CN103703020B - A DREB1 classes transcription factor for cotton and its encoding gene and application - Google Patents
A DREB1 classes transcription factor for cotton and its encoding gene and application Download PDFInfo
- Publication number
- CN103703020B CN103703020B CN201280001634.8A CN201280001634A CN103703020B CN 103703020 B CN103703020 B CN 103703020B CN 201280001634 A CN201280001634 A CN 201280001634A CN 103703020 B CN103703020 B CN 103703020B
- Authority
- CN
- China
- Prior art keywords
- plant
- seq
- nucleotide sequence
- tobacco
- ghcbf2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Abstract
The present invention relates to the DREB1 class transcription factor GhCBF2 and its encoding gene that one derives from cotton, and its application in the genetically modified plants for cultivating resistance of reverse raising.
Description
Technical field
The present invention relates to plant transcription factor and its encoding gene and application, more particularly to one from cotton
DREB1 class transcription factor GhCBF2 and its encoding gene, and its application in the genetically modified plants for cultivating resistance of reverse raising.
Background technology
Abiotic stress, such as arid, salt marsh, extreme temperature, chemical contamination and oxygen injury can be to plant growth hair
Educate and cause serious harm, extreme loss is caused to crop yield, wherein influence of the arid to crop yield, many naturally inverse
First place is accounted in border, it is endangered equivalent to other disaster sums, is the bottlenecks that many areas are agricultural development.According to statistics, the world is done
Early, half-dried early area accounts for the 34% of land area；The dry early, semiarid zone in China accounts for 52% of area in state, and year is by early face
Product is up to 20~2,700,000 hectares, the national billion cubic meter of the annual water shortage in irrigation district about 30, and it is public to receive grain 350~4,000,000,000 less because of water shortage
Jin；Particularly China relationship and primary grain producing such as North China, northeast and northwest, is the area of China's water shortage most serious, and spring drought frequently reaches
Meet within 10 years nine.
Because the resistance to coercive of plant belongs to quantitative character mostly, existing available germ plasm resource is deficient, using routine
The difficulty of breeding technique improvement stress tolerance in plants is quite big, cultivates real resistance to stress kind with regard to particularly difficult.In recent years,
With to plant stress-resistance molecular mechanism research deepen continuously and the fast development of Protocols in Molecular Biology, it is degeneration-resistant research from
Physiological level is deep into molecular level, promotes the development of plant stress-resistance genetic engineering.It can be produced when plant is being forced
Corresponding responsing reaction, to reduce or eliminate the harm brought to plant.This responsing reaction of plant is one and is related to more bases
Cause, multi signal approach, the complex process of polygenes product.These genes and its expression product can be divided into 3 classes：(1) letter is participated in
Number Cascaded amplification system and the gene and product of transcription control；(2) gene directly to be worked to protection biomembrane and protein
And its expression product；(3) protein related to the intake and transhipment of water and ion.In recent years, improved by transgenic technology
Research of the plant to stress-tolerance ability, and to coercing the crops with tolerance, xerophyte and halophytes
Research all achieves significant achievement, and stress-related genes and signal transduction system there has also been with further understanding (Liu
Q.1998.Two transcrip tion facto rs, DREB1 and DREB2, w ith an EREBP/AP2DNA
Binding domain, separate two cellular signal transduction pathways in drought-
And low temperature-responsive gene exp ression, respectively, in A
Rabidopsis.Plant Cell, 10：1391-1406；KAN GJY.2002.A rabid op sis basic leucine
zipper p ro teins that mediate stress2responsive abscisic acid signaling。
Plant Cell, 14：343-357；ABE H.2003.A rabid op sis AtMYC2(bHLH)and AtMYB2(MYB)
function as transcrip tional activato rs in abscisic acid signaling.Plant
Cell, 15：63-78.).
But for current research situation, because its mechanism is sufficiently complex, many plants are to the biochemistry under adverse circumstance
Still needed to be studied with physiological response mechanism.Research in terms of the function of degeneration-resistant response gene and expression regulation accounts for
Majority, but contact between degeneration-resistant related signaling pathways and whole signal transmit network system mechanism need into
One step research.Although many research institutions obtain all kinds of transgenosis with certain anti-adversity ability by modern biotechnology
Plant, but also it is not up to the standard of industrialization.Therefore in terms of stress resistance of plant is improved, also many needs of work are done.
The content of the invention
The present inventor has cloned a DREB (dehydration response element for cotton using SSH with the RACE methods being combined
Associated proteins, dehydration responsive element binding protein) class transcription factor (is named as herein
GhCBF2 the DNA sequence dna of encoding gene).And find after being conducted into transfer-gen plant, it can obviously improve transfer-gen plant
Winter resistance and drought resistance, and these characters can stablize heredity.
First aspect present invention provides a DREB class transcription factor GhCBF2 for cotton, and its sequence is SEQ ID NO：1.
Second aspect of the present invention provides the nucleotide sequence of the transcription factor described in coding first aspect present invention.It is preferred that
Ground, the nucleotide sequence have SEQ ID NO：Nucleotide sequence shown in 2.
Third aspect present invention provides a kind of recombinant expression carrier, and it contains the nucleotides sequence described in second aspect of the present invention
Arrange and the nucleotide sequence is operably connected with the expression control sequence of the expression vector；Preferably, the carrier
For the rd29A-GhCBF2-2300 carriers shown in accompanying drawing 2.
