CN105051059B - A kind of cotton dehydrin protein and its encoding gene and application - Google Patents

Abstract

The one dehydrin protein dehydrin09 and its encoding gene for deriving from cotton, and its application in the genetically modified plants for cultivating drought resistance raising.

Description

A kind of cotton dehydrin protein and its encoding gene and application

Technical field

The present invention relates to vegetable protein and its encoding gene and application, more particularly to the Dehydrins for deriving from cotton Albumen dehydrin09 and its encoding gene, and its application in the genetically modified plants for cultivating drought tolerance raising.

Technical background

Dehydrins are one kind in LEA protein, after being widely present in each histoorgan and Embryos Development of Plant of plant Phase.Dehydrins are a kind of high-hydrophilic protection eggs that plant synthesizes when by abiotic stress such as low temperature, arid and high salts In vain, there is protection nucleic acid, intracellular protein and membrane structure to exempt from injured function.Many researchs are had confirmed in abiotic stress Under, there is closely contact between the expression of plant dehydration element and accumulation and stress resistance of plant.

Abiotic stress, such as arid, salt marsh, extreme temperature, chemical contamination and oxygen injury can be to plant growth hair Educate and cause serious harm, extreme loss is caused to crop yield, wherein influence of the arid to crop yield, many naturally inverse First place is accounted in border, it is endangered equivalent to other disaster sums, is the bottlenecks that many areas are agricultural development.According to statistics, the world is done Drought, semiarid zone account for the 34% of land area；China's arid, semiarid zone account for the 52% of area, face of suffering from drought in year Product the national billion cubic meter of the annual water shortage in irrigation district about 30, grain 350~40,000,000,000 is received because of water shortage less up to 200~2,700,000 hectares Kilogram；Particularly China relationship and primary grain producing such as North China, northeast and northwest, is the area of China's water shortage most serious, and spring drought frequently reaches Met by 10 years nine.

Because the resistance to coercive of plant belongs to quantitative character mostly, existing available germ plasm resource is deficient, using routine The difficulty of breeding technique improvement stress tolerance in plants is quite big, cultivates real resistance to stress kind with regard to particularly difficult.In recent years, With to plant stress-resistance molecular mechanism research deepen continuously and the fast development of Protocols in Molecular Biology, it is degeneration-resistant research from Physiological level is deep into molecular level, promotes the development of plant stress-resistance genetic engineering.It can be produced when plant is being forced Reaction should be beaten with a stick accordingly, to reduce or eliminate the harm brought to plant.This responsing reaction of plant is one and is related to more bases Cause, multi signal approach, the complex process of polygenes product.These genes and its expression product can be divided into 3 classes：(1) letter is participated in Number Cascaded amplification system and the gene and product of transcription control；(2) gene directly to be worked to protection biomembrane and protein And its expression product；(3) protein related to the intake and transhipment of water and ion.In recent years, improved by transgenic technology Research of the plant to stress-tolerance ability, and to the crops with stress-tolerance ability, xerophyte and halophytes Research all achieves significant achievement, and stress-related genes and signal transduction system there has also been with further understanding (Liu Q.1998.Two transcription factors, DREB1and DREB2, with an EREBP/AP2 DNA binding Domain, separate two cellular signal transduction pathways in drought and low Temperature responsive gene expression, respectively, in Arabidopsis.Plant Cell, 10：1391-1406；KANGJY.2002.Arabidopsis basic leucine zipper proteins that Mediate stress responsive abscisic acid signaling.Plant Cell, 14：343-357； ABEH.2003.Arabidopsis AtMYC2(bHLH)and AtMYB2(MYB)function as transcriptional Activators in abscisic acid signaling.Plant Cell, 15：63-78.).

But for current research situation, because its mechanism is sufficiently complex, many plants to the biochemistry of adverse circumstance and Physiological response mechanism still needs to be studied.Research in terms of the function of degeneration-resistant response gene and expression regulation will be The research that network system is transmitted in contact and whole signal between degeneration-resistant related signaling pathways provides important basis.

The content of the invention

The method clone that the present inventor is combined using SSH (Subtractive hybridization) with RACE (cDNA ends rapid amplifying) The encoding gene of a dehydrin protein (being named as dehydrin09 herein) for cotton, and determine its DNA sequence dna.Concurrently After being now conducted into recipient plant and overexpression, the drought tolerance of recipient plant can be significantly improved, and these characters can be stablized Heredity.

