CN105026563B

CN105026563B - One cotton protein kinase and its encoding gene and application

Info

Publication number: CN105026563B
Application number: CN201280076369.XA
Authority: CN
Inventors: 王建胜; 崔洪志; 何云蔚; 刘捷; 林余
Original assignee: Biocentury Seed Industry Co Ltd
Current assignee: Biocentury Seed Industry Co Ltd
Priority date: 2012-10-23
Filing date: 2012-10-23
Publication date: 2017-09-22
Anticipated expiration: 2032-10-23
Also published as: CN105026563A; WO2014063269A1

Abstract

There is provided a kind of protein kinase C IPK1 1 and its encoding gene from cotton, and its application in the genetically modified plants that drought tolerance is improved are cultivated.

Description

One cotton protein kinase and its encoding gene and application

Technical field

The present invention relates to protein kinase and its encoding gene and application, the more particularly to one cotton egg from cotton White kinase c IPK1-1 and its encoding gene, and its application in the genetically modified plants that drought tolerance is improved are cultivated.

Background technology

Abiotic stress, such as arid, salt marsh, extreme temperature, chemical contamination and oxygen injury can be sent out the growth of plant Educate and cause serious harm, extreme loss is caused to crop yield, wherein influence of the arid to crop yield, many naturally inverse First place is accounted in border, it is endangered equivalent to other disaster sums, be many areas be agricultural development bottleneck.According to statistics, the world is done Early, half-dried early area accounts for the 34% of land area；The dry early, semiarid zone of China accounts for the 52% of area, and year is by early face Product is up to 20~2,700,000 hectares, the national billion cubic meter of the annual water shortage in irrigation district about 30, receives grain 350~4,000,000,000 less because of water shortage public Jin；Particularly China relationship and primary grain producing such as North China, northeast and northwest, is the area of China's water shortage most serious, spring drought frequently reaches Meet within 10 years nine.

Because the resistance to coercive of plant belongs to quantitative character mostly, existing available germ plasm resource is deficient, using routine The difficulty of breeding technique improvement stress tolerance in plants is quite big, cultivates really resistance to stress kind just particularly difficult.In recent years, With to plant stress-resistance molecular mechanism research deepen continuously and Protocols in Molecular Biology fast development, degeneration-resistant research from Physiological level is deep into molecular level, promotes the development of plant stress-resistance genetic engineering.It can be produced when plant is being forced Corresponding responsing reaction, to reduce or eliminate the harm brought to plant.This responsing reaction of plant is one and is related to many bases Cause, multi signal approach, the complex process of polygenes product.These genes and its expression product can be divided into 3 classes：(1) letter is participated in Number Cascaded amplification system and the gene and product of transcription control；(2) gene directly worked to protection biomembrane and protein And its expression product；(3) protein related with transhipment to the intake of water and ion.In recent years, improved by transgenic technology Research of the plant to stress-tolerance ability, and to coercing the crops with tolerance, xerophyte and halophytes Research all achieves significant achievement, and stress-related genes and signal transduction system there has also been with further understanding (Liu Q.1998.Two transcrip tion facto rs, DREB1and DREB2, with an EREBP/AP2DNA Binding domain, separate two cellular signal transduction pathways in drought- And low temperature-responsive gene exp ression, respectively, in A Rabidopsis.Plant Cell, 10：1391-1406；KAN GJY.2002.A rabid op sis basic leucine zipper p ro teins that mediate stress2responsive abscisic acid signaling。 Plant Cell, 14：343-357；ABEH.2003.A rabid op sis AtMYC2(bHLH)and AtMYB2(MYB) function as transcrip tional activato rs in abscisic acid signaling.Plant Cell.15：63-78.).

But for current research situation, because its mechanism is sufficiently complex, many plants are to the biochemistry under adverse circumstance Still needed to be studied with physiological response mechanism.Research in terms of the function and expression regulation of degeneration-resistant response gene is accounted for The mechanism of contact between majority, but degeneration-resistant related signaling pathways and whole signal transmission network system need into One step research.

The content of the invention

The present inventor (is named herein using SSH with the protein kinase that the RACE methods being combined have cloned cotton For CIPK1-1) encoding gene DNA sequence dna.And find to be conducted into after transfer-gen plant, it can obviously improve transfer-gen plant Drought tolerance, and these characters can stablize heredity.