Fourth aspect present invention provides a kind of recombinant cell, its contain nucleotide sequence described in second aspect of the present invention or
Recombinant expression carrier described in person's third aspect present invention；Preferably, the recombinant cell is restructuring agrobatcerium cell.
A kind of method for improving plant cold-resistant and/or drought resistance of fifth aspect present invention, including：By second party of the present invention
Recombinant expression carrier described in nucleotide sequence or third aspect present invention described in face imports plant or plant tissue and made
The gene expression；Preferably, the plant is tobacco.
A kind of method of prepare transgenosis plant of sixth aspect present invention, including：Trained under conditions of plant is effectively produced
Support containing the nucleotide sequence described in second aspect of the present invention, the recombinant expression carrier described in third aspect present invention plant or
Plant tissue；Preferably, the plant is tobacco.
Seventh aspect present invention provides the transcription factor described in first aspect present invention, the core described in second aspect of the present invention
The recombinant cell described in recombinant expression carrier or fourth aspect present invention described in nucleotide sequence, third aspect present invention is used for
Improve plant cold-resistant and/or drought resistance and the purposes for plant breeding；Preferably, the plant is tobacco.
Brief description of the drawings
Fig. 1 is the structure flow of GhCBF2 plant expression vector (rd29A-GhCBF2-2300).
Fig. 2 is the plasmid figure of GhCBF2 plant expression vector (rd29A-GhCBF2-2300).
Fig. 3 is the experimental result of transgene tobacco winter resistance.It is transfer-gen plant (T to scheme a left side1L3-2)；Figure is right to turn base to be non-
Because of plant (control).
Fig. 4 is the experimental result of transgene tobacco drought resistance.It is transfer-gen plant (T to scheme a left side1L5-11)；Right figure is non-turn
Gene plant (control).
Embodiment
Embodiment
The present invention is further described with reference to non-limiting example.
The restriction enzyme mentioned in example below is purchased from New England Biolabs companies
Cotton SSH library constructions under 1 cold stress of embodiment：
Specific method is：
Utilize the PCR-select of Clontech companiesTMCDNA Subtraction Kit, according to shown in product description
Method pass through suppressed subtractive hybridization method build subtractive library.With low-temperature treatment 6h cotton seedling blade in experimentation
MRNA as sample (tester), control (driver) is used as using the mRNA of untreated cotton seedling blade.
(1) material to be tested：
Ji cotton 14 (National Cotton mid-term storehouse, obtains unit Cotton research institute, Unified number：ZM-30270) it is seeded into
On sterilized vermiculite, cultivated under the conditions of 25 DEG C, photoperiod 16h/8h, pour 1/2MS culture mediums (9.39mMKNO weekly3,
0.625mM KH2PO4, 10.3mM NH4NO3, 0.75mM MgSO4, 1.5mM CaCl2, 50 μM of KI, 100 μM of H3BO3, 100 μM
MnSO4, 30 μM of ZnSO4, 1 μM of Na2MoO4, 0.1 μM of CoCl2, 100 μM of Na2EDTA, 100 μM of FeSO4) once.When seedling strain
It is used to test during up to 25-30cm.
(2) material process：
2 groups will be divided into for examination seedling, every group of 4 basins, per 1 plant of basin.First group is control group, in 25 DEG C, illumination cultivation, second
Group is low-temperature treatment group, and 6h, illumination cultivation are handled in 4 DEG C of low temperature.Timely two groups of seedling apicals 1/3 of clip after being disposed
Blade, after liquid nitrogen quick freeze, preserved in -70 DEG C of refrigerators.
(3) Total RNAs extraction：
The cotton leaf 0.5g of control and low-temperature treatment is taken respectively, is carried with plant RNA extraction kit (invitrogen)
Take the total serum IgE of cotton.Suction of the total serum IgE in 260nm and 280nm is determined with the ultraviolet specrophotometer U-2001 of HITACHI companies
Shading value, OD260/OD280 ratios are 1.8-2.0, show that total serum IgE purity is higher, are detected with 1.0% agarose gel electrophoresis
The integrality of total serum IgE, the brightness of 28S bands are about 2 times of 18S bands, show that RNA integrality is good.It is public using Qiagen
Oligotex mRNA purification kits (the purification of polyA+RNA from total RNA) separation of department
mRNA。
(4) suppressed subtractive hybridization：
In order to have increased access to EST (unigene) validity, gene is avoided to be turned over without restriction enzyme site and obtained sequence non-
Area is translated, this laboratory uses the PCR-selectTM cDNA Subtraction Kit of Clontech companies, according to description of commodity
Book RsaI, HaeIII digest to the double-strand cDNA from above-mentioned separation mRNA respectively, do two groups of suppressed subtractive hybridizations, its
His step and method strictly press the PCR-select of Clontech companiesTMCDNA Subtraction Kit product descriptions institute
The method shown carries out suppressed subtractive hybridization, finally merges second of PCR primer of two groups of forward direction subtractive hybridization cDNA fragments.