The encoding gene that first aspect present invention provides a dehydrin protein dehydrin09 for cotton (is ordered herein Entitled Ghdehydrin09), its nucleotides sequence is classified as SEQ ID NO：2.

Second aspect of the present invention provides a kind of recombinant expression carrier, and it contains the gene described in first aspect present invention, its By the way that the gene is inserted into a kind of expression vector to obtain, wherein the nucleotide sequence of the gene and the restructuring The expression control sequence of expression vector is operably connected；Preferably, the expression vector is pCAMBIA2300；Preferably, institute Recombinant expression carrier is stated as the rd29A-Ghdehydrin09-2300 carriers shown in accompanying drawing 2.

Third aspect present invention provides a kind of recombinant cell, and it contains gene or this hair described in first aspect present invention Recombinant expression carrier described in bright second aspect；Preferably, the recombinant cell is restructuring agrobatcerium cell.

Fourth aspect present invention provides a kind of method for improving drought resistance in plants, including：By described in first aspect present invention Gene or second aspect of the present invention described in recombinant expression carrier import plant or plant tissue and make the gene expression； Preferably, the plant is tobacco.

Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：Effectively producing the condition of plant Lower plant of the culture containing the gene described in first aspect present invention or the recombinant expression carrier described in second aspect of the present invention Or plant tissue；Preferably, the plant is tobacco.

Sixth aspect present invention provides the gene described in first aspect present invention, the restructuring table described in second aspect of the present invention It is used to improve drought resistance in plants and use for plant breeding up to the recombinant cell described in carrier or third aspect present invention On the way；Preferably, the plant is tobacco.

Seventh aspect present invention is provided as the protein of the gene code described in first aspect present invention, its amino acid sequence Such as SEQ ID NO：Shown in 1.

Brief description of the drawings

Fig. 1 is the structure stream of the plant expression vector (rd29A-Ghdehydrin09-2300) of Ghdehydrin09 genes Journey (Fig. 1 a-1b).

Fig. 2 is the plasmid figure of the plant expression vector (rd29A-Ghdehydrin09-2300) of Ghdehydrin09 genes.

Fig. 3 is the T of Ghdehydrin09 genes₀For transgenic tobacco plant (middle figure, T₀6；Right figure, T₀9) and as control Non-transgenic tobacco plants (left figure, CK) drought-enduring simulated experiment (transformation bud transplant 15 days after seedling, arid 14 days (no Watering), 25 DEG C, optical culture/14 hour light culture circulation in 10 hours) result.

Fig. 4 is to T using reverse transcription PCR₀For in transgenic tobacco plant and non-transgenic reference plant The result of Molecular Detection of the Ghdehydrin09 genes on transcriptional level.M is Marker, and 1-3 is non-transgenic reference Tobacco plant, 4-6 are the inapparent transgene tobacco T of drought-enduring effect₀For plant, 7-14 is the transgenosis cigarette of drought-enduring significant effect Careless T₀For plant.

Embodiment

The present invention is further described with reference to non-limiting example.

The restriction enzyme in the unreceipted source mentioned in example below is purchased from New England Biolabs public affairs Department.

Cotton SSH library constructions under the drought stress of embodiment 1：

Specific method is：

According to the PCR-select of Clontech companies^TMShown in cDNA Subtraction Kit kit specifications Method builds SSH libraries (subtracted library) by Subtractive hybridization method.With the Young Cotton of Osmotic treatment in experimentation The mRNA of the blade of seedling is used as control as sample (Tester) using the mRNA of the blade of untreated cotton seedling (Driver).Comprise the following steps that：

(1) material to be tested：

Ji cotton 14 (National Cotton mid-term storehouse, obtains unit Cotton research institute, Unified number：ZM-30270) it is seeded into On sterilized vermiculite, in 25 DEG C, illumination cultivation (photoperiod 16h illumination/8h is dark), 1/2MS fluid nutrient mediums are poured weekly and (are contained 9.39mM KNO₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM of KI, 100 μM H₃BO₃, 100 μM of MnSO₄, 30 μM of ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM of FeSO₄, Surplus is water) once.It is used to test when seedling plant height reaches 25-30cm.