First aspect present invention provides a protein kinase C IPK1-1 for cotton encoding gene, and its sequence is SEQ ID NO：2.

Second aspect of the present invention provides a kind of recombinant expression carrier, its contain the gene described in first aspect present invention and The nucleotide sequence of the gene is operably connected with the expression control sequence of the expression vector；Preferably, the carrier For the rd29A-GhCIPK1-1-2300 carriers shown in accompanying drawing 2.

Third aspect present invention provides a kind of recombinant cell, its contain nucleotide sequence described in first aspect present invention or Recombinant expression carrier described in person's second aspect of the present invention；Preferably, the recombinant cell is restructuring agrobatcerium cell.

Fourth aspect present invention provides a kind of method of improvement drought resistance in plants, including：By described in first aspect present invention Nucleotide sequence or second aspect of the present invention described in recombinant expression carrier import plant or plant tissue and make the base Because of expression；Preferably, the plant is tobacco.

Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：Effectively producing the condition of plant Lower culture contains the gene described in first aspect present invention, the plant of the recombinant expression carrier described in second aspect of the present invention or plant Thing tissue；Preferably, the plant is tobacco.

Sixth aspect present invention provides the gene described in first aspect present invention, the restructuring table described in second aspect of the present invention It is used to improve drought resistance in plants and use for plant breeding up to the recombinant cell described in carrier or third aspect present invention On the way；Preferably, the plant is tobacco.

Seventh aspect present invention provides the amino acid sequence of the gene code described in invention first aspect, such as SEQ ID NO： Shown in 1.

Brief description of the drawings

Fig. 1 is the structure flow of GhCIPK1-1 plant expression vector (rd29A-GhCIPK1-1-2300).

Fig. 2 is the plasmid figure of GhCIPK1-1 plant expression vector (rd29A-GhCIPK1-1-2300).

Fig. 3 is GhCIPK1-1 transgenosis T₁For tobacco plant (in figure, T₁S4；Figure is right, T₁S7) and be used as control non-turn The drought-enduring simulated experiment result of genetic tobacco plant (figure is left).

Fig. 4 is GhCIPK1-1 transgenosis T₁For the albumen of tobacco plant and non-transgenic reference plant on transcriptional level Express the result.M is Marker, and 1-8 is transfer-gen plant, and 9-12 is adjoining tree, and 13 be positive control (GhCIPK1-1).

Embodiment

The present invention is further described with reference to non-limiting example.

Cotton SSH library constructions under embodiment 1, drought stress：

Specific method is：

Using the method shown in the PCR-selectTM cDNA Subtraction Kit of Clontech companies by suppressing Subtractive hybridizing method builds subtracted library.MRNA using the leaf of the cotton seedling of Osmotic treatment in experimentation is used as sample (tester) control (driver), is used as using the mRNA of the leaf of untreated cotton seedling.Specific steps are summarized as follows：

(1) material to be tested：

(National Cotton mid-term storehouse obtains unit Cotton research institute, Unified number to african cotton：ZM-06838) it is seeded into On sterilized vermiculite, cultivated under the conditions of 25 DEG C, photoperiod 16h/8h (light intensity 2000-3000Lx), 1/2MS cultures are poured weekly Base (9.39mM KNO₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM of KI, 100μM H₃BO₃, 100 μM of MnSO₄, 30 μM of ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM FeSO₄) once.It is used to test when seedling plant height reaches 25-30cm.

(2) material process：

2 groups, every group of 4 basins, per 1 plant of basin will be divided into for examination seedling.First group is control group, in 25 DEG C, illumination cultivation, normally Pour.Second group is Osmotic treatment group, and 25 DEG C, illumination cultivation stop pouring, handled 10 days, timely clip two after being disposed The blade of group seedling apical 1/3, after liquid nitrogen quick freeze, is preserved in -70 DEG C of refrigerators.

(3) Total RNAs extraction：

Control group and the cotton leaf 0.5g of Osmotic treatment group are taken respectively, use plant RNA extraction kit (invitrogen) total serum IgE of cotton is extracted.Total serum IgE is determined with the ultraviolet specrophotometer U-2001 of HITACHI companies to exist 260nm and 280nm absorbance, OD260/OD280 ratios are 1.8-2.0, show that total serum IgE purity is higher, with 1.0% fine jade The integrality of sepharose electrophoresis detection total serum IgE, the brightness of 28S bands is about 2 times of 18S bands, shows that RNA integrality is good It is good.Use Oligotex mRNA purification kits (the purification of polyA+RNA from of Qiagen companies Total RNA) separation mRNA.

