CN110278918A - A kind of Lueyang Gallus domesticlus brisson selection - Google Patents
A kind of Lueyang Gallus domesticlus brisson selection Download PDFInfo
- Publication number
- CN110278918A CN110278918A CN201910740540.6A CN201910740540A CN110278918A CN 110278918 A CN110278918 A CN 110278918A CN 201910740540 A CN201910740540 A CN 201910740540A CN 110278918 A CN110278918 A CN 110278918A
- Authority
- CN
- China
- Prior art keywords
- generation
- lueyang
- gallus domesticlus
- domesticlus brisson
- selection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000287826 Gallus Species 0.000 title claims abstract description 82
- 238000009395 breeding Methods 0.000 claims abstract description 60
- 230000001488 breeding effect Effects 0.000 claims abstract description 58
- 235000013372 meat Nutrition 0.000 claims abstract description 23
- 238000005516 engineering process Methods 0.000 claims abstract description 7
- 238000000034 method Methods 0.000 claims abstract description 7
- 241000287828 Gallus gallus Species 0.000 claims description 15
- 230000037406 food intake Effects 0.000 claims description 5
- 230000008774 maternal effect Effects 0.000 claims description 5
- 210000003323 beak Anatomy 0.000 claims description 4
- 210000001930 leg bone Anatomy 0.000 claims description 4
- 238000009394 selective breeding Methods 0.000 claims description 4
- 102100039939 Growth/differentiation factor 8 Human genes 0.000 claims description 3
- 108050006583 Growth/differentiation factor 8 Proteins 0.000 claims description 3
- 101001139117 Homo sapiens Krueppel-like factor 7 Proteins 0.000 claims description 3
- 102100020692 Krueppel-like factor 7 Human genes 0.000 claims description 3
- 239000008280 blood Substances 0.000 claims description 3
- 210000004369 blood Anatomy 0.000 claims description 3
- 241000561734 Celosia cristata Species 0.000 claims description 2
- 210000001520 comb Anatomy 0.000 claims description 2
- 230000036541 health Effects 0.000 claims description 2
- 235000021050 feed intake Nutrition 0.000 claims 1
- 230000036750 egg laying performance Effects 0.000 abstract description 18
- 238000004519 manufacturing process Methods 0.000 abstract description 7
- 210000000991 chicken egg Anatomy 0.000 abstract description 3
- 241000271566 Aves Species 0.000 abstract description 2
- 230000013011 mating Effects 0.000 abstract description 2
- 235000013601 eggs Nutrition 0.000 description 27
- 238000011161 development Methods 0.000 description 5
- 230000018109 developmental process Effects 0.000 description 5
- 230000017448 oviposition Effects 0.000 description 5
- 238000010586 diagram Methods 0.000 description 4
- 230000009897 systematic effect Effects 0.000 description 4
- 230000012447 hatching Effects 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 230000003442 weekly effect Effects 0.000 description 3
- 230000004720 fertilization Effects 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- 230000015556 catabolic process Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007423 decrease Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 210000003608 fece Anatomy 0.000 description 1
- 230000035558 fertility Effects 0.000 description 1
- 239000000796 flavoring agent Substances 0.000 description 1
- 235000019634 flavors Nutrition 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000008821 health effect Effects 0.000 description 1
- 239000010871 livestock manure Substances 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 235000013622 meat product Nutrition 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000012797 qualification Methods 0.000 description 1
- 230000003716 rejuvenation Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000002560 therapeutic procedure Methods 0.000 description 1
- 238000012549 training Methods 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The embodiment of the invention discloses a kind of Lueyang Gallus domesticlus brisson selections, it is related to birds breeding technology field, the selection includes the following steps: step 1: from 4 small towns of Lueyang Gallus domesticlus brisson cradle Heihe River basin, selecting and carries out mating with black plumage, the black complete black male and female individual of color characteristic character and produce one from generation to generation；Step 2: will have black plumage, black color characteristic character complete black in a generation of step 1 generation and meet the cock of the selected standard of performance and hen is reserved seed for planting；Step 3: the cock that step 2 is selected and remain and hen set up family half sibs and carry out panmixia breeding；Male and female individual is selected and remain according to step 2 method, through 3-5 generation breeding, cultivates egg strain Lueyang Gallus domesticlus brisson or meat line Lueyang Gallus domesticlus brisson.Selection of the invention uses swarm robotic system selection-breeding method to select family by generation as unit of family, obtains an egg laying performance and a meat production is promoted and can stablize the strain of heredity, to reduce commodity black-bone chicken egg and baby chick production cost.
