a secondary wall of a plant cell.
4. Use according to any one of claims 1 to 3, wherein the plant is a dicotyledonous or monocotyledonous plant.
5. The use according to claim 4, wherein the plant is a graminaceous plant or a cruciferous plant.
6. Use according to any one of claims 1 to 3, wherein the plant is cotton or Arabidopsis thaliana.
7. Use according to any one of claims 1 to 3, characterized in that: the plant is Asian cotton, upland cotton, or Ramengde cotton.
8. A method for cultivating transgenic plants comprises introducing GhPME36 gene into receptor plants, and screening to obtain transgenic plants for regulating and controlling secondary wall development; the nucleotide sequence of the GhPME36 gene is shown in SEQ ID No. 1.
9. The method of claim 8, wherein the plant is a dicot or a monocot.
10. The method of claim 9, wherein the plant is a graminaceous plant or a cruciferous plant.
11. Use according to claim 8, wherein the plant is cotton or Arabidopsis thaliana.
12. The use of claim 11, wherein: the plant is Asian cotton, upland cotton or Ramengde cotton.