(4) suppressed subtractive hybridization：

Method as shown in the PCR-selectTM cDNA Subtraction Kit kits of Clontech companies is carried out Subtractive hybridization.It is first using Clontech PCR-Select cDNA Subtraction Kits subtractive hybridization kits Driver and Tester mRNA is distinguished into reverse transcription, double-strand cDNA is obtained, then with 2 μ g Tester and 2 μ g Driver cDNA Subtractive hybridization is carried out as parent material.Respectively by Tester cDNA and Driver cDNA Rsa I enzymes under 37 DEG C of water-baths 1.5h is cut, the Tester cDNA after digestion are then divided into joints different in two equal portions, connection, and Driver cDNA do not connect Joint.Two kinds of Tester cDNA for being connected with different joints are mixed with excessive Driver respectively, carry out first time subtractive hybridization. The product of two kinds of first time subtractive hybridization is mixed, then second of subtractive hybridization is carried out with Fresh denatured Driver cDNA, is led to The fragment of differential expression is expanded after inhibition PCR twice, it is enriched with.

(5) structure of cDNA subtractive libraries and preliminary screening, clone, identification

(QIAquick PCR Purification Kit are pure for second of PCR primer of positive subtractive hybridization cDNA fragments Change, purchased from Qiagen) it is connected with pGEM-T Easy (being purchased from Promega kits) carrier, according to pGEM-T Easy kits Program, comprise the following steps that：Following ingredients are sequentially added with 200 μ l PCR pipes：The positive subtractive hybridization cDNA fragments of purifying The μ l of second of PCR primer, 3 μ l, T4 ligase buffer solution, 5 μ l, pGEM-T Easy carriers, 1 μ l, T4DNA ligase 1, in 4 DEG C Connection is stayed overnight.10 μ L coupled reaction products are taken, are added in 100 μ L competence Escherichia coli JMI09 (being purchased from TAKARA), ice bath 30min, heat shock 60s, ice bath 2min, separately adding 250 μ L LB nutrient solutions, (1%Tryptone is purchased from OXOID, 0.5%Yeast Extract is purchased from OXOID, and 1%NaCl is purchased from traditional Chinese medicines) put in 37 DEG C of water-baths, with 225r/min shaken cultivation 30min, take 200 μ L Bacterium solution is planted in LB (ibid)/X-gal/IPTG (X-gal/IPTG is purchased from TAKARA) culture containing 50 μ g/mL ampicillins On plate, 37 DEG C of cultivation 18h.The clear white and blue colonies number of diameter ＞ 1mm in culture plate is counted, random picking 540 is white Color bacterium colony (numbering：Gh-D2-001 to Gh-D2-540).All white colonies are chosen in the LB containing 50 μ g/mL ampicillins In 96 porocyte culture plates (CORNING) of fluid nutrient medium, glycerol adding is to final concentration 20% after 37 DEG C of overnight incubations, in -80 DEG C save backup.With nest-type PRC primer Primer 1 and Primer 2R (the PCR-selectTM cDNA of Clontech companies Subtraction Kit kits are carried) bacterium solution PCR amplifications are carried out, 452 positive colonies are obtained, all positive colonies are existed Invitrogen (Shanghai) Trading Co., Ltd. is sent to be sequenced

(6) the cDNA sequencing analysis of differential cloning：

After the cDNA that DNA sequencing result is removed to carrier and indefinite sequence and redundancy, 405 effective EST are obtained (unigene)。

The cotton protein kinases encoding gene GhCIPK1-1 of embodiment 2 clone

Clone Gh-D2-057 removes after redundant DNA, and sequence is SEQ ID NO：3, sequence analysis shows the volume of the sequence The amino acid sequence of code belongs to protein kinase, and the clone Gh-D2-057 full-length genes encoded are named as into GhCIPK1- herein 1, corresponding albumen is named as CIPK1-1.

SEQ ID NO：3

The clone of GhCIPK1-1 full-length genes

According to the Gh-D2-057 genetic fragments obtained, two specific primers are designed, it is special as 5 ' RACE 3 ' ends Specific primer.

