CN104884619B - A kind of cotton isopentene group transferase I PT2 and its encoding gene and application - Google Patents
A kind of cotton isopentene group transferase I PT2 and its encoding gene and application Download PDFInfo
- Publication number
- CN104884619B CN104884619B CN201280078040.7A CN201280078040A CN104884619B CN 104884619 B CN104884619 B CN 104884619B CN 201280078040 A CN201280078040 A CN 201280078040A CN 104884619 B CN104884619 B CN 104884619B
- Authority
- CN
- China
- Prior art keywords
- plant
- seq
- gene
- pcr
- tobacco
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
Abstract
One prenyltransferase (IPT2) and its encoding gene for deriving from cotton, and its application in the genetically modified plants that drought resistance is improved are cultivated are provided.
Description
Technical field
The present invention relates to vegetable protein and its encoding gene and application, more particularly to one iso-amylene from cotton
Based transferase (IPT2) albumen and its encoding gene, and its application in the genetically modified plants that drought resistance is improved are cultivated.
Background technology
Abiotic stress, such as arid, salt marsh, extreme temperature, chemical contamination and oxygen injury can be sent out the growth of plant
Educate and cause serious harm, extreme loss is caused to crop yield.Wherein influence of the arid to crop yield, many naturally inverse
First place is accounted in border, it is endangered equivalent to other disaster sums, be many areas be agricultural development bottleneck.According to statistics, the world is done
Drought, semiarid zone account for the 34% of land area；China's arid, semiarid zone account for the 52% of area, face of suffering from drought in year
Product reaches ten thousand hectares of 200-270, and the national billion cubic meter of the annual water shortage in irrigation district about 30 receives grain 350-400 hundred million because of water shortage public less
Jin；Particularly China relationship and primary grain producing such as North China, northeast and northwest, is the area of China's water shortage most serious, spring drought frequently reaches
Meet within 10 years nine.
Because the resistance to coercive of plant belongs to quantitative character mostly, existing available germ plasm resource is deficient, using routine
The difficulty of breeding technique improvement stress tolerance in plants is quite big, cultivates really resistance to stress kind just particularly difficult.In recent years,
With to plant stress-resistance molecular mechanism research deepen continuously and Protocols in Molecular Biology fast development, degeneration-resistant research from
Physiological level is deep into molecular level, promotes the development of plant stress-resistance genetic engineering.It can be produced when plant is being forced
Corresponding responsing reaction, to reduce or eliminate the harm brought to plant.This responsing reaction of plant is one and is related to many bases
Cause, multi signal approach, the complex process of polygenes product.These genes and its expression product can be divided into 3 classes：(1) letter is participated in
Number Cascaded amplification system and the gene and product of transcription control；(2) gene directly worked to protection biomembrane and protein
And its expression product；(3) protein related with transhipment to the intake of water and ion.In recent years, improved by transgenic technology
Research of the plant to stress-tolerance ability, and to coercing the crops with tolerance, xerophyte and halophytes
Research all achieves significant achievement, and stress-related genes and signal transduction system there has also been with further understanding (Liu
Q.1998.Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
Binding domain, separate two cellular signal transduction pathways in drought-
And low temperature-responsive gene expression, respectively, in
Arabidopsis.Plant Cell, 10：1391-1406；KANG JY.2002.Arabidopsis basic leucine
zipper proteins that mediate stress-responsive abscisic acid signaling.Plant
Cell, 14：343-357；ABE H.2003.Arabidopsis AtMYC2(bHLH)and AtMYB2(MYB)function as
Transcriptional activators in abscisic acid signaling.Plant Cell, 15：63-78.).
But for current research situation, because its mechanism is sufficiently complex, many plants are to the biochemistry under adverse circumstance
Still needed to be studied with physiological response mechanism.Research in terms of the function and expression regulation of degeneration-resistant response gene will
Research to the related signaling pathways of plant stress-resistance and signal transmission network system provides important basis.
The content of the invention
The method clone that the present inventor is combined using SSH (Subtractive hybridization) with RACE (cDNA ends rapid amplifying)
Go out the encoding gene of a prenyltransferase (being named as IPT2 herein) for cotton, and determine its DNA sequence dna.And
It was found that being conducted into by transgenosis after plant, the drought resistance of transfer-gen plant is can obviously improve, and these characters can be stablized
Heredity.
The encoding gene that first aspect present invention provides a prenyltransferase IPT2 for cotton (is named as Gh herein
IPT2), its sequence is SEQ ID NO：2.
Second aspect of the present invention provides a kind of recombinant expression carrier, its contain the gene described in first aspect present invention and
The nucleotide sequence of the gene is operably connected with the expression control sequence of the expression vector；Preferably, the carrier
For the rd29A-Gh IPT2-2300 carriers shown in accompanying drawing 2.