Description
Technical field
The present embodiments relate to birds breeding technology fields, and in particular to a kind of Lueyang Gallus domesticlus brisson selection.
Background technique
Lueyang Gallus domesticlus brisson is figure biggish one in the existing silkies strain of the distinctive poultry variety source in Shaanxi Province and China
Kind Gallus domesticlus brisson.The kind muscle unique flavor, it is full of nutrition to have both food therapy health effect, it is welcomed by consumers.
But Lueyang Gallus domesticlus brisson long-term field free-ranging, chicken manure do not separate, and cause kind hydridization, degradation phenomena more serious.Slightly
The macroscopic features that positive Gallus domesticlus brisson so mixes undoubtedly brings larger difficulty to the identification of kind, while also causing to its traction
Greater impact.Lueyang Gallus domesticlus brisson possession side original variety, production performance are simultaneously not affected by systematic breeding, excellent without biggish raising
Gesture, growth and the more mature business egg of egg laying performance, broiler chicken kind still have larger gap, and popularity is not high, this is seriously constrained
The development and utilization of Lueyang silkies strain resource.At present the slow growth of Lueyang Gallus domesticlus brisson, lay eggs it is low, increase raising and feed at
This, is unfavorable for the popularization of the marketization.
The Age at first laying for showing Buddhist nun gram laying hen according to early-stage study is 17 week old, and peak period laying rate is 89%, peak period
Later the amplitude that laying rate declines weekly is 0.2%；And Lueyang Gallus domesticlus brisson Age at first laying raised under identical environment is 21 weeks, it is high
Peak phase laying rate is 53%, and the amplitude that laying rate declines weekly after peak period is 0.8%.Lueyang Gallus domesticlus brisson totality egg laying performance is remote
Far below the business layer breed by systematic breeding.Meanwhile Lueyang Gallus domesticlus brisson egg laying performance shows biggish populational variation,
By taking 40 week old egg numbers as an example, the coefficient of variation is up to 40%.It is numerous that deficiency of Lueyang Gallus domesticlus brisson in terms of egg laying performance increases Gallus domesticlus brisson
The production cost with commodity egg is educated, totally unfavorable influence is caused to the development of Gallus domesticlus brisson industry.
Summary of the invention
For this purpose, the embodiment of the present invention provides a kind of Lueyang Gallus domesticlus brisson selection, to solve in the prior art due to Lueyang crow
Chicken is not made kind growth and the more mature business egg of egg laying performance and broiler chicken kind still have larger gap, mesh by systematic breeding
The slow growth of preceding Lueyang Gallus domesticlus brisson and the low increase for leading to raising and feed cost of laying eggs.
To achieve the goals above, the embodiment of the present invention provides the following technical solutions:
According to a first aspect of the embodiments of the present invention, a kind of Lueyang Gallus domesticlus brisson selection, the selection include as follows
Step:
Step 1: it from 4 small towns of Lueyang Gallus domesticlus brisson cradle Heihe River basin, selects complete with black plumage, black color characteristic character
The male and female individual of crow carries out panmixia according to male and female proportion for the ratio of 1:(8-12) and produces one from generation to generation；
Step 2: will have black plumage, black color characteristic character complete black in a generation of step 1 generation and meet performance and select
Quasi- cock and hen is calibrated to reserve seed for planting；The crow full crow of color characteristic character refers to that skin, bone, leg, toe, tongue, hat, beak are crow
Color；
Step 3: the cock that step 2 is selected and remain and hen set up family half sibs and carry out panmixia breeding, carry out a
Body record and family selective breeding；Male and female individual is selected and remain according to step 2 method, through 3-5 generation breeding, cultivates egg strain Lueyang
Gallus domesticlus brisson or meat line Lueyang Gallus domesticlus brisson.