GhCIPK1-1GSP1：SEQ ID NO：4：

CTTCAAAGATCTCAGCATCTAT

GhCIPK1-1GSP2：SEQ ID NO：5：

ATTTCACCTTCCCATCCTTGTT

GhCIPK1-1GSP3：SEQ ID NO：6：

AAGCATTGAAATAACTCGGCCT

Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification CDNA Ends kits are purchased from invitrogen companies).

With SEQ ID NO：5 and 5 ' universal primer AAP (kit is carried), with the cDNA of mRNA reverse transcriptions, (reverse transcription is drawn Thing SEQ ID NO：4) amplification of first round PCR is carried out for template, comprised the following steps that：Ex Taq are purchased from TAKARA, 50 μ l PCR Reaction system：The cDNA, 1.0 μ l Ex of 5 μ 10 × Ex of l μ l mRNA reverse transcriptions of Buffer, 3 μ l 2.5mM dNTP, 2.0 Taq, 10 μM of primer SEQ ID NO：Each 2.0 μ l of 7 and AAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, after 33 circulations, 72 DEG C of extension 10min.The PCR of gained Product takes 2.0 μ l as template after diluting 50 times with distilled water, with SEQ ID NO：6 and 3 ' end primer AUAP carry out second and taken turns PCR is expanded, and is comprised the following steps that：50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l The first round PCR primer of dilution, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：Each 2.0 μ l of 8 and AUAP, and 35 μ l Distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min, 33 After circulation, 72 DEG C of extension 10min.It is about that (Gel Extraction Kit are purchased 900bp bands that second of PCR primer, which reclaims fragment, From OMEGA) pGEM-T Easy Vector are connected to, it is transformed into JM109 (specific method is ibid), the random white bacterium of picking 10 Fall within the LB fluid nutrient mediums containing 50 μ g/mL ampicillins and cultivate, glycerol adding is to final concentration after 37 DEG C of overnight incubations 20%, -80 DEG C save backup.SEQ ID NO：8 and 3 ' end primer AUAP carry out bacterium solution PCR amplifications (reaction system and reaction bar Part is ibid), 4 positive colonies are obtained, Invitrogen's sequencing sequencing is sent, obtains the cDNA of the gene 5 ' end.

After 5 ' the RACE product clonings sequencing of gained, with SEQ ID NO：3 results are spliced.Obtain GhCIPK1-1 cDNA Sequence SEQ ID NO：7.

SEQ ID NO：7：

According to SEQ ID NO：7：Sequences Design pair of primers is as follows：

GhCIPKF：SEQ ID NO：8：

ATGGAGAAGAAAGGGACAGTAT

GhCIPKR：SEQ ID NO：9：

TCAAACCAGGCTCTGGGTATAA

Pass through SEQ ID NO：8 and SEQ ID NO：9 clone GhCIPK1-1 total lengths.

Using TaKaRa PrimeSTAR HS archaeal dna polymerases, performing PCR reaction is entered by template of the cDNA of cotton.50μl PCR reaction systems：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 cDNA, 1.0 μ l PrimeSTAR, 10 μM Primer SEQ ID NO：8 and SEQ ID NO：9 each 2.0 μ l, and 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, after 33 circulations, 72 DEG C of extension 10min.

Pcr amplification product adds A tails：PCR primer adds 2.5 times of absolute ethyl alcohol, and -20 DEG C are placed 10 minutes, and centrifugation is gone Clearly, dry, dissolved with 21 μ l distilled waters.Add 2.5 μ 10 × Ex of l Buffer, 0.5 μ l 5mM dATP, 2.5 10 × Ex of μ l Taq.Reaction condition：70 DEG C are reacted 30 minutes.The DNA fragmentation for obtaining about 1300bp is reclaimed into (Omega QIAquick Gel Extraction Kits), connection (GhCIPK1-1-pGEM plasmids are obtained on to pGEM T-easy carriers), conversion JM109 (method is ibid), random picking 10 White colony is cultivated in the LB fluid nutrient mediums containing 50 μ g/mL ampicillins, and glycerol adding is to end after 37 DEG C of overnight incubations Concentration 20%, -80 DEG C save backup.SEQ ID NO：8 and SEQ ID NO：9 carry out bacterium solution PCR amplification (reaction system and reaction Condition is ibid), 3 positive colonies are obtained, Invitrogen's sequencing is delivered to, sequence is SEQ ID NO： 2, the amino acid sequence of its albumen encoded is SEQ ID NO：1.