(5) structure of cDNA subtractive libraries and preliminary screening, clone, identification
Second of PCR primer (QIAquick PCR Purification of the positive subtractive hybridization cDNA fragments of merging
Kit is purified, purchased from Qiagen) it is connected with pGEM-T Easy carriers (being purchased from Promega), produced according to pGEM-T Easy kits
Method shown in product specification, is comprised the following steps that：Following ingredients are sequentially added with 200ul PCR pipes：Purify cDNA fragments
Second of PCR primer 3ul, T4 ligase buffer solution 5ul, pGEM-T Easy carriers 1ul, T4DNA ligase 1ul, in 4 DEG C of companies
Take over night.10 μ L coupled reaction products are taken, are added in 100 μ L competence e. coli jm109s (being purchased from TAKARA), ice bath
30min, heat shock 60s, ice bath 2min, separately adding 250 μ L LB nutrient solutions, (1%Tryptone is purchased from OXOID, 0.5%Yeast
Extract is purchased from OXOID, and 1%NaCl is purchased from traditional Chinese medicines) put in 37 DEG C of shaking tables, 225r/min shakes bacterium 30min, takes 200 μ L bacterium solution kinds
Plant in ampicillin containing 50ug/mL, 40ug/mLX-gal, 24ug/mL IPTG (X-gal/IPTG is purchased from TAKARA) LB
On (being same as above) solid culture flat board, 37 DEG C of cultivation 18h.The clear white and blue colonies number of diameter ＞ 1mm in culture plate is counted,
Random picking 200 white colonies (numbering：Gh-C001 to Gh-C200) in the LB liquid training containing 50ug/mL ampicillins
In 96 porocyte culture plates (CORNING) for supporting base, glycerol adding is to final concentration 20% after 37 DEG C of overnight incubations, in -80 DEG C of preservations
It is standby.With (the PCR-select of nest-type PRC primer Primer 1TMCDNA Subtraction Kit kits carry) and
Primer 2R(PCR-selectTMCDNA Subtraction Kit kits carry) bacterium solution PCR amplifications are carried out, obtain 152
Individual positive colony, Invitrogen (Shanghai) Trading Co., Ltd. is being sent to be sequenced all positive colonies.
(6) the cDNA sequencing analysis of differential cloning：
After DNA sequencing result is removed into carrier and indefinite sequence and unnecessary cDNA, 112 EST are obtained
(unigene).Through BlastN find wherein 52 unigene have in GenBank homologous sequence (similar more than 50%), 25
EST Unknown Functions or to assume albumen, separately have 35 not obtain homologous matching, thus it is speculated that to be probably to turn in 3 ', 5 ' ends are non-
Translate the shorter sequence in area.
The clone of embodiment 2GhCBF2 encoding genes
In embodiment 1 has the unigene of homologous sequence, clone Gh-C072 sequences such as SEQ ID NO：Shown in 3：
1 ACTTTTCTCA CAGCGGAGAT GGCAGCTCGT GCCCACGACG TAGCGGCCAT AGCTCTGAGG
61 GGGAGGTCGG CTTGCCTGAA CTTCGCGGAC TCAGCTTGGA GGCTTCCGGT TCCGGCTTCT
121 GCTGATCCCA AGGATATCCA GAAGGCGGCG GCAGAGGCGG CGGAGGCATT TAGACAACCG
181 GCTGAGCAAT GGGACGGAAA CTCTGAAGCT AATGCAAAGG GAGATGAAAA CAAAGGGAGT
241 TTGTGTGAGA ATGGGTTTTA TTTGGACGAG GAGGCGGTTT TTGGAACACA AAGTTATCTG
301 GAAAACATGG CGGCAGGGAT GATGATGTCA CCCCCTCGTT GTGGGT
Sequence analysis shows that the amino acid sequence of the coding of the sequence belongs to DREB1 albuminoids, herein names the albumen
For GhCBF2.
(1) clone of GhCBF2 full-length gene
According to the GhCBF2 obtained genetic fragment, two specific primers are designed, the 5 ' ends as 3 ' RACE are special
Specific primer：
GhCBF2 GSP1：SEQ ID NO：4：
CTCACAGCGGAGATGGCAGCTC
GhCBF2 GSP2：SEQ ID NO：5：
TCGTGCCCACGACGTAGCGGCCAT
Experimental procedure is by kit specification operation (3 ' RACE System for Rapid Amplification of
CDNA Ends kits, purchased from invitrogen companies)
With SEQ ID NO：4 and 3 ' end primer AUAP (kit carries), are carried out by template of the cDNA of mRNA reverse transcriptions
First round PCR is expanded.Comprise the following steps that：Ex Taq are purchased from TAKARA, 50 μ l PCR reaction systems：5μl 10×Ex
Buffer, 3 μ l 2.5mM dNTP, the cDNA of 2.0 μ l mRNA reverse transcriptions, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID
NO：Each 2.0 μ l of 4 and AUAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 58
DEG C annealing 30s, 72 DEG C extension 1min, 33 circulation；72 DEG C of extension 10min.
The PCR primer of gained takes 1 μ l as template after diluting 50 times by the use of double distilled waters, with SEQ ID NO：5 and 3 ' end primers
AUAP carries out the second wheel PCR amplifications, comprises the following steps that：50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l
2.5mM dNTP, the PCR primer that the 2.0 μ l first round diluted, 1.0 μ l Ex Taq, 10 μM of primer SEQ IDNO：5 and AUAP
Each 2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s,
72 DEG C of extension 1min, 33 circulations；72 DEG C of extension 10min.Second of PCR primer (QIAquick PCR Purification
Kit is purified, purchased from Qiagen) 3ul is connected to pGEM-T Easy Vector, and being transformed into e. coli jm109, (specific method is same
On), random 10 white colonies of picking are cultivated in the LB fluid nutrient mediums containing 50ug/mL ampicillins, 37 DEG C of cultures
To final concentration 20%, -80 DEG C save backup glycerol adding after overnight.SEQ ID NO：5 and 3 ' end primer AUAP carry out bacterium solution PCR expansions
Increase (system and condition are same as above), obtain 4 positive colonies, send Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced, obtain the base
The cDNA of cause 3 ' ends.