(2) material process：

It is divided into 2 groups for trying seedling by above-mentioned, every group of 4 basins, per 1 plant of basin.First group is control group, in 25 DEG C, photoperiod 16h Cultivate under illumination/8h dark conditions, normally poured with 1/2MS fluid nutrient mediums.Second group is Osmotic treatment group, 25 DEG C, light week Cultivated under phase 16h illumination/8h dark conditions, stop pouring, processing 10 days, then the leaf of timely two groups of seedling apicals 1/3 of clip Piece, after liquid nitrogen quick freeze, preserved in -70 DEG C of refrigerators.

(3) Total RNAs extraction：

Control group and each 0.5g of the cotton leaf of Osmotic treatment group are taken respectively, with plant RNA extraction kit (Invitrogen) total serum IgE of cotton is extracted.With the ultraviolet specrophotometer U-2001 measure gained total serum IgEs of HITACHI companies In 260nm and 280nm absorbance, OD₂₆₀/OD₂₈₀Ratio is 1.8-2.0, shows that total serum IgE purity is higher, with 1.0% fine jade The integrality of sepharose electrophoresis detection total serum IgE, the brightness of 28S bands is about 2 letters of 18S bands, shows that RNA integrality is good It is good.Use Oligotex mRNA purification kits (the purification of polyA+RNA from of Qiagen companies Total RNA) separation mRNA.

(4) Subtractive hybridization：

By the PCR-select of Clontech companies^TMSide shown in cDNA Subtraction Kit kit specifications Method carries out Subtractive hybridization.Driver mRNA and Tester mRNA are first distinguished into reverse transcription, obtain double-strand cDNA, then with 2 μ G Tester cDNA and 2 μ g Driver cDNA carry out subtractive hybridization as parent material.Respectively will under 37 DEG C of water-baths Tester cDNA and Driver cDNA Rsa I digestion 1.5h, are then divided into two equal portions by the Tester cDNA after digestion, Different joint in connection, and Driver cDNA are not connected to head.Two kinds of Tester cDNA for being connected with different joints respectively with mistake The Driver cDNA mixing of amount, carry out positive subtractive hybridization for the first time.The product of two kinds of first time subtractive hybridization is mixed, then Second of positive subtractive is carried out with the Driver cDNA being newly denatured to hybridize, and differential expression is then expanded by inhibition PCR twice Fragment, be enriched with it.

In order to have increased access to the effective of EST (Expressed Sequence Tag, EST) (Unigene) Property, avoid gene without restriction enzyme site and obtained sequence in non-translational region.In addition to Rsa I enzymes, this experiment uses restriction endonuclease simultaneously HaeIII carries out digestion to Tester cDNA and Driver cDNA by above-mentioned steps and carries out subtractive hybridization and PCR amplifications. Finally merge second of PCR primer of two groups of forward direction subtractive hybridization cDNA fragments.

(5) structure of subtracted library and preliminary screening, clone and identification

According to method shown in the product description of pGEM-T Easy kits (being purchased from Promega), by above-mentioned merging just To second of pcr amplification product of subtractive hybridization cDNA fragments, (QIAquick PCR Purification Kit are purified, and are purchased from Qiagen) it is connected, comprises the following steps that with pGEM-T Easy carriers：Following ingredients are sequentially added in 200 μ l PCR pipes：It is pure μ l, 2 × T4DNA ligase buffer solutions of second of inhibition PCR primer 3 of positive subtractive hybridization cDNA fragments after the merging of change The μ l of 5 μ l, pGEM-T Easy carriers, 1 μ l, T4DNA ligase 1, in 4 DEG C of connections overnight.Then, 10 μ L coupled reaction products are taken, It is added in 100 μ L competence e. coli jm109s (being purchased from TAKARA) and mixes, ice bath 30min, 42 DEG C of heat shock 60s, ice Bath 2min, another plus 250 μ L LB nutrient solutions (1%Tryptone is purchased from OXOID, and 0.5%Yeast Extract are purchased from OXOID, 1%NaCl is purchased from traditional Chinese medicines) after be placed in 37 DEG C of shaking tables, with 225r/min shaken cultivation 30min, take 200 μ L bacterium solutions to be coated on and contain 50 μ g/mL ampicillins (being purchased from Amresco), 40 μ g/mL X-gal (the chloro- 3- indoles-β-D- galactosides of 5- bromo- 4), 24 μ g/mL IPTG (isopropyl-beta D-thio galactopyranoside) (X-gal and IPTG are purchased from TAKARA) LB (being same as above) is solid On body culture plate, 37 DEG C of cultivation 18h.Count the clear white and blue colonies number of diameter ＞ 1mm in culture plate, random picking 360 white colony (numberings：Gh-D001 to Gh-D360).All white colonies are chosen in containing 50 μ g/mL ampicillins LB fluid nutrient mediums 96 porocyte culture plates (CORNING) in, glycerol adding is to final concentration 20% after 37 DEG C of overnight incubations, so Saved backup after -80 DEG C.With nest-type PRC primer Primer 1 and the Primer 2R (PCR-selectTM of Clontech companies CDNA Subtraction Kit kits carry) enter performing PCR amplification checking to the bacterium solution obtained by the culture, obtain 238 Positive colony, Invitrogen (Shanghai) Trading Co., Ltd. is sent to be sequenced all positive colonies