The amino acid sequence of CIPK1-1 albumen：SEQ ID NO：1

The nucleotide sequence of GhCIPK1-1 encoding genes：SEQ ID NO：2

Embodiment 3GhCIPK1-1 gene plant expression vector establishments

Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd) As plant expression vector, the 35S promoter that NPTII genes contain double enhancers is replaced with Pnos promoters, to reduce NPTII eggs Expression in plant in vain.Select promoters and termination of the inducible promoter rd29A and Tnos as GhCIPK1-1 genes Son.

With primer SEQ ID NO：10 and SEQ ID NO：11 is (remote purchased from Beijing China with plant expression vector PBI 121 Foreign Science and Technology Ltd.) it is template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR react System：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l PBI 121,1.0 μ l PrimeSTAR, 10 μM draw Thing SEQ ID NO：11 and SEQ ID NO：12 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, after 33 circulations, 72 DEG C of extension 10min.By EcoRI, BglII digestions are connected to pCAMBIA2300 (promega, T4 ligase box) and obtain pCAMBIA2300-1.

SEQ ID NO：10：

GCACGAATTCGGCGGGAAACGACAATCTGA

SEQ ID NO：11：

ATCCAGATCTAGATCCGGTGCAGATTATTTG

SEQ ID NO：12 and SEQ ID NO：13 using PBI121 as template amplification Tnos, using TaKaRa's PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0 The μ l PrimeSTAR of μ l PBI 121,1.0,10 μM of primer SEQ ID NO：12 and SEQ ID NO：13 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 33 After individual circulation, 72 DEG C of extension 10min.PCAMBIA2300-1 (promega T4 ligases are connected to by KpnI, EcoRI digestion Box) obtain pCAMBIA2300-2

SEQ ID NO：12：

AAGGGTACCGAATTTCCCCGATCGTTCAAA

SEQ ID NO：13：

TCAGAATTCCCAGTGAATTCCCGATCTAGTA

SEQ ID NO：14 and SEQ ID NO：15 with arabidopsis (Colombia's type, purchased from TARI, Www.arabidopsis.org) DNA be template amplification arabidopsis rd29A promoters (with reference to Zeng J., et L.2002, Preparation of total DNA from " recalcit rant plant taxa ", Acta Bot.Sin., 44 (6)： Method in 694-697 extracts arabidopsis DNA).Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR react System：10 μ 5 × PS of l μ l arabidopsis of Buffer, 3 μ l2.5mM dNTP, 1.0 DNA, 1.0 μ l PrimeSTAR, 10 μM draw Thing SEQ ID NO：14 and SEQ ID NO：15 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, after 33 circulations, 72 DEG C of extension 10min.Pass through HindIII, SalI digestion are connected to (connection method is ibid) pCAMBIA2300-2 and obtain pCAMBIA2300-3

SEQ ID NO：14：

ACTAAGCTTCCTTCTTGACATCATTCAATTTTA

SEQ ID NO：15：

TGAGTCGACTCCAAAGATTTTTTTCTTTCCAATAG

SEQ ID NO：16 and SEQ ID NO：(template is the GhCIPK1- that embodiment 2 is obtained to 17 amplification GhCIPK1-1 1-pGEM plasmids), using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10μl 5×PS The μ l GhCIPK1-1-pGEM plasmids of Buffer, 3 μ l 2.5mM dNTP, 1.0,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：16 and SEQ ID NO：17 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, 94 DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 2min, 33 circulation after, 72 DEG C extension 10min.Pass through KpnI, SalI digestion (connection method is ibid) pCAMBIA2300-3 is connected to, plant expression vector rd29A-GhCIPK1-1-2300 is obtained.

SEQ ID NO：16：

TGAGGTACCATGGAGAAGAAAGGGACAGTAT

SEQ ID NO：17：

AAGGTCGACTCAAACCAGGCTCTGGGTATAA

The rd29A-GhCIPK1-1-2300 expression vectors of embodiment 4 convert Agrobacterium