According to the GhCBF2 obtained genetic fragment, three specific primers are designed, respectively as mRNA reversion
Record primer (SEQ ID NO：6) and 5 ' RACE 3 ' end primers (SEQ ID NO：7 and 8).
GhCBF2 GSP3：SEQ ID NO：6：
AAACCGCCTC CTCGTCCAAA T
GhCBF2 GSP4：SEQ ID NO：7：
CCTCCCCCTC AGAGCTATGG C
GhCBF2 GSP5：SEQ ID NO：8：
CGCTACGTCG TGGGCACGAG CT
Experimental procedure is by kit specification operation (5 ' RACE System for Rapid Amplification of
CDNA Ends kits, purchased from invitrogen companies).SEQ ID NO：6 primer as mRNA reverse transcriptions into cDNA.
With SEQ ID NO：7 and 5 ' universal primer AAP (kit carries), with the cDNA of mRNA reverse transcriptions, (reverse transcription is drawn
Thing SEQ ID NO：6) amplification of first round PCR is carried out for template, comprised the following steps that：Ex Taq are purchased from TAKARA, 50 μ l PCR
Reaction system：The cDNA of 5 μ 10 × Ex of l μ l total serum IgE reverse transcriptions of Buffer, 3 μ l 2.5mM dNTP, 2.0,1.0 μ lExTaq,
10 μM of primer SEQ IDNO：Each 2.0 μ l of 7 and AAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；
94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, 33 circulate；72 DEG C of extension 10min.
The PCR primer of gained takes 1 μ l as template after diluting 50 times by the use of distilled water, with SEQ ID NO：8 and 3 ' end primers
AUAP carries out the second wheel PCR amplifications, comprises the following steps that：50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l
2.5mM dNTP, the PCR primer that the 2.0 μ l first round diluted, 1.0 μ l Ex Taq, 10 μM of primer SEQ IDNO：8 and AUAP
Each 2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s,
72 DEG C of extension 1min, 33 circulations；72 DEG C of extension 10min.Second of PCR primer (QIAquick PCR Purification
Kit is purified, purchased from Qiagen) 3ul is connected to pGEM-T Easy Vector, JM109 (specific method is same as above) is transformed into, at random
10 white colonies of picking are cultivated in the LB fluid nutrient mediums containing 50ug/mL ampicillins, are added after 37 DEG C of overnight incubations
To final concentration 20%, -80 DEG C save backup glycerine.SEQ ID NO：8 and 3 ' end primer AUAP carry out bacterium solution PCR amplifications (reaction
System and reaction condition are same as above), 4 positive colonies are obtained, send Guangzhou Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced, are obtained
The cDNA of the gene 5 ' ends.
After 5 ' the RACE product clonings sequencing of gained, splice with 3 ' RACE products sequencing results.Obtain GhCBF2 total length
CDNA sequence.It is as follows that pair of primers is designed according to GhCBF2 full length cDNA sequence：
GhCBF2F：SEQ ID NO：9：
ATGCTCGATTCTGGGTCTGTTTCGTCGCC
GhCBF2R：SEQ ID NO：10：
TTATTGACAG TAACTCCAAA GAGGTAT
Pass through SEQ ID NO：9 and SEQ ID NO：10 clone the total length of GhCBF2 encoding genes.
Using TaKaRa PrimeSTAR HS archaeal dna polymerases, enter performing PCR reaction by template of the cDNA of cotton.50μl
PCR reaction systems：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 cDNA, 1.0 μ lPrimeSTAR, 10 μM
Primer SEQ ID NO：9 and SEQ ID NO：10 each 2.0 μ l, 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 60s, 33 circulate；72 DEG C of extension 10min.