Third aspect present invention provides a kind of recombinant cell, and it contains gene or this hair described in first aspect present invention
Recombinant expression carrier described in bright second aspect；Preferably, the recombinant cell is restructuring agrobatcerium cell.
Fourth aspect present invention provides a kind of method of improvement plant drought resistance, including：By described in first aspect present invention
Recombinant expression carrier described in gene or second aspect of the present invention imports plant or plant tissue and makes the gene expression；It is excellent
Selection of land, the plant is tobacco.
Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：Effectively producing the condition of plant
It is lower culture the plant containing gene described in first aspect present invention or the recombinant expression carrier described in second aspect of the present invention or
Plant tissue；Preferably, the plant is tobacco.
Sixth aspect present invention provides the gene described in first aspect present invention, the restructuring table described in second aspect of the present invention
It is used to improve plant drought resistance and use for plant breeding up to the recombinant cell described in carrier or third aspect present invention
On the way；Preferably, the plant is tobacco.
Seventh aspect present invention provides the protein of the gene code described in first aspect present invention, and its amino acid sequence is such as
SEQ ID NO：Shown in 1.
Brief description of the drawings
Fig. 1 is the structure flow of GhIPT2 plant expression vector (rd29A-GhIPT2-2300).
Fig. 2 is the plasmid figure of GhIPT2 plant expression vector (rd29A-GhIPT2-2300).
Fig. 3 is the drought resistance growing state for compareing tobacco and transgene tobacco (before Fig. 3 a is arids, after Fig. 3 b is arids)；
CK (left side)：Compare tobacco；T1Q4 (right side)：Transgene tobacco strain.
Fig. 4 is the checking that drought-resistant T1 is for transgenic tobacco plant and not drought-resistant control tobacco plant is on transcriptional level
As a result.M is Marker (DL2000), 1-8 be drought-resistant T1 for transgenic tobacco plant, 9 be plasmid PCR positive control, 10-13
For not drought-resistant control tobacco plant.
Embodiment
Following examples are provided, to facilitate those skilled in the art to more fully understand the present invention.The embodiment merely for
Exemplary purpose, is not intended to limit the scope of the present invention.
Cotton SSH library constructions under the drought stress of embodiment 1.：
Specific method is：
Using the method shown in the PCR-selectTM cDNA Subtraction Kit of Clontech companies by suppressing
Subtractive hybridizing method builds subtracted library.Made in experimentation with the mRNA extracted in the blade of the cotton seedling of Osmotic treatment
For sample (tester), the mRNA extracted using in the blade of untreated cotton seedling is used as control (driver).Specific steps
It is summarized as follows：
(1) material to be tested：
(National Cotton mid-term storehouse obtains unit Cotton research institute, Unified number to african cotton：ZM-06838) it is seeded into
On sterilized vermiculite, cultivate, pour weekly under the conditions of 25 DEG C, photoperiod 16h illumination/8h dark (light intensity 2000-3000Lx)
1/2MS culture mediums (contain 9.39mM KNO3, 0.625mM KH2PO4, 10.3mM NH4NO3, 0.75mM MgSO4, 1.5mM
CaCl2, 50 μM of KI, 100 μM of H3BO3, 100 μM of MnSO4, 30 μM of ZnSO4, 1 μM of Na2MoO4, 0.1 μM of CoCl2, 100 μM
Na2EDTA, 100 μM of FeSO4) once.It is used to test when seedling plant height reaches 25-30cm.
(2) material process：
2 groups, every group of 4 basins, per 1 plant of basin will be divided into for examination seedling.First group is control group, in 25 DEG C, photoperiod 16h light
It is normal to pour according to/8h dark (light intensity 2000-3000Lx) culture.Second group is Osmotic treatment group, 25 DEG C, photoperiod 16h light
According to being cultivated under the conditions of/8h dark (light intensity 2000-3000Lx), stop pouring, handle 10 days, timely two groups of clip after being disposed
The blade of seedling apical 1/3, after liquid nitrogen quick freeze, is preserved in -70 DEG C of refrigerators.
(3) Total RNAs extraction：
Control group and the cotton leaf 0.5g of Osmotic treatment group are taken respectively, (are purchased from plant RNA extraction kit
Invitrogen the total serum IgE of cotton leaf) is extracted.Total serum IgE is determined with the ultraviolet specrophotometer U-2001 of HITACHI companies to exist
260nm and 280nm absorbance, OD260/OD280Ratio is 1.8-2.0, shows that total serum IgE purity is higher, with 1.0% agar
The integrality of sugared detected through gel electrophoresis total serum IgE, the brightness of 28S bands is about 2 times of 18S bands, shows that RNA integrality is good
It is good.Use Oligotex mRNA purification kits (the purification of polyA+RNA from of Qiagen companies
Total RNA) separation mRNA.