It is prepared by Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competence：1-2 days in advance by agriculture Bacillus LBA4404 draws single spot inoculation, 28 DEG C of trainings on the LB solid mediums containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins Support 1 to 2 day.Picking single bacterium colony is inoculated in LB fluid nutrient mediums of the 5ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, and 28 It is 0.4 that overnight incubation (about 12-16h) to OD600 values are shaken at DEG C, forms seed bacterium solution.Take the bacterium solution (1: 20 after 5ml activation Ratio) be inoculated in the LB fluid nutrient mediums of the same concentration antibiotic of 100ml, 28 DEG C shake culture 2-2.5h to OD₆₀₀= 0.8.Ice bath bacterium solution 10min, shakes up once every 3min, makes bacterium even into resting state.Centrifuged in 4000g at 4 DEG C 10min, abandons supernatant；Add 4000g at certain glycerine resuspension thalline of head for precooling 10%, 4 DEG C and centrifuge 10min, collect precipitation； Repeated to wash 3-4 times with 10% glycerine；Adding 10% glycerine of appropriate ice bath precooling, suspended bacterial is precipitated again, will with 40 μ l/ pipes It is dispensed, and is saved backup in -70 DEG C.

Convert Agrobacterium：Melt competent cell on ice, 1 μ l plasmid is added into 40 μ l competent cell, mix Even rear ice bath about 10min.Competence and DNA mixture are transferred in the electric shock of precooling cup with rifle, rapping arrives suspension Up to bottom, bubble has been careful not to.Electric shock cup (being purchased from bio-rad) is put on the slideway of electroporation chamber, promotes slideway to shock by electricity Cup is put to electroporation chamber base electrode.Using 0.1cm electric shock cup when, MicroPulser (be purchased from bio-rad) program It is set to " Agr ", electric shock is once.Electric shock cup is taken out immediately, adds the LB culture mediums of 28 DEG C of preheatings.It is quick and it is soft will with rifle Cell is beaten.Suspension is transferred to 1.5ml centrifuge tube, 28 DEG C, 225rpm cultures 1h.Take 100~200 μ l bacterium solution be coated with (LB solid mediums, containing 50 μ g/ml rifampins, 50 μ g/ml streptomysins, 50 μ g/ml on corresponding resistance screening culture medium flat plate Kanamycins), 28 DEG C of cultures.

Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method

With 75% alcohol-pickled tobacco seed, (countries tobacco mid-term storehouse obtains unit：Compile in tobacco institute of the Chinese Academy of Agricultural Sciences, storehouse Number I5A00660) 30s, is washed twice with sterilizing distilled water.8min is soaked with 0.1% mercuric chloride again, is washed twice with sterilizing distilled water, it is complete Into surface sterilizing.The tobacco seed of surface sterilizing is placed in MS (18.78mM KNO₃, 1.25mM KH₂PO₄, 20.6mM NH₄NO₃, 1.5mM MgSO₄, 3.0mM CaCl₂, 50 μM of KI, 100 μM of H₃BO₃, 100 μM of MnSO₄, 30 μM of ZnSO₄, 1 μM of Na₂MoO₄, 0.1μM CoCl₂, 100 μM of Na₂EDTA, 100 μM of FeSO₄, 7.4g/L agar, sucrose 30g/L) under aseptic condition germinate, Prepare aseptic seedling.Take tests for sterility to be cut into the leaf dish of 5mm × 5mm sizes, contain expression vector with exponential phase Rd29A-GhCIPK1-1-2300 During Agrobacterium leaf dish 10min, blots bacterium solution, and 2 days are co-cultured under dark condition, and (MS is trained Support base).Blade is gone into differential medium, and (the MS+1mg/L basic elements of cell division (BA)+0.1mg/L methyl α-naphthyl acetates (NAA)+50mg/L blocks That mycin+500mg/L cephalosporins) on, cultivated 45 days or so under illumination condition, cut after bud is grown up and be transferred to culture of rootage Culture 30 days or so in base (MS+50mg/L kanamycins+500mg/L cephalosporins), after being transferred to seedling only after well developed root system Preservation is numbered on MS culture mediums added with 500mg/L cephalosporins.

The transgenic tobacco leaf of acquisition is taken, DNA (arabidopsis DNA extraction method in be the same as Example 3) is extracted, uses SEQ ID NO：9：With SEQ ID NO：10 (50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：9 and SEQ ID NO：10 each 2.0 μ l, and 35 μ l distilled water. PCR reaction conditions：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, after 33 circulations, 72 DEG C extension 10min), PCR identification, preserve positive plant T is numbered₀S1-T₀S20。

Embodiment 6 is overexpressed GhCIPK1-1 transgene tobaccos T1 drought-enduring simulated experiment and Function Identification