(6) the cDNA sequencing analysis of differential cloning：

After DNA sequencing result is removed into carrier and the cDNA of indefinite sequence and redundancy, 134 expressed sequence marks are obtained Sign (Expressed sequence tag, EST) (Unigene).Find wherein 79 Unigene in GenBank through BlastN In have a homologous sequence (albumen homology more than 50%), 30 EST Unknown Functions or to assume albumen separately have 25 not obtain Homologous matching, thus it is speculated that be probably the shorter sequence in 3 ' or 5 ' end non-translational regions.

The cotton dehydrin protein gene dehydrin09 of embodiment 2 clone

After the sequencing result for numbering the positive colony for being Gh-D222 is removed into redundant DNA, sequence is SEQ ID No：3, sequence The protein of the row analysis shows sequential coding belongs to dehydrin protein, herein by SEQ ID No：Total length corresponding to 3 encodes base Because being named as Ghdehydrin09, its corresponding albumen is named as dehydrin09.

SEQ ID No：3

The clone of Ghdehydrin09 total length encoding genes

Ghdehydrin09 genetic fragments (the SEQ ID No obtained：3) there is terminator codon TGA in, therefore Only need to be 5'RACE to clone its total length encoding gene.

According to the SEQ ID No obtained：3 sequences, three specific primers are designed, as reverse transcription primer and 5' RACE 3 ' end primers.

Ghdehydrin09 GSP1：SEQ ID NO：4：

TATGATTTGT ACTAAAAATG

Ghdehydrin09 GSP2：SEQ ID NO：5：

TCTTGTGTTG TCCAGGGAGT TTC

Ghdehydrin09 GSP3：SEQ ID NO：6：

TCTGGCGTCT CTGGCTGGAC

Experimental procedure is by kit specification operation (5 ' RACE System for Rapid Amplification of CDNA Ends kits are purchased from Invitrogen companies).

CDNA (reverse transcription primer SEQ ID NO are obtained with cotton mRNA reverse transcriptions：4), then tried according to above-mentioned 5 ' RACE Step in agent box specification adds Poly C tails, carries out the amplification of first round PCR by template of the product after tailing, the primer is SEQ ID NO：5 and universal primer AAP (kit carries), is comprised the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l mRNA reverse transcriptions are simultaneously Add the cDNA after Poly C tails, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：Each 2.0 μ of 5 and AAP L, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, 33 circulations (94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extension 10min.