(4) Subtractive hybridization：
By the PCR-select of Clontech companiesTMMethod shown in cDNA Subtraction Kit kits is carried out
Subtractive hybridization.Driver mRNA and Tester mRNA are first distinguished into reverse transcription, double-strand cDNA is obtained, then with 2 μ g
Tester cDNA and 2 μ g Driver cDNA carry out subtractive hybridization as parent material.Respectively by Tester under 37 DEG C of water-baths
Tester cDNA after digestion, are then divided into two equal portions, connection not by cDNA and Driver cDNA Rsa I digestion 1.5h
Same joint, and Driver cDNA are not connected to head.Two kinds be connected with different joints Tester cDNA respectively with it is excessive
Driver is mixed, and carries out positive subtractive hybridization for the first time.By two kinds of first times, the products of positive subtractive hybridization are mixed, then are become with new
Property Driver cDNA carry out second positive subtractive hybridization, the fragment of differential expression is expanded by inhibition PCR twice, is made
It is enriched with.
(5) structure of cDNA subtracted libraries and preliminary screening, clone, identification
According to the program of pGEM-T Easy kits, described second positive subtractive is hybridized second of cDNA fragments
Inhibition PCR primer (using QIAquick PCR Purification Kit purifying, purchased from Qiagen) and pGEM-T Easy
(being purchased from Promega kits) carrier connection, it is comprised the following steps that：Following ingredients are sequentially added with 200 μ l PCR pipes：Purifying
Positive subtractive hybridize cDNA fragments μ l, pGEM-T the Easy carriers of second of PCR primer, 3 μ l, 2 × T4 ligase buffer solution 5
The μ l of 1 μ l, T4DNA ligase 1, are stayed overnight in 4 DEG C of connections.10 μ l coupled reaction products are taken, 100 μ l competence Escherichia coli are added to
In JM109 (being purchased from TAKARA), ice bath 30min, heat shock 60 seconds, ice bath 2min separately add 250 μ l LB nutrient solutions (to contain 1%
Tryptone (is purchased from OXOID), and 0.5%Yeast Extract (are purchased from OXOID), 1%NaCl (being purchased from traditional Chinese medicines)) put 37 DEG C of water
In bath, with 225rpm shaken cultivation 30min, 200 μ l bacterium solutions are taken to be inoculated in LB (ibid)/X- containing 50 μ g/ml ampicillins
On gal/IPTG (X-gal/IPTG is purchased from TAKARA) culture plate, 37 DEG C of cultivation 18h.Diameter ＞ 1mm's is clear in counting culture plate
Clear white and blue colonies number, random 540 white colonies of picking (numbering：Gh-D2-001 to Gh-D2-540).Will be all white
Color clone is inoculated in 96 porocyte culture plates (CORNING) of the LB fluid nutrient mediums containing 50 μ g/ml ampicillins, and 37
Glycerol adding is saved backup to final concentration 20% in -80 DEG C after DEG C overnight incubation.With nest-type PRC primer Primer 1 and Primer
2R (the PCR-select of Clontech companiesTMCDNA Subtraction Kit kits are carried) bacterium solution PCR amplifications are carried out,
452 positive colonies are obtained, then send Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced all positive colonies.
(6) the cDNA sequencing analysis of differential cloning：
After the cDNA that DNA sequencing result is removed to carrier and indefinite sequence and redundancy, 405 effective EST are obtained
(unigene)。
The cotton isopentenyl transferase genes GhIPT2 of embodiment 2 clone
Clone Gh-D2-141 removes after redundant DNA, and sequence is SEQ ID No：3, sequence analysis shows the sequential coding
Albumen belong to prenyltransferase.Herein by SEQ ID No：The corresponding total length encoding gene of 3 sequences is named as GhIPT2,
Its corresponding albumen is named as IPT2.
SEQ ID No：3：
The clone of GhIPT2 total length encoding genes
According to the SEQ ID No obtained：3 sequences, design following two specific primers, are used as 3 ' RACE 5 ' ends
Specific primer.
GhIPT2 GSP1：SEQ ID No：4：
TTAGACAAGA GACAACGTGC TA
GhIPT2 GSP1：SEQ ID No：5：
TAAACTGCTG CAAGAAGCAA TC
Experimental procedure operates (3 ' RACE System for Rapid Amplification of by kit specification
CDNA Ends kits are purchased from invitrogen companies).