Pcr amplification product adds A：PCR primer adds 2.5 times of absolute ethyl alcohol, and -20 DEG C are placed 10 minutes, centrifugation, remove supernatant,
Dry, dissolved with 21 μ l distilled waters.Add 10 × Ex of 2.5ul Buffer, 0.5ul 5mM dATP, 2.5ul10 × Ex
Taq.Reaction condition：70 DEG C are reacted 30 minutes.The DNA fragmentation for obtaining about 600bp is reclaimed into (Omega QIAquick Gel Extraction Kits), clone
To pGEM T-easy carriers, convert JM109 (method is same as above).Random 10 white colonies of picking are in containing 50ug/mL ammonia benzyls
Cultivated in the LB fluid nutrient mediums of penicillin, glycerol adding to final concentration 20%, -80 DEG C saves backup after 37 DEG C of overnight incubations.SEQ
ID NO：9 and SEQ ID NO：10 carry out bacterium solution PCR amplifications (reaction system and reaction condition are same as above), obtain 5 positive colonies,
Invitrogen (Shanghai) Trading Co., Ltd. is sent to be sequenced, sequence is SEQ ID NO：2.Its protein expression sequence is SEQ ID NO：
1。
GhCBF2 amino acid sequence：SEQ ID NO：1
1 MLDSGSVSSP LSDSGSGTSR
21 PANFSDEDVM LASICPKKRA
41 GRKKFRETRH PVYRGVRRKN
61 SGKWVCEVRE PNKKSRIWLG
81 TFLTAEMAAR AHDVAAIALR
101 GRSACLNFAD SAWRLPVPAS
121 ADPKDIQKAA AEAAEAFRQP
141 AEQWDGNSEA NAKGDENKGS
161 LCENGFYLDE EAVFGTQSYL
181 ENMAAGMMMS PPRCGYNGDE
201 LEYDAADDFI PLWSYCQ*
The nucleotide sequence of GhCBF2 encoding genes：SEQ ID NO：2
1 ATGCTCGATT CTGGGTCTGT TTCGTCGCCG TTATCGGATT CTGGAAGTGG TACTTCTCGT
61 CCGGCAAATT TCTCCGATGA AGATGTGATG TTAGCTTCGA TTTGTCCGAA GAAACGAGCG
121 GGACGGAAGA AATTCCGCGA GACTCGGCAT CCGGTTTACC GTGGAGTCCG CCGGAAGAAC
181 TCGGGGAAGT GGGTTTGTGA AGTGAGGGAG CCTAATAAGA AGTCGAGGAT TTGGCTGGGT
241 ACTTTTCTCA CAGCGGAGAT GGCAGCTCGT GCCCACGACG TAGCGGCCAT AGCTCTGAGG
301 GGGAGGTCGG CTTGCCTGAA CTTCGCGGAC TCAGCTTGGA GGCTTCCGGT TCCGGCTTCT
361 GCTGATCCCA AGGATATCCA GAAGGCGGCG GCAGAGGCGG CGGAGGCATT TAGACAACCG
421 GCTGAGCAAT GGGACGGAAA CTCTGAAGCT AATGCAAAGG GAGATGAAAA CAAAGGGAGT
481 TTGTGTGAGA ATGGGTTTTA TTTGGACGAG GAGGCGGTTT TTGGAACACA AAGTTATCTG
541 GAAAACATGG CGGCAGGGAT GATGATGTCA CCCCCTCGTT GTGGGTACAA TGGGGATGAA
601 CTAGAATACG ATGCTGCCGA TGATTTCATA CCTCTTTGGA GTTACTGTCA ATAA
Embodiment 3GhCBF2 plant expression vector constructions
Plant expression vector rd29A-GhCBF2-2300 structures flow is as shown in Figure 1.
Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd)
As plant expression vector, 35S promoter of the NP TII genes containing double enhancers is replaced with Pnos promoters, to reduce NPTII
Expression of the albumen in plant.Select promoters and terminator of the inducible promoter rd29A and Tnos as GhCBF2 genes.
Comprise the following steps that：
Use SEQ ID NO：11 and SEQ ID NO：12 (are purchased from ocean section of Beijing China with plant expression vector PBI121
Skill Co., Ltd) it is template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reactants
System：10 μ 5 × PS of l μ l PBI121 of Buffer, 3 μ l 2.5mM dNTP, 1.0,1.0 μ l PrimeSTAR, 10 μM of primer
SEQ ID NO：11 and SEQ ID NO：12 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, 33 circulate；72 DEG C of extension 10min, product pass through Eco
RI, BglII digestion are connected to pCAMBIA2300 (promega T4 ligases box) and obtain pCAMBIA2300-1.
SEQ ID NO：11：
GCAC GAATTC ATACAAATGGACGAACGGAT
SEQ ID NO：12：
ATCC AGATCT AGATCCGGTGCAGATTATTTG
Use SEQ ID NO：13 and SEQ ID NO：14 using PBI121 as template amplification Tnos, using TaKaRa's
PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0
μ l PBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：13 and SEQ ID NO：14 each 2.0 μ l, and 31 μ
L distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 30s, 33
Circulation；72 DEG C of extension 10min.Product is connected to pCAMBIA2300-1 by SacI, Eco RI digestions, obtains
pCAMBIA2300-2。
SEQ ID NO：13：
AAGGAGCTCGAATTTCCCCGATCGTTCAAA
SEQ ID NO：14：
TCAGAATTC CCAGTGAATT CCCGATCTAG TA
Use SEQ ID NO：15 and SEQ ID NO：16 with arabidopsis, (Colombia's type, is purchased from
Www.arabidopsis.org) genomic DNA is that template amplification arabidopsis rd29A promoters (refer to Zeng J., et
L.2002, Preparation of total DNA from " recalcit rant plant taxa ", Acta Bot.Sin.,
44(6)：Method extraction arabidopsis DNA in 694-697).Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50μl
PCR reaction systems：10 μ 5 × PS of l μ l arabidopsis of Buffer, 3 μ l 2.5mM dNTP, 1.0 DNA, 1.0 μ l PrimeSTAR,
10 μM of primer SEQ ID NO：15 and SEQ ID NO：16 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94℃
Pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 33 circulate；72 DEG C of extension 10min, PCR primer
PCAMBIA2300-2 is connected to by HindIII, SalI digestion, obtains pCAMBIA2300-3.