2.0 μ l are taken as template after the PCR primer of gained is diluted into 50 times by the use of distilled water, with SEQ ID NO：6 with it is general Primer AUAP carries out the second wheel PCR amplifications, comprises the following steps that：50 μ l PCR reaction systems：5μl 10×Ex Buffer、3μl The first round PCR primer of 2.5mM dNTP, 2.0 μ l dilution, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：6 and AUAP Each 2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, and 33 circulations (94 DEG C of denaturation 30s, 58 DEG C Anneal 30s, 72 DEG C of extension 2min), 72 DEG C of extension 10min.The band that fragment is about 500bp is reclaimed from the second wheel PCR primer (Gel Extraction Kit are purchased from OMEGA) is connected to pGEM-T Easy carriers, is then transformed into Escherichia coli In JM109 competent cells (specific method is same as above), and the bacterium solution after conversion is coated on the LB containing 50 μ g/mL ampicillins Screened on solid medium..Random 10 white colonies of picking are inoculated in the LB containing 50 μ g/mL ampicillins respectively Cultivated in fluid nutrient medium, glycerol adding to final concentration 20%, -80 DEG C saves backup after 37 DEG C of overnight incubations.SEQ ID NO：6 with Universal primer AUAP carries out bacterium solution PCR amplifications (reaction system and reaction condition are same as above), obtains 3 positive colonies, send the English Weihe River prompt Base (Shanghai) trade Co., Ltd is sequenced, and obtains the cDNA of the gene 5 ' ends.

By sequence obtained by the positive colony sequencing in the 5'RACE products of gained and SEQ ID No：3 splicings, obtain SEQ ID NO：17：

According to SEQ ID NO：17 sequences Design pair of primers are as follows：

Ghdehydrin09F：SEQ ID NO：7：

ATGGCCGAGGAGCATACCAGC

Ghdehydrin09R：SEQ ID NO：8：

TCAAGCCTTTTCTTTTTCTTCATC

Pass through SEQ ID NO：7 and SEQ ID NO：8 clone Ghdehydrin09 complete encoding sequences.

Using TaKaRa PrimeSTAR HS archaeal dna polymerases, enter performing PCR reaction by template of the cDNA of cotton.50μl PCR reaction systems：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 cDNA, 1.0 μ l PrimeSTAR, 10 μM Primer SEQ ID NO：7 and SEQ ID NO：8 each 2.0 μ l, and 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extension 10min.

Pcr amplification product adds A tails：PCR primer adds 2.5 times of absolute ethyl alcohol, and -20 DEG C are placed 10 minutes, centrifugation, are gone Clearly, dry, dissolved with 21 μ l distilled waters.Add 2.5 μ 10 × Ex of l Buffer, 0.5 μ l 5mM dATP, 1 μ l Ex Taq. Reaction condition：70 DEG C are reacted 30 minutes.The DNA fragmentation for obtaining about 600bp is reclaimed into (Omega QIAquick Gel Extraction Kits), and connected It is connected on pGEM T-easy carriers and (obtains Ghdehydrin09-pGEM plasmids), is then transformed into Escherichia coli JMl09 Screened (method is same as above) in competent cell and on the LB solid mediums containing 50 μ g/mL ampicillins.Choose at random Take 10 white colonies to be inoculated in respectively in the LB fluid nutrient mediums containing 50 μ g/mL ampicillins to cultivate, 37 DEG C were cultivated Glycerol adding to final concentration 20%, -80 DEG C saves backup after night.SEQ ID NO：7 and SEQ IDNO：8 carry out bacterium solution PCR amplifications (reaction system and reaction condition are same as above), 4 positive colonies are obtained, deliver to Invitrogen's sequencing, Gained sequence is SEQ ID NO：2, the amino acid sequence such as SEQ ID NO of its dehydrin09 albumen encoded：Shown in 1.

The amino acid sequence of dehydrin09 albumen：SEQ ID NO：1

The nucleotide sequence of Ghdehydrin09 encoding genes：SEQ ID NO：2

Embodiment 3Ghdehydrin09 gene plant expression vector establishments

Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd) As plant expression vector, 35S promoter of the NPTII genes containing double enhancers is replaced with Pnos promoters, to reduce NPTII eggs Expression in plant in vain.Inducible promoter rd29A and Tnos terminator are selected respectively as Ghdehydrin09 genes Promoter and terminator, structure flow are as shown in Figure 1.