With SEQ ID NO：4 with universal primer AUAP (kit is carried), the progress by template of the cDNA of mRNA reverse transcriptions
First round PCR is expanded.Comprise the following steps that：
50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l mRNA reverse transcriptions
CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：Each 2.0 μ l of 4 and AUAP and the double steamings of 35 μ l
Water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min),
72 DEG C of extension 10min.
The PCR primer of gained takes 2.0 μ l as template after diluting 50 times with distilled water, with SEQ ID NO：5 draw with general
Thing AUAP carries out second and takes turns PCR amplifications, comprises the following steps that：
50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, the first round of 2.0 μ l dilutions
PCR primer, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：5 and AUAP each 2.0 μ l and 35 μ l distilled water.PCR
Reaction condition：94 DEG C of pre-degeneration 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C are prolonged
Stretch 10min.The band (Gel Extraction Kit are purchased from OMEGA) that fragment is about 400bp in second of PCR primer is reclaimed,
And pGEM-T Easy Vector are coupled with, then it is transformed into e. coli jm109 (specific method is ibid).Random picking
10 white colonies are inoculated in the LB fluid nutrient mediums containing 50 μ g/ml ampicillins, glycerol adding after 37 DEG C of overnight incubations
To final concentration 20%, -80 DEG C save backup.With SEQ ID NO：5 carry out bacterium solution PCR amplifications with universal primer AUAP, obtain 4
4 positive colonies are delivered to Invitrogen's sequencing sequencing, obtain the cDNA of the gene by positive colony
3 ' end.
According to the GhIPT2 genetic fragments obtained, following three specific primers are designed, 5 ' RACE 3 ' ends are used as
Specific primer.
GhIPT2 GSP3：SEQ ID No：6：
ACAAGCTCTT CCCAAGCCTC AT
GhIPT2 GSP4：SEQ ID No：7：
TGAGGAACAC TTCGGTGGCG TC
GhIPT2 GSP5：SEQ ID No：8：
ATTCTTCTTG TTCCTCAGCC
Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification
CDNA Ends kits are purchased from invitrogen companies).
With SEQ ID NO：7 and universal primer AAP (kit is carried), with the cDNA (reverse transcription primers of mRNA reverse transcriptions
SEQ ID NO：6) amplification of first round PCR is carried out for template, comprised the following steps that：
50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l mRNA reverse transcriptions
CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：7 and AAP each 2.0 μ l's and 35 μ l is double
Steam water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 33 circulations (94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extensions
1min), 72 DEG C of extension 10min.
The PCR primer of gained takes 2.0 μ l as template after diluting 50 times with distilled water, with SEQ ID NO：8 and primer
AUAP carries out second and takes turns PCR amplifications, comprises the following steps that：
50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, the first round of 2.0 μ l dilutions
PCR primer, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：8 and AUAP each 2.0 μ l and 35 μ l distilled water.PCR
Reaction condition：94 DEG C of pre-degeneration 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C are prolonged
Stretch 10min.The band (Gel Extraction Kit are purchased from OMEGA) that fragment is about 800bp in second of PCR primer is reclaimed,
And pGEM-T Easy Vector are coupled with, then it is transformed into JM109 (specific method is ibid).10 whites of random picking
Colony inoculation is in the LB fluid nutrient mediums containing 50 μ g/ml ampicillins, and glycerol adding is to final concentration after 37 DEG C of overnight incubations
20%, -80 DEG C save backup.With SEQ ID NO：8 carry out bacterium solution PCR amplification (reaction system and reaction condition with primer AUAP
Ibid), 5 positive colonies are obtained, wherein 4 clones is chosen and delivers to Invitrogen's sequencing sequencing,
Obtain the cDNA of the gene 5 ' ends.
After 5 ' the RACE product clonings sequencing of gained, by itself and 3 ' RACE products sequencing results and SEQ ID No：3 sequences
Row are spliced.Obtain GhIPT2 full length cDNA sequence SEQ ID No：9：
SEQ ID No：9：
According to SEQ ID NO：9 sequences Design pair of primers are as follows：
SEQ ID No：10：
ATGACAGTTT CAATGTCAAT GT
SEQ ID No：11：
TTATACCACA AGGAACTCAA TGG
Pass through SEQ ID NO：10 and SEQ ID NO：11 clone GhIPT2 total length encoding genes.
Using TaKaRa PrimeSTAR HS archaeal dna polymerases, performing PCR reaction is entered by template of the cDNA of cotton.50μl
PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM
Primer SEQ ID NO：10 and SEQ ID NO：11 each 2.0 μ l and 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre- changes
Property 5min, 33 circulation (94 DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 1min), 72 DEG C extension 10min.
Pcr amplification product adds A tails：The absolute ethyl alcohol of 2.5 times of volumes is added in PCR primer, -20 DEG C are placed 10 minutes, from
The heart, removes supernatant, dries, and is then dissolved with 21 μ l distilled waters.Then 2.5 μ 10 × Ex of l Buffer, 0.5 μ l are added thereto
5mM dATP, 1.0 μ l Ex Taq.Reaction condition：70 DEG C are reacted 30 minutes.Obtained about 900bp DNA fragmentation is reclaimed
(Omega QIAquick Gel Extraction Kits), and be connected on pGEM T-easy carriers and (obtain GhIPT2-pGEM plasmids), then convert
JM109 (method is ibid).Random 10 white colonies of picking are inoculated in the LB fluid nutrient mediums containing 50 μ g/ml ampicillins
In, glycerol adding is to final concentration 20% after 37 DEG C of overnight incubations, and -80 DEG C save backup.With SEQ ID NO：10 and SEQ ID NO：
11 carry out bacterium solution PCR amplifications (reaction system and reaction condition are ibid), obtain 7 positive colonies, choose wherein 4 positive colonies
Invitrogen's sequencing is delivered to, sequence is SEQ ID NO：2, the amino acid sequence of its protein encoded
It is classified as SEQ ID NO：1.