SEQ ID NO：15：
ACTAAGCTTCCTTCTTGACATCATTCAATTTTA
SEQ ID NO：16：
TGAGTCGACTCCAAAGATT TTTTTCTTTC CAATAG
Use SEQ ID NO：17 and SEQ ID NO：(template is that embodiment 2 is contained to 18 amplification GhCBF2 genes
The pGEM T-easy recombinant vectors of GhCBF2 genes), using TaKaRa PrimeSTAR HS archaeal dna polymerases.50μl PCR
Reaction system：10 μ 5 × PS of l μ of Buffer, 3 μ l 2.5mM dNTP, 1.0 lGhCBF2-pGEM, 1.0 μ l PrimeSTAR,
10 μM of primer SEQ ID NO：17 and SEQ ID NO：18 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94℃
Pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min, 33 circulate；72 DEG C of extension 10min.Pass through
SalI, SacI digestion are connected to pCAMBIA2300-3, obtain plant expression vector, rd29A-GhCBF2-2300.
SEQ ID NO：17：
TGAGTCGAC ATGCTCGATTCTGGGTCTGTTTCGTCGCC
SEQ ID NO：18：
AAGGAGCTC TTATTGACAG TAACTCCAAA GAGGTAT
Embodiment 4rd29A-GhCBF2-2300 expression vectors convert Agrobacterium
It is prepared by Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competence：1-2d is by agriculture bar in advance
Bacterium LBA4404 draws single spot inoculation, 28 DEG C of cultures 1 on the LB solid mediums containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins
To 2d.Picking single bacterium colony is inoculated in LB fluid nutrient mediums of the 5ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, at 28 DEG C
It is 0.4 to shake overnight incubation (about 12-16h) to OD600 values, forms seed bacterium solution.Take bacterium solution (1: 20 ratio after 5ml activation
Example) it is inoculated in the LB fluid nutrient mediums of the same concentration antibiotic of 100ml, 28 DEG C are shaken culture 2-2.5h to OD600=0.8.
Ice bath bacterium solution 10min, shakes up once every 3min, makes bacterium even into resting state.4000g centrifuges 10min at 4 DEG C,
Abandon supernatant；Certain glycerine resuspension thalline of head for precooling 10% is added, 4000g centrifuges 10min at 4 DEG C, collects precipitation；With 10%
Glycerine repeats to wash 3-4 times；Adding 10% glycerine of appropriate ice bath precooling, suspended bacterial precipitates again, is dispensed with 40 μ l/ pipes,
Saved backup in -70 DEG C.
Convert Agrobacterium：Melt competent cell on ice, 1 μ l rd29A- is added into 40 μ l competent cell
GhCBF2-2300 plasmids, ice bath about 10min after mixing.Competence and DNA mixture are transferred to the electric shock cup of precooling with rifle
In, rapping makes suspension reach bottom, has been careful not to bubble.Electric shock cup (being purchased from bio-rad) is put into the slideway of electroporation chamber
On, promote slideway to put electric shock cup to electroporation chamber base electrode.Using 0.1cm electric shock cup when, MicroPulser
The program of (being purchased from bio-rad) is arranged to " Agr ", and electric shock is once.Electric shock cup is taken out immediately, adds the LB cultures of 28 DEG C of preheatings
Base.It is quick and soft to be beaten cell with rifle.Suspension is transferred to 1.5ml centrifuge tube, 28 DEG C, 225rpm cultivates 1h.Take
100~200 μ l bacterium solution coating and corresponding resistance screening culture medium (LB solid mediums, containing 50 μ g/ml rifampins, 50 μ g/
Ml streptomysins, 50 μ g/ml kanamycins) on flat board, 28 DEG C of cultures.
Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method
(countries tobacco mid-term storehouse, tobacco institute of unit the Chinese Academy of Agricultural Sciences, storehouse numbering are obtained with 75% alcohol-pickled tobacco seed
I5A00660) 30s, then 8min is soaked with 0.1% mercuric chloride, carry out surface sterilization.Sterilized tobacco seed is placed in MS solids
Culture medium (18.78mM KNO3, 1.25mM KH2PO4, 20.6mM NH4NO3, 1.5mM MgSO4, 3.0mM CaCl2, 50 μM
KI, 100 μM of H3BO3, 100 μM of MnSO4, 30 μM of ZnSO4, 1 μM of Na2MoO4, 0.1 μM of CoCl2, 100 μM of Na2EDTA, 100 μM
FeSO4, 7.4g/L agar, sucrose 30g/L) on aseptic germination, prepare aseptic seedling.Tests for sterility is taken to be cut into 5mm × 5mm sizes
Leaf dish, with the During Agrobacterium leaf dish 10min containing expression vector in exponential phase, bacterium solution is blotted, in dark condition
It is lower to co-culture 2 days (MS culture mediums).Blade is gone into differential medium, and (that is mould for MS+1mg/LBA+0.1mg/LNAA+50mg/L cards
Element+500mg/L cephalosporins) on, cultivated 45 days or so under illumination condition, cut after bud is grown up and be transferred to root media
Culture 30 days or so in (MS+50mg/L kanamycins+500mg/L cephalosporins), seedling is transferred to after well developed root system and only added
Have and preservation is numbered on the MS culture mediums of 500mg/L cephalosporins.
The transgenic tobacco leaf of acquisition is taken, extraction genomic DNA (with arabidopsis DNA extraction method in embodiment 3), is used
Primer SEQ ID NO：17 and SEQ ID NO：18 enter performing PCR identification (50 μ l PCR reaction systems：5 μ l 10 × ExBuffer, 3
μ l 2.5mM dNTP, 2.0 μ l DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：17 and SEQ ID NO：18 is each
2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of 30s that anneal, 72
DEG C extension 1min, 33 circulation；72 DEG C of extension 10min), positive plant is preserved, numbering is T respectively0L1 to T0L20.Choose
T0L1-T0L5 seed is carried out.