Sterilized vermiculite is impregnated with 1/2MS culture mediums.T₀S1-T₀S20 and control tobacco seed are sowed in vermiculite respectively On, 15 seeds are sowed per basin, 25 DEG C, optical culture/10 hour light culture circulation in 14 hours are poured a 1/2MS for every 5 days, cultivated After 25 days, SEQ ID NO：8 and SEQ ID NO：9 do PCR detections, remove negative plant.Choose transgenosis of the same size Tobacco and control tobacco do drought-enduring experiment, per 4-5 more consistent seedling of basin reservation size.Transgene tobacco, control tobacco arid 14 days (not watering), 25 DEG C, optical culture/10 hour light culture circulation in 14 hours.(T0 is for transfer-gen plant for transfer-gen plant by T1 The plant that grows up to of seed) Identification of Drought show that adjoining tree is all wilted seriously, and T₁S4、T₁S7、T₁S9、T₁S10、 T₁Five strain tobaccos of S16 show obvious drought tolerance (referring to Fig. 2, with T₁S4、T₁Exemplified by S7, T₁S9、T₁S10、T₁S16's As a result with T₁S4、T₁S7 is similar, is not shown here).

Embodiment 7 verifies CIPK1-1 protein expressions on transcriptional level

Normal growth transfer-gen plant randomly selects 8 in implementing 6, and adjoining tree randomly selects 4, arid in implementing 6 14 days blade 0.05g, the total serum IgE extracted with plant RNA extraction kit (invitrogen).Ultraviolet spectrophotometry is total RNA calculates each RNA concentration in 260nm and 280nm absorbance.According to invitrogen reverse transcription reagent box Method shown in SuperScript III Reverse Transcriptase carries out reverse transcription, and (1 μ g total serum IgEs are as template, reversion Record primer SEQ ID NO：9).Pass through SEQ ID NO：18 and SEQ ID NO：19 detection GhCIPK1-1, detect CIPK1-1 eggs White relative expression's situation.Using TaKaRa PrimeSTAR HS archaeal dna polymerases, performing PCR is entered using the cDNA of reverse transcription as template Reaction.50 μ l PCR reaction systems：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 cDNA, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：18 and SEQ ID NO：19 each 2.0 μ l, and 30 μ l distilled water.PCR is anti- Answer condition：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min, after 28 circulations, 72 DEG C are prolonged Stretch 10min.Product electrophoresis result is as shown in Figure 4：M is DNA Ladder Marker (DL2000, purchased from the auspicious very biological skill in Shenzhen Art Co., Ltd), 1-8 is transfer-gen plant, and 9-12 is adjoining tree, and 13 be positive control (GhCIPK1-1, SEQ ID NO：2). Stripe size shown in figure and positive control it is in the same size.As a result show normal growth plant plant pair GhCIPK1-1 transcription compared with By force, it is impossible to which normal growth plant is not transcribed or transcribed very weak.

SEQ ID NO：18：CGCTATTTCCAGCAATTGATAGC

SEQ ID NO：19：GTATTCCAAAGTATCCCCAGCA

Claims

1. an encoding protein kinase gene for cotton, its sequence is SEQ ID NO:2.

2. a kind of recombinant expression carrier, it contains the nucleotide sequence of gene described in claim 1 and the nucleotide sequence It is operably connected with the expression control sequence of the expression vector.

3. the carrier described in claim 2, it is the rd29A-GhCIPK1-1-2300 carriers shown in accompanying drawing 2.

4. a kind of recombinant cell, it contains described in the nucleotide sequence or Claims 2 or 3 of gene described in claim 1 Recombinant expression carrier.

5. the recombinant cell of claim 4, wherein the recombinant cell is restructuring agrobatcerium cell.

6. a kind of method of improvement tobacco drought tolerance, including：Will by the nucleotide sequence or right of gene described in claim 1 The recombinant expression carrier described in 2 or 3 is asked to import tobacco or Tissues of Tobacco and make the gene expression.

7. a kind of method of prepare transgenosis tobacco, including：Culture contains claim 1 institute under conditions of tobacco is effectively produced State tobacco or the Tissues of Tobacco of recombinant expression carrier described in the nucleotide sequence or Claims 2 or 3 of gene.

8. described in the recombinant expression carrier described in gene, Claims 2 or 3 or claim 4 or 5 described in claim 1 Recombinant cell be used for improve tobacco drought tolerance and the purposes for tobacco breeding.

9. the albumen of the gene code described in claim 1, such as SEQ ID NO:Shown in 1.