Use primer SEQ ID NO：9 and SEQ ID NO：10 is (remote purchased from Beijing China with plant expression vector PBI 121 Foreign Science and Technology Ltd.) it is template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR react System：10 μ l 5 × PS Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l PBI121,1.0 μ l PrimeSTAR, 10 μM draw Thing SEQ ID NO：9 and SEQ ID NO：10 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 33 circulations (94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.By EcoRI, Gained PCR primer is connected to pCAMBIA2300 (Promega, T4 ligase box) after BglII digestions and obtains pCAMBIA2300- 1。

SEQ ID NO：9：

GCACGAATTCATACAAATGGACGAACGGAT

SEQ IDNO：10：

ATCCAGATCTAGATCCGGTGCAGATTATTTG

Use primer SEQ ID NO：11 and SEQ ID NO：12 with PBI 121 for template amplification Tnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l PBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：11 and SEQ ID NO：12 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min, and 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C Extend 30s), 72 DEG C of extension 10min.PCAMBIA2300-1 is connected to as the PCR primer by obtained by after Sad, EcoRI digestion (Promega, T4 ligase box) obtains pCAMBIA2300-2

SEQ ID NO：11：

AAGGAGCTCGAATTTCCCCGATCGTTCAAA

SEQ ID NO：12：

TCAGAATTCCCAGTGAATTCCCGATCTAGTA

Use primer SEQ ID NO：13 and SEQ ID NO：14 with arabidopsis, (Colombia's type, is purchased from Www.arabidopsis.org) DNA be template amplification arabidopsis rd29A promoters (refer to Zeng J., et L2002, Preparation of total DNA from " recalcit rant plant taxa ", Acta Bot.Sin., 44 (6)： Method extraction arabidopsis DNA in 694-697).Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR react System：10 μ 5 × PS of l μ l arabidopsis of Buffer, 3 μ l 2.5mM dNTP, 1.0 DNA, 1.0 μ l PrimeSTAR, 10 μM Primer SEQ ID NO：13 and SEQ ID NO：14 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.By HindIII, Gained PCR primer is connected to (connection method is same as above) pCAMBIA2300-2 after PstI digestions and obtains pCAMBIA2300-3

SEQ ID NO：13：

ACTAAGCTTCCTTCTTGACATCATTCAATTTTA

SEQ ID NO：14：

TGACTGCAGTCCAAAGATTTTTTTCTTTCCAATAG

Use primer SEQ ID NO：15 and SEQ ID NO：16 expand Ghdehydrin09 (with the institute of embodiment 2 by PCR The positive Ghdehydrin09-pGEM plasmids of acquisition are template), using TaKaRa PrimeSTAR HS archaeal dna polymerases.50μ L PCR reaction systems：10 μ 5 × PS of l μ l Ghdehydrin09-pGEM plasmids of Buffer, 3 μ l 2.5mM dNTP, 1.0, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：15 and SEQ ID NO：16 each 2.0 μ l, and 31 μ l distilled water. PCR reaction conditions：94 DEG C of pre-degeneration 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C extension 10min.(connection method is same as above) pCAMBIA2300- is connected to as the PCR primer by obtained by after PstI, SacI digestion 3, obtain plant expression vector rd29A-Ghdehydrin09-2300 (Fig. 2).

SEQ ID NO：15：

TGACTGCAGATGGCCGAGGAGCATACCAGC

SEQ ID NO：16：

AAGGAGCTCTCAAGCCTTTTCTTTTTCTTCATC

Embodiment 4rd29A-Ghdehydrin09-2300 expression vectors convert Agrobacterium

It is prepared by Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competence：By Agrobacterium LBA4404 draws the inoculation of a single spot on the LB solid mediums containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, 28 DEG C of cultures 1 to 2 days.Picking single bacterium colony is inoculated in LB fluid nutrient mediums of the 5ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, at 28 DEG C Overnight incubation (about 12-16h) is shaken to OD₆₀₀It is worth for 0.4, forms seed bacterium solution.Take 5ml activate after seed bacterium solution (1: 20 Ratio) it is inoculated in LB fluid nutrient mediums of the 100ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, 28 DEG C are shaken culture 2- 2.5h to OD₆₀₀=0.8.Ice bath bacterium solution 10min, shakes up once every 3min, makes bacterium even into resting state.At 4 DEG C 4000g centrifuges 10min, abandons supernatant；10% glycerine resuspension thalline of a certain amount of ice precooling is added, 4000g is centrifuged at 4 DEG C 10min, collect precipitation；Ice-cold 10% glycerine repeats to wash 3-4 times；10% glycerine for adding appropriate ice bath precooling hangs again Floating bacterial precipitation, that is, be made LBA4404 competent cells, dispensed with 40 μ l/ pipes, saved backup in -70 DEG C.