Embodiment 6 is overexpressed GhCBF2 transgene tobacco T1The cold-resistant simulated experiment in generation and Function Identification
Sterilized vermiculite is impregnated with 1/2MS culture mediums.By T0For transgene tobacco T0L1、T0L2、T0L3、T0L4 and
T0L5 seed and Wild-type non-transgenic control tobacco seed is sowed on vermiculite respectively, 25 DEG C, 10 hours optical culture/14
Hour light culture circulation, pours a 1/2MS culture medium for every 5 days, after cultivating 25 days, wins bottom leaf, extracts base
Because of a group DNA (with arabidopsis DNA extraction method in embodiment 3), primer SEQ ID NO are utilized：17 and SEQ IDNO：18 are PCR
Identification (reaction and condition are same as above), reject negative plant (control tobacco similarly wins leaf).Picking is of the same size
Transgene tobacco (T1L1、T1L2、T1L3、T1L4 and T1Each 10 plants of L5, numbering is T respectively1L1-1 to T1L1-10、T1L2-1 is extremely
T1L2-10、T1L3-1 to T1L3-10、T1L4-1 to T1L4-10 and T1L5-1 to T1L5-10), control tobacco (10 plants) is cooked cold-resistant
Experiment.Transgene tobacco, control tobacco, 4 DEG C are coerced 72 hours.Pass through 14 days renewal cultivations again.Then take out plant pair plant
Weighed.Above-mentioned T1Show for the cold hardness evaluation of transfer-gen plant, adjoining tree can not restore normal growth, and growth is obvious
It is suppressed, and transfer-gen plant growth shows obvious winter resistance (accompanying drawing 3 and table 1) apparently higher than adjoining tree.Scheming
In 3, transfer-gen plant T is chosen1L3-2 and one plant of control exemplary display of tobacco, the result of other tobaccos are similar with them.
Embodiment 7 is overexpressed GhCBF2 transgene tobacco T1The drought resisting simulated experiment in generation and Function Identification
Sterilized vermiculite is impregnated with 1/2MS culture mediums.By T0For transgene tobacco T0L1、T0L2、T0L3、T0L4 and T0L5
Seed and control tobacco seed sow respectively on vermiculite, 25 DEG C, optical culture/14 hour light cultures circulation in 10 hours, every 5
It pours a 1/2MS, after cultivating 25 days, wins bottom leaf, extraction genomic DNA is (the same as arabidopsis in embodiment 3
DNA extraction method), utilize primer SEQ ID NO：17 and SEQ ID NO：18 do PCR identifications, reject negative plant (control cigarette
Grass similarly wins leaf).Picking transgene tobacco (T of the same size1L1、T1L2、T1L3、T1L4 and T1Each 10 plants of L5,
Numbering is T respectively1L1-11 to T1L1-20、T1L2-11 to T1L2-20、T1L3-11 to T1L3-20、T1L4-11 to T1L4-20 and
T1L5-11 to T1L5-20), compare tobacco (10 plants) and do drought-enduring experiment.Transgene tobacco, control tobacco arid (are not poured for 14 days
Water), 25 DEG C, optical culture/14 hour light culture circulation in 10 hours.Plant pair plant is then taken out to be weighed.Above-mentioned T1In generation, turns
The Identification of Drought of gene plant shows, adjoining tree wilt it is serious, and transfer-gen plant can normal growth, show obvious
Drought resistance (accompanying drawing 4 and table 1).In Fig. 4, transfer-gen plant T is chosen1L5-11 and one plant of control exemplary display of tobacco, other
The result of tobacco is similar with them.
Table 1
Claims (13)
1. a DREB class transcription factor for cotton, its sequence is SEQ ID NO：1.
2. encode the nucleotide sequence of the transcription factor described in claim 1.
3. the nucleotide sequence described in claim 2, it is characterised in that there is SEQ ID NO:Nucleotide sequence shown in 2.
4. a kind of recombinant expression carrier, its contain the nucleotide sequence described in Claims 2 or 3 and the nucleotide sequence with
The expression control sequence of the expression vector is operably connected.
5. the recombinant expression carrier described in claim 4, wherein the carrier is the rd29A-GhCBF2-2300 shown in accompanying drawing 2
Carrier.
6. a kind of recombinant cell, it contains the restructuring described in nucleotide sequence or claim 4 described in Claims 2 or 3
Expression vector.
7. the recombinant cell described in claim 6, wherein the recombinant cell is restructuring agrobatcerium cell.
8. a kind of method for improving plant cold-resistant and/or drought resistance, including：By the nucleotide sequence described in Claims 2 or 3
Or the recombinant expression carrier described in claim 4 imports plant or plant tissue and makes the gene expression.
9. the method described in claim 8, wherein the plant is tobacco.
10. a kind of method of prepare transgenosis plant, including：Culture contains claim 2 under conditions of plant is effectively produced
Or the plant or plant tissue of the nucleotide sequence described in 3 or the recombinant expression carrier described in claim 4.
11. the method described in claim 10, wherein the plant is tobacco.
12. the restructuring table described in nucleotide sequence, claim 4 described in the transcription factor of claim 1, Claims 2 or 3
It is used to improve plant cold-resistant and/or drought resistance up to the recombinant cell described in carrier or claim 6 and is educated for plant
The purposes of kind.