The amino acid sequence of IPT2 albumen：SEQ ID NO：1
The nucleotide sequence SEQ ID NO of GhIPT2 encoding genes：2
The GhIPT2 gene plant expression vector establishments of embodiment 3
Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd)
As plant expression vector, the 35S promoter that NPTII genes contain double enhancers is replaced with Pnos promoters, to reduce NPTII eggs
Expression in plant in vain.The rd29A promoters and terminator Tnos of induction type are selected respectively as the startup of GhIPT2 genes
Son and terminator.
With primer SEQ ID NO：12 and SEQ ID NO：13 (are purchased from Beijing China ocean with plant expression vector pBI121
Science and Technology Ltd.) it is template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reactants
System：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer
SEQ ID NO：12 and SEQ ID NO：13 each 2.0 μ l and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min, 33 circulations (94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.By EcoRI,
The PCR primer connection (promega, T4 ligase box) of gained is obtained pCAMBIA2300- by BglII digestions to pCAMBIA2300
1。
SEQ ID NO：12
GCACGAATTC ggcgggaaac gacaatctga
SEQ ID NO：13
ATCCAGATCTAGATCCGGTGCAGATTATTTG
With primer SEQ ID NO：14 and SEQ ID NO：15 using pBI121 as template amplification Tnos, using TaKaRa's
PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0
μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：14 and SEQ ID NO：15 each 2.0 μ l and 31 μ
L distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C are prolonged for 33 circulations
Stretch 30s), 72 DEG C of extension 10min.(promega T4 ligases are connected as PCR primer of SacI, EcoRI digestion by obtained by
Box) obtain pCAMBIA2300-2 to pCAMBIA2300-1.
SEQ ID NO：14：
AAGGAGCTCGAATTTCCCCGATCGTTCAAA
SEQ ID NO：15：
TCAGAATTCCCAGTGAATTCCCGATCTAGTA
With primer SEQ ID NO：16 and SEQ ID NO：17 with arabidopsis, (Colombia's type, is purchased from
WWW.arabidopsis.org) DNA be template amplification arabidopsis rd29A promoters (refer to Zeng J., et al.2002,
Preparation of total DNA from " recalcitrant plant taxa ", Acta Bot.Sin., 44 (6)：
Method in 694-697 extracts arabidopsis DNA).Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR react
System：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l arabidopsis DNA, 1.0 μ l PrimeSTAR, 10 μM
Primer SEQ ID NO：16 and SEQ ID NO：17 each 2.0 μ l and 31 μ l distilled waters.PCR reaction conditions：94 DEG C of pre-degenerations
5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.By HindIII,
The PCR primer connection (connection method is ibid) of gained is obtained pCAMBIA2300-3 by PstI digestions to pCAMBIA2300-2.
SEQ ID NO：16：
ACTAAGCTTCCTTCTTGACATCATTCAATTTTA
SEQ ID NO：17：
TGACTGCAGTCCAAAGATTTTTTTCTTTCCAATAG
With primer SEQ ID NO：18 and SEQ ID NO：(template is real to the full length sequence of 19 amplification GhIPT2 encoding genes
Apply example 2 and obtain positive GhIPT2-pGEM plasmids), using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR are anti-
Answer system：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l GhIPT2-pGEM, 1.0 μ l PrimeSTAR, 10
μM primer SEQ ID NO：18 and SEQ ID NO：19 each 2.0 μ l and 31 μ l distilled waters.PCR reaction conditions：94 DEG C of pre- changes
Property 5min, 33 circulation (94 DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 2min), 72 DEG C extension 10min.By PstI,
The PCR primer connection (connection method is ibid) of gained is arrived pCAMBIA2300-3 by SacI digestions, obtains plant expression vector
rd29A-GhIPT2-2300。
SEQ ID NO：18：
TGACTGCAG ATGACAGTTT CAATGTCAAT GT
SEQ ID NO：19：
AAGGAGCTC TTATACCACA AGGAACTCAA TGG
The rd29A-GhIPT2-2300 expression vectors of embodiment 4 convert Agrobacterium
The preparation of Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competent cell：1-2 in advance
Agrobacterium LBA4404 is drawn single spot on the LB solid mediums containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins and is inoculated with by it,
28 DEG C are cultivated 1 to 2 day.Picking single bacterium colony is inoculated in LB Liquid Cultures of the 5ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins
Overnight incubation (about 12-16h) is shaken in base, at 28 DEG C to OD600It is worth for 0.4, formation seed bacterium solution.Take the bacterium solution after 5ml activation
(1: 20 ratio) is inoculated in LB fluid nutrient mediums of the 100ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, and 28 DEG C are shaken
Dynamic culture 2-2.5h to OD600=0.8.Ice bath bacterium solution 10min, shakes up once every 3min, makes the bacterium even into dormancy
State.10min is centrifuged in 4000g at 4 DEG C, supernatant is abandoned；Add 10% glycerine resuspension thalline of a certain amount of ice precooling, 4 DEG C
Lower 4000g centrifuges 10min, collects precipitation；Ice-cold 10% glycerine repeats to wash 3-4 times；Then appropriate ice bath precooling is added
10% glycerine again suspended bacterial precipitate, dispensed, saved backup in -70 DEG C with 40 μ l/ pipes.