Convert Agrobacterium：Melting LBA4404 competent cells on ice, 1 μ is added into the 40 μ l competent cell The positive rd29A-Ghdehydrin09-2300 plasmids of gained, ice bath about 10min after mixing in l embodiments 3.After ice bath It is pre- that the mixture of the competent cell and positive rd29A-Ghdehydrin09-2300 plasmids with micropipettor is transferred to ice In cold electric shock cup, rapping makes suspension reach bottom, has been careful not to bubble.Electric shock cup (being purchased from Bio-Rad) is put into electricity Hit on the slideway of room, promote slideway to put electric shock cup to electroporation chamber base electrode.Using 0.1cm electric shock cup, MicroPulser (being purchased from Bio-Rad) program is arranged to " Agr ", and electric shock is once.Electric shock cup is taken out immediately, adds 1ml 28 DEG C preheating LB culture mediums.Quickly gently mixture is beaten with micropipettor.Suspension is transferred to 1.5ml centrifugation Pipe, 28 DEG C, 225rpm cultures 1h.100~200 μ l bacterium solution is taken to be coated on corresponding resistance screening culture medium flat plate that (LB is solid Body culture medium, containing 50 μ g/ml rifampins, 50 μ g/ml streptomysins, 50 μ g/ml kanamycins), 28 DEG C of cultures.Screen positive transformants Clone, and its bacterium solution is saved backup in -70 DEG C.

Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method

(countries tobacco mid-term storehouse, unit is obtained with 75% alcohol-pickled tobacco seed：Tobacco institute of the Chinese Academy of Agricultural Sciences, storehouse are compiled Number I5A00660) 30s, is washed twice with sterilizing distilled water.8min is soaked with 0.1% mercuric chloride again, is washed twice with sterilizing distilled water, it is complete Into surface sterilizing.The tobacco seed of surface sterilizing is placed in MS solid mediums (KNO containing 18.78mM₃, 1.25mM KH₂PO₄, 20.6mM NH₄NO₃, 1.5mM MgSO₄, 3.0mM CaCl₂, 50 μM of KI, 100 μM of H₃BO₃, 100 μM of MnSO₄, 30 μM ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM of FeSO₄, 7.4g/L agar, sucrose 30g/L is remaining Measure as water) on, germinateed under aseptic condition, prepare aseptic seedling.Tests for sterility is taken to be cut into the leaf dish of 5mm × 5mm sizes, use The rd29A-Ghdehydrin09-2300 containing expression vector of the gained Agrobacterium LBA4404 in the embodiment 4 of exponential phase The bacterium solution of positive transformants clone contaminates leaf dish 10min, blots bacterium solution, is co-cultured under dark condition 2 days (MS culture mediums).By leaf Piece go to differential medium (the MS+1mg/L basic elements of cell division (BA)+0.1mg/L methyl α-naphthyl acetate (NAA)+50mg/L kanamycins+ 500mg/L cephalosporins) on, cultivated 45 days or so under illumination condition, cut after bud is grown up and be transferred to root media (MS+ 50mg/L kanamycins+500mg/L cephalosporins) in culture 30 days or so, after well developed root system by seedling be transferred to containing Preservation is numbered on the MS culture mediums of 500mg/L cephalosporins.

Take the transgenic tobacco leaf of acquisition, extraction DNA (with arabidopsis DNA extraction method in embodiment 3), with SEQ ID NO：7 and SEQ ID NO：8 (50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：9 and SEQ ID NO：10 each 2.0 μ l, and 35 μ l distilled water. PCR reaction conditions：94 DEG C of pre-degeneration 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C extension 10min, and by PCR be accredited as the positive plant (T is numbered₀1-T₀20) and preserve.

Embodiment 6 is overexpressed Ghdehydrin09 T₀For the drought-enduring simulated experiment of transgene tobacco and Function Identification

Sterilized vermiculite is impregnated with 1/2MS fluid nutrient mediums.By the T of the gained of embodiment 5₀1-T₀20 transgene tobaccos And control tobacco (non-transgenic) tissue-cultured seedling is transplanted to vermiculite respectively, 25 DEG C, 10h optical cultures/14h light cultures circulation, every 5 days A 1/2MS fluid nutrient medium is poured, strong seedling culture carries out drought stress experiment after 15 days, by transgene tobacco and control tobacco Arid 14 days (not watering), 25 DEG C, 10h optical cultures/14h light cultures circulation.T₀Show for the Identification of Drought of transfer-gen plant, Adjoining tree is all wilted seriously, and T₀1、T₀3、T₀5、T₀6、T₀8、T₀9、T₀12、T₀15 8 transfer-gen plants can normally give birth to It is long, significant drought tolerance is shown (referring to Fig. 3, with T₀6、T₀Exemplified by 9, remaining is not shown).