Further, in step 2, when cultivating egg with strain Lueyang Gallus domesticlus brisson, it is Age at first laying that the performance of hen, which selectes standard,
It is (220 ± 5) piece/year for 150 days and 40 weeks egg numbers, it is blood sisters's egg number (240 ± 5) that the performance of cock, which selectes standard,
Piece/year or/and maternal egg number (250 ± 5) piece/year.
Further, in step 2, when cultivating meat line Lueyang Gallus domesticlus brisson, the performance of cock and hen is selected standard and is wrapped
Include health, have a full figure, cockscomb is clean and tidy and 40 days weight reaches (600 ± 5) gram.
Further, in step 2, when cultivating meat line Lueyang Gallus domesticlus brisson, it further includes 18 weeks that the performance of cock, which selectes standard,
When age, the daily gain of cock is (18.42 ± 1.01) gram, daily ingestion amount is (104.15 ± 2.66) gram, feed-weight ratio be 5.66 ±
0.26, the performance of hen selectes standard when further including 18 week old, and the daily gain of hen is (11.53 ± 0.36) gram, daily ingestion amount:
(76.16 ± 2.71) gram, feed-weight ratio are 6.62 ± 0.38.
Further, in the selection since zero generation, 12 months each generation intevals.
Further, the generation breeding group scale be 635 hens, 337 cocks, cock reserve seed for planting rate be 14%,
Hen rate of reserving seed for planting is 66%, sets up 48 family half sibs breeding two from generation to generation；The scale of two generation breeding groups is 958 cocks,
The rate of reserving seed for planting of 951 hens, cock is 6%, and hen rate of reserving seed for planting is 57%, sets up 60 family half sibs breeding three from generation to generation, training
Bring out egg strain Lueyang Gallus domesticlus brisson.
Further, the generation breeding group scale be 1200 hens, 80 cocks, cock reserve seed for planting rate be 10%,
Hen rate of reserving seed for planting is 80%, sets up 65 family half sibs breeding two from generation to generation；The scale of two generation breeding groups is 120 cocks,
The rate of reserving seed for planting of 1500 hens, cock is 15%, and hen rate of reserving seed for planting is 86%, sets up 65 family half sibs breeding three from generation to generation,
Cultivate meat line Lueyang Gallus domesticlus brisson.
Further, genome scanning is also carried out using molecular breeding technology to chicken is reserved seed for planting in step 2, screening is effective
SNP selects site.
Further, it when cultivating meat line Lueyang Gallus domesticlus brisson, filters out effectively meat performance-relevant with Lueyang Gallus domesticlus brisson
SNP selects site for following two:
MSTN
5’-GGCTGGAACAAGCACCTAACATTAGCAGGGACGTTATTAAA(G)CAGCTTTTACCCAAAGCTCCT
CCACTGCAGGAACTGATTGATCAGTATGATGTCCAGAG-3'；
KLF7
5’-AGACCAACTGAAGTGAGCAAAAGAAAGCTTTTTTTCT(A)CTTTTCTGCTTCATGCTATTTCCTC
ATCTGTTCT-3’。
The embodiment of the present invention has the advantages that
A kind of Lueyang Gallus domesticlus brisson selection of the embodiment of the present invention uses swarm robotic system selection-breeding method to choose as unit of family by generation
Family is selected, an egg laying performance is obtained and a meat production is promoted and can stablize the strain of heredity, to reduce commodity
Black-bone chicken egg and baby chick production cost also establish novel Gallus domesticlus brisson breed system for the later period and lay the foundation.
A kind of Lueyang Gallus domesticlus brisson selection of the embodiment of the present invention is using modern biotechnology and utilizes locking Systematic Breeding skill
Art achievees the purpose that conservation while purification and rejuvenation to Lueyang Gallus domesticlus brisson.
The breeding of Gallus domesticlus brisson egg laying performance and meat production is improved, helps to reduce being produced into for commodity black-bone chicken egg and baby chick
This, reduces market sale price, improves the occupation rate of market of Gallus domesticlus brisson Related product, attracts more raisers to throw oneself into Gallus domesticlus brisson and supports
It grows, with the development thrust zone economic development of characteristic fowl industry, solves surplus rural labor force.
Detailed description of the invention
It, below will be to embodiment party in order to illustrate more clearly of embodiments of the present invention or technical solution in the prior art
Formula or attached drawing needed to be used in the description of the prior art are briefly described.It should be evident that the accompanying drawings in the following description is only
It is merely exemplary, it for those of ordinary skill in the art, without creative efforts, can also basis
The attached drawing of offer, which is extended, obtains other implementation attached drawings.
Structure depicted in this specification, ratio, size etc., only to cooperate the revealed content of specification, for
Those skilled in the art understands and reads, and is not intended to limit the invention enforceable qualifications, therefore does not have technical
Essential meaning, the modification of any structure, the change of proportionate relationship or the adjustment of size are not influencing the function of the invention that can be generated
Under effect and the purpose that can reach, should all still it fall in the range of disclosed technology contents can cover.
Fig. 1 is an a kind of generation of Lueyang Gallus domesticlus brisson selection that the embodiment of the present invention 1 provides and the egg productivity of two generations
The comparison diagram of energy；
Fig. 2 is an a kind of generation of Lueyang Gallus domesticlus brisson selection that the embodiment of the present invention 1 provides and the egg number of two generations
With the comparison diagram of laying rate；
To the body of a generation chicken difference week old in a kind of Lueyang Gallus domesticlus brisson selection that Fig. 3 provides for the embodiment of the present invention 2
The statistical analysis figure of weight；
First generation of breeding, the second generation in a kind of Lueyang Gallus domesticlus brisson selection that Fig. 4 provides for the embodiment of the present invention 2
Generation, third generation chicken growth and development situation comparison diagram；
First generation of breeding, the second generation in a kind of Lueyang Gallus domesticlus brisson selection that Fig. 5 provides for the embodiment of the present invention 2
Generation, third generation chicken weight 4th week and the 8th week weight comparison diagram.
Specific embodiment
Embodiments of the present invention are illustrated by particular specific embodiment below, those skilled in the art can be by this explanation
Content disclosed by book is understood other advantages and efficacy of the present invention easily, it is clear that described embodiment is the present invention one
Section Example, instead of all the embodiments.Based on the embodiments of the present invention, those of ordinary skill in the art are not doing
Every other embodiment obtained under the premise of creative work out, shall fall within the protection scope of the present invention.
As table 1 analyzes tri- kinds of Lueyang Gallus domesticlus brisson male and female proportion situation hatching eggs of 1:8,1:10,1:12 in early-stage study
Rate of fertilization, wherein with the mating fertility rate of hatching egg highest of male and female 1:8.
The rate of fertilization of 1 Lueyang Gallus domesticlus brisson difference male and female of table proportion hatching egg compares
Note: mean difference is not significant (P > 0.05) between the identical expression group of same column shoulder mark, between same column shoulder mark difference expression group
Number significant difference (P < 0.05)
Embodiment 1
A kind of Lueyang Gallus domesticlus brisson selection, which is characterized in that the selection includes the following steps:
Step 1: it from 4 small towns of Lueyang Gallus domesticlus brisson cradle Heihe River basin, selects complete with black plumage, black color characteristic character
The male and female individual of crow carries out panmixia according to the ratio that male and female proportion is 1:8 and produces one from generation to generation；
Step 2: will have black plumage, black color characteristic character complete black in a generation of step 1 generation and meet performance and select
Quasi- cock and hen is calibrated to reserve seed for planting；The crow full crow of color characteristic character refers to that skin, bone, leg, toe, tongue, hat, beak are crow
Color；
Step 3: the cock that step 2 is selected and remain and hen set up family half sibs and carry out panmixia breeding, carry out a
Body record and family selective breeding；Male and female individual is selected and remain according to step 2 method, through the breeding of 3 generations, cultivates egg strain Lueyang crow
Chicken.
In step 2, when cultivating egg with strain Lueyang Gallus domesticlus brisson, the performance of hen select standard be Age at first laying be 150 days and
40 weeks egg numbers are (220 ± 5) piece/year, the performance of cock select standard be blood sisters's egg number (240 ± 5) piece/year or/
With maternal egg number (250 ± 5) piece/year.
Cock egg-laying deseription is using compatriot and the seed selection of parent's egg laying performance merged index back-and-forth method, born of the same parents and parent's egg productivity
50% weight can be respectively accounted for, egg-laying deseription belongs to low genetic force sex-limited character, adopts to the breeding conventional method of cock egg-laying deseription more
With indirect selections born of the same parents.But Lueyang Gallus domesticlus brisson egg laying performance is poor, the quantity of hen is very in a family full-sibs sometimes
Few, this brings very big difficulty and inaccuracy to the selection of cock egg-laying deseription.The present invention examines on the basis of Sib selection
Consider maternal egg laying performance, the average egg laying performance of compatriot and maternal egg laying performance are fitted to by merged index with the weight for respectively accounting for 50%
Breeding is carried out to cock egg laying performance.
In the selection since zero generation, 12 months each generation intevals.
The one generation breeding group scale is 635 hens, 337 cocks, and cock rate of reserving seed for planting is 14%, and hen is reserved seed for planting rate
It is 66%, sets up 48 family half sibs breedings two from generation to generation；The scale of two generation breeding groups be 958 cocks, 951 hens,
The rate of reserving seed for planting of cock is 6%, and hen rate of reserving seed for planting is 57%, sets up 60 family half sibs breeding three from generation to generation, cultivates egg articles
It is Lueyang Gallus domesticlus brisson.
The achievement of egg laying performance breeding at present:
Compare the egg laying performance of a generation and two generations, as shown in Figure 1, two generations egg-laying peak laying rate than one
10 percentage points are improved from generation to generation, amplitude decline of the laying rate more to balance after peak period.Since Lueyang Gallus domesticlus brisson is being laid eggs
Endurance of laying eggs after peak period laying rate and peak period is significantly improved, as shown in Fig. 2, Lueyang Gallus domesticlus brisson maintained at present educates
The annual egg number of kind core group is promoted to 171 pieces from the 85 of a generation pieces, and egg laying performance improves 1 times.
Embodiment 2
A kind of Lueyang Gallus domesticlus brisson selection, which is characterized in that the selection includes the following steps:
Step 1: it from 4 small towns of Lueyang Gallus domesticlus brisson cradle Heihe River basin, selects complete with black plumage, black color characteristic character
The male and female individual of crow carries out panmixia according to the ratio that male and female proportion is 1:10 and produces one from generation to generation；
Step 2: will have black plumage, black color characteristic character complete black in a generation of step 1 generation and meet performance and select
Quasi- cock and hen is calibrated to reserve seed for planting；The crow full crow of color characteristic character refers to that skin, bone, leg, toe, tongue, hat, beak are crow
Color；
Step 3: the cock that step 2 is selected and remain and hen set up family half sibs and carry out panmixia breeding, carry out a
Body record and family selective breeding；Male and female individual is selected and remain according to step 2 method, through the breeding of 3 generations, cultivates meat line Lueyang crow
Chicken.
In step 2, when cultivating meat line Lueyang Gallus domesticlus brisson, when the selected standard of the performance of cock further includes 18 week old, cock
Daily gain be (18.42 ± 1.01) gram, daily ingestion amount is (104.15 ± 2.66) gram, feed-weight ratio is 5.66 ± 0.26, hen
Performance select standard when further including 18 week old, the daily gain of hen is (11.53 ± 0.36) gram, daily ingestion amount: (76.16 ±
2.71) gram, feed-weight ratio is 6.62 ± 0.38.
In the selection since zero generation, 12 months each generation intevals.
The one generation breeding group scale is 1200 hens, 80 cocks, and cock rate of reserving seed for planting is 10%, and hen is reserved seed for planting rate
It is 80%, sets up 65 family half sibs breedings two from generation to generation；The scale of two generation breeding groups be 120 cocks, 1500 hens,
The rate of reserving seed for planting of cock is 15%, and hen rate of reserving seed for planting is 86%, sets up 65 family half sibs breeding three from generation to generation, cultivates meat product
It is Lueyang Gallus domesticlus brisson.
Genome scanning is also carried out using molecular breeding technology to chicken is reserved seed for planting in step 2, screens effective SNP selection position
Point.
Meat line Lueyang Gallus domesticlus brisson growth performance breeding achievement at present:
The egg laying performance of a generation and two generations are compared, two generations were increased to after 42 days de- temperature by original 390 grams existing
600 grams after 42 days de- temperature, the speed of growth improves 65% after the growth rate of Lueyang Gallus domesticlus brisson and peak period.
To a generation, the chicken of different week old is inspected by random samples, carries out the measurement of weight, and for statistical analysis, as shown in figure 3,
The volume growth for understanding Lueyang Gallus domesticlus brisson Meat Traits is studied, volume growth is not only that breeding work is established in 7 week old in this way
Determine basic basis, the exploitation of new lines special feed provides reference for the later period.
Breeding has had progressed to third from generation to generation, breeding achievement highly significant.As shown in figure 4, Lueyang Gallus domesticlus brisson is nascent
Weight has improved 30.62 grams, measures weight weekly and has significantly improved.P1, P2, P3 respectively represent breeding first from generation to generation, the
Two generations, third are from generation to generation.
Basic research dynamics is increased, by carrying out genome scanning using molecular breeding technology to chicken is reserved seed for planting, screening is effective
SNP select site, filter out effectively select site for following two with the meat performance-relevant SNP of Lueyang Gallus domesticlus brisson at present:
MSTN
5’-GGCTGGAACAAGCACCTAACATTAGCAGGGACGTTATTAAA(G)CAGCTTTTACCCAAAGCTCCT
CCACTGCAGGAACTGATTGATCAGTATGATGTCCAGAG-3'；
KLF7
5’-AGACCAACTGAAGTGAGCAAAAGAAAGCTTTTTTTCT(A)CTTTTCTGCTTCATGCTATTTCCTC
ATCTGTTCT-3’。
As shown in figure 5, the 4th week and the 8th week weight by three generation populations to breeding compare and analyze,
It is completed and verifies from generation to generation, show that above two SNP selection site is related to the promotion of Lueyang Gallus domesticlus brisson Meat Performance.P1, P2, P3 points
The first generation of breeding, the second generation, third are not represented from generation to generation.
The accuracy and science of the seed selection of meat line Lueyang Gallus domesticlus brisson are thus further improved, breeding has been dramatically speeded up
Speed.
Although above having used general explanation and specific embodiment, the present invention is described in detail, at this
On the basis of invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Therefore,
These modifications or improvements without departing from theon the basis of the spirit of the present invention are fallen within the scope of the claimed invention.
Claims (9)
1. a kind of Lueyang Gallus domesticlus brisson selection, which is characterized in that the selection includes the following steps:
Step 1: it from 4 small towns of Lueyang Gallus domesticlus brisson cradle Heihe River basin, selects with black plumage, black color characteristic character full crow
Male and female individual carries out panmixia according to male and female proportion for the ratio of 1:(8-12) and produces one from generation to generation；
Step 2: will have black plumage, black color characteristic character complete black in a generation of step 1 generation and meet performance and select mark
Quasi- cock and hen is reserved seed for planting；The crow full crow of color characteristic character refers to that skin, bone, leg, toe, tongue, hat, beak are black color；
Step 3: the cock that step 2 is selected and remain and hen set up family half sibs and carry out panmixia breeding, carry out individual note
Record and family selective breeding；Male and female individual is selected and remain according to step 2 method, through 3-5 generation breeding, cultivates egg strain Lueyang Gallus domesticlus brisson
Or meat line Lueyang Gallus domesticlus brisson.
2. a kind of Lueyang Gallus domesticlus brisson selection as described in claim 1, which is characterized in that in step 2, cultivate egg strain
When the Gallus domesticlus brisson of Lueyang, it is that Age at first laying is 150 days and 40 weeks egg numbers are (220 ± 5) piece/year that the performance of hen, which selectes standard, public
It is blood sisters's egg number (240 ± 5) piece/year or/and maternal egg number (250 ± 5) piece/year that the performance of chicken, which selectes standard,.
3. a kind of Lueyang Gallus domesticlus brisson selection as described in claim 1, which is characterized in that in step 2, cultivate meat line
When the Gallus domesticlus brisson of Lueyang, the performance of cock and hen select standard include health, have a full figure, cockscomb is clean and tidy and 40 days weight reaches
To (600 ± 5) gram.
4. a kind of Lueyang Gallus domesticlus brisson selection as claimed in claim 3, which is characterized in that in step 2, cultivate meat line
When the Gallus domesticlus brisson of Lueyang, when the selected standard of the performance of cock further includes 18 week old, the daily gain of cock is (18.42 ± 1.01) gram, day
Feed intake is (104.15 ± 2.66) gram, feed-weight ratio is 5.66 ± 0.26, and the performance of hen selectes standard when further including 18 week old,
The daily gain of hen is (11.53 ± 0.36) gram, daily ingestion amount: (76.16 ± 2.71) gram, feed-weight ratio are 6.62 ± 0.38.
5. a kind of Lueyang Gallus domesticlus brisson selection as described in claim 1, which is characterized in that in the selection from generation to generation from zero
Start, 12 months each generation intevals.
6. a kind of Lueyang Gallus domesticlus brisson selection as claimed in claim 2, which is characterized in that the generation breeding group scale is
635 hens, 337 cocks, cock rate of reserving seed for planting is 14%, and hen rate of reserving seed for planting is 66%, sets up the breeding of 48 family half sibs
Two from generation to generation；The scale of two generation breeding groups is 958 cocks, and the rate of reserving seed for planting of 951 hens, cock is 6%, and the hen rate of reserving seed for planting is
57%, it sets up 60 family half sibs breedings three from generation to generation, cultivates egg strain Lueyang Gallus domesticlus brisson.
7. a kind of Lueyang Gallus domesticlus brisson selection as claimed in claim 4, which is characterized in that the generation breeding group scale is
1200 hens, 80 cocks, cock rate of reserving seed for planting is 10%, and hen rate of reserving seed for planting is 80%, sets up the breeding of 65 family half sibs
Two from generation to generation；The scale of two generation breeding groups is 120 cocks, and the rate of reserving seed for planting of 1500 hens, cock is 15%, and hen is reserved seed for planting rate
It is 86%, sets up 65 family half sibs breedings three from generation to generation, cultivate meat line Lueyang Gallus domesticlus brisson.
8. a kind of Lueyang Gallus domesticlus brisson selection as described in claim 1, which is characterized in that also used to chicken of reserving seed for planting in step 2
Molecular breeding technology carries out genome scanning, screens effective SNP selection site.
9. a kind of Lueyang Gallus domesticlus brisson selection as claimed in claim 8, which is characterized in that cultivate meat line Lueyang Gallus domesticlus brisson
When, it filters out and effectively selects site for following two with the meat performance-relevant SNP of Lueyang Gallus domesticlus brisson:
MSTN
5’-GGCTGGAACAAGCACCTAACATTAGCAGGGACGTTATTAAA(G)CAGCTTTTACCCAAAGCTCCTCCAC
TGCAGGAACTGATTGATCAGTATGATGTCCAGAG-3'；
KLF7
5’-AGACCAACTGAAGTGAGCAAAAGAAAGCTTTTTTTCT(A)CTTTTCTGCTTCATGCTATTTCCTCATCT
GTTCT-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910740540.6A CN110278918A (en) | 2019-08-12 | 2019-08-12 | A kind of Lueyang Gallus domesticlus brisson selection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910740540.6A CN110278918A (en) | 2019-08-12 | 2019-08-12 | A kind of Lueyang Gallus domesticlus brisson selection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110278918A true CN110278918A (en) | 2019-09-27 |
Family
ID=68025153
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910740540.6A Pending CN110278918A (en) | 2019-08-12 | 2019-08-12 | A kind of Lueyang Gallus domesticlus brisson selection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110278918A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102499174A (en) * | 2011-10-14 | 2012-06-20 | 广东粤禽育种有限公司 | Method for breeding novel high-efficiency superior yellow-feathered broilers |
| CN102630635A (en) * | 2012-04-26 | 2012-08-15 | 安徽华卫集团禽业有限公司 | Cultivation method of Wanjiang Ma chickens |
| CN104488822A (en) * | 2014-12-23 | 2015-04-08 | 安徽鲲鹏农业科技有限公司 | Synthetic line breeding method for pheasant |
| CN106234307A (en) * | 2016-08-31 | 2016-12-21 | 湖南文妹子现代农业科技生态园有限公司 | The breeding method of green-egg-shelled black plumage Gallus Domesticus |