Convert Agrobacterium：Melt described competent cell on ice, 1 μ l matter is added into 40 μ l competent cell
Grain, ice bath about 10min after mixing.The mixture of competent cell and rd29A-GhIPT2-2300 DNAs is turned with liquid-transfering gun
In the electric shock cup (being purchased from bio-rad) for moving on to ice precooling, rapping makes suspension reach electric shock cup bottom, has been careful not to bubble.
The electric shock cup is put on the slideway of electroporation chamber, promotes slideway to put electric shock cup to electroporation chamber base electrode.Use 0.1em
When the electric shock cup of specification, MicroPulser (being purchased from bio-rad) program is set to " Agr ", and electric shock is once.Take immediately
Go out the cup that shocks by electricity, add the LB culture mediums of 28 DEG C of preheatings.It is quickly soft to be beaten cell with liquid-transfering gun.Suspension is transferred to
1.5ml centrifuge tube, culture 1h is shaken in 28 DEG C of 225rpm.100-200 μ l bacterium solution is taken to be coated on corresponding resistance screening training
Support on base flat board (LB solid mediums, containing 50 μ g/ml rifampins, 50 μ g/ml streptomysins, 50 μ g/ml kanamycins), 28 DEG C of trainings
Support.Positive transformants clone is screened, and its bacterium solution is saved backup in -70 DEG C.
Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method
With 75% alcohol-pickled tobacco seed, (countries tobacco mid-term storehouse obtains unit：Compile in tobacco institute of the Chinese Academy of Agricultural Sciences, storehouse
Number I5A00660) 30s, is then washed twice with sterilizing distilled water.8min is soaked with 0.1% mercuric chloride again, then with sterilizing distilled water
Wash twice, complete surface sterilizing.The tobacco seed of surface sterilizing is placed in MS solid mediums (containing 18.78mM KNO3、
1.25mM KH2PO4、20.6mM NH4NO3、1.5mM MgSO4、3.0mM CaCl2、50μM KI、100μM H3BO3、100μM
MnSO4、30μM ZnSO4、1μM Na2MoO4、0.1μM CoCl2、100μM Na2EDTA、100μM FeSO4, 7.4g/l agar,
30g/l sucrose) under aseptic condition germinate, prepare aseptic seedling.Take tests for sterility to be cut into the leaf dish of 5mm × 5mm sizes, use
The During Agrobacterium leaf dish 10min of the rd29A-GhIPT2-2300 containing expression vector in exponential phase, blots bacterium solution,
2 days (MS solid mediums) is co-cultured under dark condition.Blade is gone into differentiation solid medium (the MS+1mg/l basic elements of cell division
(BA)+0.1mg/l methyl α-naphthyl acetates (NAA)+50mg/l kanamycins+500mg/l cephalosporins) on, daily with 2000Lx illumination
16h, cultivates 45 days or so, is cut after bud is grown up and be transferred to rooting solid culture medium (MS+50mg/l kanamycins+500mg/l
Cephalosporin) middle culture 30 days or so, only trained after being transferred to seedling after well developed root system added with the MS solids of 500mg/l cephalosporins
Support and preservation is numbered on base.
The blade for the transgenic tobacco plant that clip is obtained, extracts DNA (arabidopsis DNA extraction method in be the same as Example 3),
With SEQ ID NO：10 and SEQ ID NO：11 enter performing PCR amplification identification (50 μ l PCR reaction systems：5μl 10×Ex
Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：10 and SEQ ID
NO：11 each 2.0 μ l and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, 33 circulation (94 DEG C of denaturation
30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extension 10min), it is T0Q1- that PCR is accredited as into positive plant numbering
T0Q20 is simultaneously preserved.