Embodiment 7 verifies the expression of Ghdehydrin09 genes on transcriptional level

Control tobacco, not significantly drought-enduring transgene tobacco T are taken respectively₀For plant, significantly drought-enduring transgene tobacco T₀For plant (upgrowth situation is good) arid each 0.05g of blade of 14 days, is extracted total with plant RNA extraction kit (Invitrogen) RNA.Absorbance of the gained total serum IgE in 260nm and 280nm is determined with the ultraviolet specrophotometer U-2001 of HITACHI companies, Calculate each RNA concentration.According to Invitrogen reverse transcription reagent box SuperScript III Reverse Method shown in Transcriptase carries out reverse transcription, and (2 μ g total serum IgEs are as template, reverse transcription primer SEQ ID NO：8).Pass through SEQ ID NO：7 and SEQ ID NO：8 amplification Ghdehydrin09, detect dehydrin09 albumen relative expression's situations.

Using TaKaRa PrimeSTAR HS archaeal dna polymerases, carried out by template of the cDNA obtained by above-mentioned reverse transcription PCR reacts.50 μ l PCR reaction systems：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 cDNA, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：7 and SEQ ID NO：8 each 2.0 μ l, and 30 μ l distilled water.PCR reacts Condition：94 DEG C of pre-degeneration 5min, 29 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extensions 10min。

Product electrophoresis result is as shown in Figure 4：M is DNALadder Marker (DL2000, purchased from the auspicious true biotechnology in Shenzhen Co., Ltd), 1-3 is non-transgenic reference tobacco, and 4-6 is the inapparent transgene tobacco T of drought-enduring effect₀For plant, 7-14 For the transgene tobacco T of drought-enduring significant effect₀(it is followed successively by for plant：T₀1、T₀3、T₀5、T₀6、T₀8、T₀9、T₀12、T₀15).Figure Shown in stripe size and Ghdehydrin09 (about 600bp) in the same size.As a result show, compareing in tobacco does not have external source The signal of Ghdehydrin09 genetic transcriptions, the transgene tobacco T of drought-enduring significant effect₀For external source Ghdehydrin09 in plant The transcription of gene is stronger, the drought-enduring inapparent transgene tobacco T of effect₀Transcribe very weak for plant or do not transcribe.

Claims (8)

1. a dehydrin protein for cotton, its sequence is SEQ ID NO：1.

2. encoding the gene of the dehydrin protein of claim 1, its sequence is SEQ ID NO：2.

3. a kind of recombinant expression carrier, it is by the way that the gene described in claim 2 is inserted into a kind of expression vector to obtain , and the nucleotide sequence of the gene is operably connected with the expression control sequence of the expression vector, the expression Carrier is pCAMBIA2300.

4. the recombinant expression carrier described in claim 3, it is the rd29A-Ghdehydrin09-2300 carriers shown in accompanying drawing 2.

5. a kind of recombinant cell, it contains the gene described in claim 2 or the recombination expression described in claim 3 or 4 carries Body；The recombinant cell is restructuring agrobatcerium cell.

6. a kind of method for improving drought resistance in plants, including：By described in the gene described in claim 2 or claim 3 or 4 Recombinant expression carrier import plant or plant tissue and make the gene expression；The plant is tobacco.

7. a kind of method of prepare transgenosis plant, including：Culture contains claim 2 institute under conditions of plant is effectively produced The plant for the recombinant expression carrier described in gene or claim 3 or 4 stated or plant tissue, wherein the plant is cigarette Grass.

8. the recombinant expression carrier described in gene, claim 3 or 4 described in claim 2 or the weight described in claim 5 Group cell is used to improve drought resistance in plants and the purposes for plant breeding, wherein the plant is tobacco.