| CN108029634A (en) * | 2017-12-30 | 2018-05-15 | 江苏省家禽科学研究所 | A kind of high regularity is suitable for the producing method for seed of the cold yellow chicken breed system of fresh listing |
| US20190075768A1 (en) * | 2014-11-14 | 2019-03-14 | Genus Plc | Hybrid Dairy Cattle and Systems for Maximizing Hybrid Advantage |
-
2019
- 2019-08-12 CN CN201910740540.6A patent/CN110278918A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102499174A (en) * | 2011-10-14 | 2012-06-20 | 广东粤禽育种有限公司 | Method for breeding novel high-efficiency superior yellow-feathered broilers |
| CN102630635A (en) * | 2012-04-26 | 2012-08-15 | 安徽华卫集团禽业有限公司 | Cultivation method of Wanjiang Ma chickens |
| US20190075768A1 (en) * | 2014-11-14 | 2019-03-14 | Genus Plc | Hybrid Dairy Cattle and Systems for Maximizing Hybrid Advantage |
| CN104488822A (en) * | 2014-12-23 | 2015-04-08 | 安徽鲲鹏农业科技有限公司 | Synthetic line breeding method for pheasant |
| CN106234307A (en) * | 2016-08-31 | 2016-12-21 | 湖南文妹子现代农业科技生态园有限公司 | The breeding method of green-egg-shelled black plumage Gallus Domesticus |
| CN108029634A (en) * | 2017-12-30 | 2018-05-15 | 江苏省家禽科学研究所 | A kind of high regularity is suitable for the producing method for seed of the cold yellow chicken breed system of fresh listing |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Looi et al. | Swiftlets and edible bird’s nest industry in Asia | |
| CN104285880B (en) | A kind of production of hybrid seeds pattern of black plumage chicken breed system | |
| Manyelo et al. | Local chicken breeds of Africa: Their description, uses and conservation methods | |
| CN101919367B (en) | Method for producing breed of black-shin dorking | |
| CN105494239B (en) | A kind of breeding method of precocious special excellent type Huang shin fiber crops chicken automatic sexing | |
| Bagh et al. | Body weight, egg production, and egg quality traits of gray, brown, and white varieties of Japanese quail (Coturnix coturnix japonica) in coastal climatic condition of Odisha | |
| CN107810924B (en) | Black chicken breeding method | |
| CN108207790B (en) | Method for improving egg laying performance of breeding hens | |
| Padhi | Production benefits of the crossbreeding of indigenous and non-indigenous ducks—growing and laying period body weight and production performance | |
| CN104542487B (en) | Method for breeding new strain of chickens with iron feet and yellow speckle feathers | |
| CN103891677A (en) | Breeding method of low-speed type extra-superior yellow-feather local chickens | |
| CN103875601A (en) | Method for cultivating slow type special-high quality ma chickens | |
| CN103891676A (en) | Breeding method of low-speed extra-superior green-foot chickens | |
| CN105210985A (en) | Breeding and cultural method of rocky mountainous area wild boar and In The Luchuan of Guangxi pig Hybrid | |
| CN109362646A (en) | A kind of white meat-type chickens matched breeding method of low cost | |
| CN103563833B (en) | Breeder industrialization breed system combines selection | |
| CN103918610A (en) | Method for feeding low-growth-speed type extra-high-quality black-feather local chicken | |
| CN108283162B (en) | Method for breeding new variety of local chicken | |
| CN109006691A (en) | A kind of breeding method of high yield Donglan Gallus domesticlus brisson | |
| CN109197775A (en) | A kind of breeding method of black-and-white flower plumage high-yield egg chicken strain | |
| CN110278918A (en) | A kind of Lueyang Gallus domesticlus brisson selection | |
| CN107182900B (en) | Method for researching growth and development rules of breeding hens based on maximum qualified egg number | |
| CN107251870B (en) | Research method for growth and development rule of laying hens based on maximum egg yield | |
| Yitayih et al. | Poultry production, marketing and consumption in Cambodia: A review of literature | |
| CN114431190A (en) | Breeding method of double-feather self-sexing high-added-value laying hen complete set line |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190927 |
|
| RJ01 | Rejection of invention patent application after publication |