Embodiment 6 is overexpressed drought resisting simulated experiments of the GhIPT2 transgene tobaccos T1 for plant
Sterilized vermiculite is impregnated with 1/2MS culture mediums.T0Q1-T0Q20 transgene tobaccos and the seed point for compareing tobacco
Do not sow on vermiculite, 15 seeds, 25 DEG C, optical culture/10 hour light culture circulation in 14 hours are sowed per basin.Pour weekly once
1/2MS, after cultivating 25 days, SEQ ID NO：10 and SEQ ID NO：11 do PCR detections, remove negative plant.Choose size
Consistent transgene tobacco and control tobacco does drought-enduring experiment, per 4-5 more consistent seedling of basin reservation size.Transgene tobacco,
Compare arid 14 days (not the watering) of tobacco, 25 DEG C, optical culture/10 hour light culture circulation in 14 hours.T1 is for transfer-gen plant (T0
The plant grown up to for the seed of transfer-gen plant) Identification of Drought show that adjoining tree is all wilted seriously, and T1Q4, T1Q7,
Tri- strains of T1Q9 show obvious drought resistance (see Fig. 3 a and 3b, with T1Q4, T1Q7, T1Q9 result with it is similar, herein
It is not shown).
Embodiment 7 verifies IPT2 protein expressions on transcriptional level
The good T1 of the medium drought resistant of embodiment 6 (is belonging respectively to above three drought resisting strain for randomly selecting 8 in transfer-gen plant
System), adjoining tree randomly selects 4 in embodiment 6, and each clip arid blade 0.05g of 14 days uses plant RNA extraction reagent
Box (invitrogen) extracts total serum IgE.Ultraviolet spectrophotometry total serum IgE calculates each in 260nm and 280nm absorbance
Individual RNA concentration.According to shown in invitrogen reverse transcription reagent box SuperScript III Reverse Transcriptase
Method carries out reverse transcription, and (1 μ g total serum IgEs are used as template, reverse transcription primer SEQ ID NO：11).Pass through SEQ ID NO：10 and SEQ
ID NO：20 amplification GhIPT2, detect IPT2 albumen relative expression's situations.It is polymerize using TaKaRa PrimeSTAR HS DNA
Enzyme, performing PCR reaction is entered by template of the cDNA of reverse transcription.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l
2.5mM dNTP, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：10 and SEQ ID NO：20 is each
2.0 μ l, and 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, (94 DEG C of denaturation 30s, 58 DEG C are moved back for 29 circulations
Fiery 30s, 72 DEG C of extension 1min), 72 DEG C of extension 10min.Product electrophoresis result is as shown in Figure 4：M is DNALadder Marker
(DL2000, purchased from Shenzhen Rui Zhen Bioisystech Co., Ltd), 1-8 be drought-resistant T1 for transgenic tobacco plant, 9 be plasmid
PCR positive controls (rd29A-GhIPT2-2300 plasmids), 10-13 is not drought-resistant control tobacco plant.Band is big shown in figure
Small (about 930bp) in the same size with GhIPT2.As a result show, turns of the drought-resistant T1 for GhIPT2 in transgenic tobacco plant
Record is stronger, does not have GhIPT2 transcriptions in not drought-resistant control tobacco plant.
SEQ ID NO：20：
GGCAGGACTA GTACTGAGCA GT
Claims (8)
1. the encoding gene of a prenyltransferase for cotton, is named as GhIPT2, its nucleotide sequence such as SEQ ID
NO：Shown in 2.
2. a kind of recombinant expression carrier, it contains nucleotide sequence and the institute of the gene described in claim 1 and the gene
The expression control sequence for stating expression vector is operably connected.
3. a kind of recombinant cell, it contains the recombinant expression carrier described in gene or claim 2 described in claim 1.
4. the cell described in claim 3, the recombinant cell is restructuring agrobatcerium cell.
5. a kind of method of improvement plant drought resistance, including：By described in the gene or claim 2 described in claim 1
Recombinant expression carrier imports plant or plant tissue and makes the gene expression, and the plant is tobacco.
6. a kind of method of prepare transgenosis plant, including：Culture contains claim 1 institute under conditions of plant is effectively produced
The plant for the recombinant expression carrier described in gene or claim 2 stated or plant tissue, wherein the plant is tobacco.
7. the recombinant expression carrier described in gene, claim 2 described in claim 1 or the restructuring described in claim 3
Cell is used to improve plant drought resistance and the purposes for plant breeding, wherein the plant is tobacco.