13. the purposes described in claim 12, wherein the plant is tobacco.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2012/000797 WO2013185256A1 (en) | 2012-06-11 | 2012-06-11 | Dreb1-like transcription factor of cotton and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103703020A CN103703020A (en) | 2014-04-02 |
| CN103703020B true CN103703020B (en) | 2017-12-12 |
Family
ID=49757386
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201280001634.8A Expired - Fee Related CN103703020B (en) | 2012-06-11 | 2012-06-11 | A DREB1 classes transcription factor for cotton and its encoding gene and application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103703020B (en) |
| WO (1) | WO2013185256A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112111508A (en) * | 2019-06-20 | 2020-12-22 | 新疆农业科学院核技术生物技术研究所（新疆维吾尔自治区生物技术研究中心） | Cotton stress-tolerant gene GhCBF and coding protein and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984059A (en) * | 2010-07-28 | 2011-03-09 | 曲延英 | Gossypium barbadense DREB transcription factor gene and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7317098B2 (en) * | 2004-07-01 | 2008-01-08 | The Board Of Trustees Of Michigan State University | Ryegrass CBF3 gene: identification and isolation |
| WO2009092009A2 (en) * | 2008-01-18 | 2009-07-23 | Ceres, Inc. | Modulating light response pathways in plants |
| CN102191254A (en) * | 2011-04-15 | 2011-09-21 | 中国农业科学院生物技术研究所 | CBF transcription factor capable of regulating plant stress resistance, and coded gene and application thereof |
-
2012
- 2012-06-11 CN CN201280001634.8A patent/CN103703020B/en not_active Expired - Fee Related
- 2012-06-11 WO PCT/CN2012/000797 patent/WO2013185256A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984059A (en) * | 2010-07-28 | 2011-03-09 | 曲延英 | Gossypium barbadense DREB transcription factor gene and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Cotton GhDREB1 increases plant tolerance to low temperature and is negatively regulated by gibberellic acid;Da-Peng Shan et al.;《New Phytologist》;20070720;第176卷(第1期);第70-81页 * |
| 海岛棉DREB基因的克隆及植物表达载体的构建;张艳妮等;《新疆农业大学学报》;20100715;第33卷(第4期);第312-316页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2013185256A1 (en) | 2013-12-19 |
| CN103703020A (en) | 2014-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103620039A (en) | Hkt protein of cotton and coding gene and application thereof | |
| CN105073772A (en) | Myb transcription factor myb1-1 of cotton and coding gene, and use thereof | |
| CN103703020B (en) | A DREB1 classes transcription factor for cotton and its encoding gene and application | |
| CN105026565B (en) | One cotton ion channel albuminoid and its encoding gene and application | |
| CN105008385B (en) | One salt mustard MYB class transcription factor MYB1-2 and its encoding gene and application | |
| CN105026563B (en) | One cotton protein kinase and its encoding gene and application | |
| CN103748223A (en) | Cotton isopentenyl-transferase, gene encoding same and uses thereof | |
| CN104884619B (en) | A kind of cotton isopentene group transferase I PT2 and its encoding gene and application | |
| CN105008538B (en) | A kind of cotton isopentene group transferase I PT3 and its encoding gene and application | |
| CN103857693B (en) | One DREB1 class transcription factor of Cotton Gossypii and encoding gene thereof and application | |
| CN103842375B (en) | A DREB1 classes transcription factor for cotton and its encoding gene and application | |
| CN103842376B (en) | Cotton AVP1 albumen and its encoding gene and application | |
| CN105452453A (en) | Thellungiella halophila calcineurin b-like protein cbl-4, coding gene of same, and application thereof | |
| CN104837998B (en) | Cotton zinc finger protein (Czf4) and coding gene and application thereof | |
| CN104379746B (en) | One cotton ion channel albuminoid and its encoding gene and application | |
| CN105051059B (en) | A kind of cotton dehydrin protein and its encoding gene and application | |
| CN105008529B (en) | One cotton cysteine proteinase cysp1 1 and its encoding gene and application | |
| CN105143246A (en) | Cysteine protease cysp1-2 of cotton and coding gene, and use thereof | |
| CN103842377B (en) | Cotton AVP1 albumen and its encoding gene and application | |
| CN104837999B (en) | Cotton zinc finger protein (Czf6) and coding gene and use thereof | |
| CN103748224A (en) | Cotton protein kinase and encoded gene and use thereof | |
| CN105189754A (en) | Cotton PP2Ac-type protein phosphatase PP2Ac-7, coding gene of same, and application thereof | |
| CN103619872A (en) | Cotton AVP1 protein and coding gene and application thereof | |
| CN105102473A (en) | Cotton PP2AC-type protein phosphatase PP2AC-4, coding gene of same, and application thereof | |
| CN104884623A (en) | Cotton mannose-6-phosphoric acid reductase, gene for encoding same, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Applicant after: Biocentury Seed Industry Co., Ltd. Address before: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Applicant before: Biocentury Transgene Co., Ltd. |
|
| COR | Change of bibliographic data | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: 518117 7th floor, Chuangshi seed industry building, A701, No.22, Puzi Road, Pingdi street, Longgang District, Shenzhen, Guangdong Province Patentee after: Biocentury Seed Industry Co., Ltd. Address before: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Patentee before: Biocentury Seed Industry Co., Ltd. |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171212 Termination date: 20200611 |