8. the albumen of the gene code described in claim 1, its amino acid sequence such as SEQ ID NO：Shown in 1.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2012/087957 WO2014101153A1 (en) | 2012-12-31 | 2012-12-31 | Cotton isopentenyl transferase ipt2, gene for encoding same, and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104884619A CN104884619A (en) | 2015-09-02 |
| CN104884619B true CN104884619B (en) | 2017-09-08 |
Family
ID=51019765
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201280078040.7A Expired - Fee Related CN104884619B (en) | 2012-12-31 | 2012-12-31 | A kind of cotton isopentene group transferase I PT2 and its encoding gene and application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104884619B (en) |
| WO (1) | WO2014101153A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753749B (en) * | 2018-06-20 | 2021-06-08 | 西南大学 | Silkworm tRNA isopentenyl transferase gene, recombinant vector and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101146439A (en) * | 2005-03-21 | 2008-03-19 | 加利福尼亚大学董事会 | Drought-resistant plants |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT1190068E (en) * | 1999-04-15 | 2006-06-30 | Calgene Llc | SEQUENCES OF NUCLEIC ACIDS FOR PROTEINS INVOLVED IN TOCOFEROL SYNTHESIS |
| CN101061228B (en) * | 2004-09-17 | 2012-06-20 | 先锋高级育种国际公司 | Isopentenyl transferase sequences and methods of use |
| BR112013000984A2 (en) * | 2010-07-15 | 2017-10-03 | Technion Res & Dev Foundation | NUCLEIC ACID STRUCTURE TO INCREASE ABIOTICAL STRESS TOLERANCE IN PLANTS |
-
2012
- 2012-12-31 WO PCT/CN2012/087957 patent/WO2014101153A1/en active Application Filing
- 2012-12-31 CN CN201280078040.7A patent/CN104884619B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101146439A (en) * | 2005-03-21 | 2008-03-19 | 加利福尼亚大学董事会 | Drought-resistant plants |
Non-Patent Citations (2)
| Title |
|---|
| Y.D. LIU et al..Improved salt tolerance and delayed leaf senescence in transgenic cotton expressing the Agrobacterium IPT gene.《BIOLOGIA PLANTARUM》.2012,第56卷(第2期),全文. * |
| 谢德意 等.棉花胚性愈伤组织的转化及转基因胚状体的有效萌发与成苗技术研究.《作物学报》.2007,第33卷(第5期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104884619A (en) | 2015-09-02 |
| WO2014101153A1 (en) | 2014-07-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105073772A (en) | Myb transcription factor myb1-1 of cotton and coding gene, and use thereof | |
| CN104884619B (en) | A kind of cotton isopentene group transferase I PT2 and its encoding gene and application | |
| CN105073773B (en) | A kind of small salt mustard tonoplast pyrophosphatase VP1 and its encoding gene and application | |
| CN105026565B (en) | One cotton ion channel albuminoid and its encoding gene and application | |
| CN105008385B (en) | One salt mustard MYB class transcription factor MYB1-2 and its encoding gene and application | |
| CN105026564B (en) | Cotton ion channel albuminoid and its encoding gene and application | |
| CN105008538B (en) | A kind of cotton isopentene group transferase I PT3 and its encoding gene and application | |
| CN105026563B (en) | One cotton protein kinase and its encoding gene and application | |
| CN104837998B (en) | Cotton zinc finger protein (Czf4) and coding gene and application thereof | |
| CN103703020B (en) | A DREB1 classes transcription factor for cotton and its encoding gene and application | |
| CN105452453A (en) | Thellungiella halophila calcineurin b-like protein cbl-4, coding gene of same, and application thereof | |
| CN103842376B (en) | Cotton AVP1 albumen and its encoding gene and application | |
| CN104379746B (en) | One cotton ion channel albuminoid and its encoding gene and application | |
| CN105073984B (en) | A kind of cotton ATP hydrolase As TPase 1 and its encoding gene and application | |
| CN103748223A (en) | Cotton isopentenyl-transferase, gene encoding same and uses thereof | |
| CN105008386B (en) | A kind of small salt mustard tonoplast sodium hydrogen antiporter protein NHX2 and its encoding gene and application | |
| CN104837999B (en) | Cotton zinc finger protein (Czf6) and coding gene and use thereof | |
| CN105051059B (en) | A kind of cotton dehydrin protein and its encoding gene and application | |
| CN105008529B (en) | One cotton cysteine proteinase cysp1 1 and its encoding gene and application | |
| CN103842375B (en) | A DREB1 classes transcription factor for cotton and its encoding gene and application | |
| CN105102622B (en) | A kind of cotton zeaxanthin epoxidase ZEP 1 and its encoding gene and application | |
| CN105073774B (en) | A kind of cotton leucine zipper protein bZIP-2 and its encoding gene and application | |
| CN105073993B (en) | A kind of cotton molybdenum cofactors vulcanization enzyme MCSU 1 and its encoding gene and application | |
| CN105008390B (en) | A kind of cotton homeotic leucine zipper protein HDbZIP 2 and its encoding gene and application | |
| CN104812900A (en) | Cotton zinc finger protein (czf5) and coding gene and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder |
Address after: 518117 7th floor, Chuangshi seed industry building, A701, No.22, Puzi Road, Pingdi street, Longgang District, Shenzhen, Guangdong Province Patentee after: Biocentury Seed Industry Co., Ltd. Address before: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Patentee before: Biocentury Seed Industry Co., Ltd. |
|
| CP02 | Change in the address of a patent holder | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170908 Termination date: 20201231 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |