CN103842376B - Cotton AVP1 albumen and its encoding gene and application - Google Patents
Cotton AVP1 albumen and its encoding gene and application Download PDFInfo
- Publication number
- CN103842376B CN103842376B CN201280001632.9A CN201280001632A CN103842376B CN 103842376 B CN103842376 B CN 103842376B CN 201280001632 A CN201280001632 A CN 201280001632A CN 103842376 B CN103842376 B CN 103842376B
- Authority
- CN
- China
- Prior art keywords
- plant
- seq
- nucleotide sequence
- tobacco
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The invention provides a kind of AVP1 albumen from cotton, and its application in the genetically modified plants that drought resistance, salt tolerance are improved are cultivated.
Description
Technical field
The present invention relates to vegetable protein and its encoding gene and application, the more particularly to one AVP1 egg from cotton
In vain, and its cultivate drought resistance, salt tolerance improve genetically modified plants in application.
Background technology
Arid causes the earth land area Planting Crops more than 40% to be restricted, to Global Agriculture production and grain
Supply also constitutes serious threat, and arid is to one of main environment restrictive condition of crop yield.
The area of saline-alkali soil is very big in the world, there are about 400,000,000 hectares, accounts for the 1/3 of irrigated farmland.Dry half-dried
Drought, arid area are because rainfall is few, evaporation violent, and salinity is constantly accumulated；Riviera causes soil to contain due to inwelling
The increase of salt amount.China's saline-alkali soil is distributed mainly on northwest, North China, northeast and coastal region, with the growth year by year of greenhouse area
With the passage in grower's year generation, the soil salinization is on the rise.For most crops, excessive Na+ can be right in soil
The normal growth metabolism of plant produces toxic action.Therefore how to improve crop yield under salt marsh environment just turns into China
The problem of particularly significant in agricultural production.
Use conventional methods seed selection salt tolerant, drought resisting plant variety it is no doubt simple and feasible, but make slow progress, limitation
Greatly.With the development of molecular biology technology, large quantities of genes relevant with plant salt tolerance, drought resisting are cloned in succession, plant
Transgenic technology has important breakthrough, and this administers salination and desert effectively to improve crop yield using nonirrigated farmland and salt-soda soil
Change soil and provide new idea and method.
The resistance of plant is a sufficiently complex quantitative character, its Mechanisms of Salt Resistance is related to from plant to organ, tissue,
Physiology and biochemistry is until each level of molecule.Plant can produce corresponding responsing reaction when being forced, to reduce or eliminate
The harm brought to plant.This responsing reaction of plant is one and is related to polygenes, multi signal approach, polygenes product and answers
Miscellaneous process.These genes and its expression product can be divided into 3 classes:(1) base of signal cascade amplification system and transcription control is participated in
Cause and product；(2) gene and its expression product directly worked to protection biomembrane and protein；(3) with water and ion
The intake gene and protein related to transhipment.The scientist of various countries has also done substantial amounts of work for this, and making a breakthrough property
Progress (Park S.2005.Up-regulation of a H+-pyrophosphatase(H+-PPase)as a strategy
to engineer drought-resistant crop plants.Proc.Natl.Acad.Sci.USA.102:18830-
18835；ABE H.2003.A rabid op sis AtMYC2(bHLH)and AtMYB2(MYB)function as
transcrip tional activato rs in abscisic acid signaling.Plant Cell,15:63-78；
Zhang ZL.2011.Arabidopsis Floral Initiator SKB1Confers High Salt Tolerance by
Regulating Transcription and Pre-mRNA Splicing through Altering Histone
H4R3and Small Nuclear Ribonucleoprotein LSM4Methylation.Plant Cell,23:396–
411).By animal nutrition, the research for coercing crops, xerophyte and halophytes with tolerance is all taken
Significant achievement was obtained, stress-related genes and signal transduction system there has also been and further understand.
But for current research situation, because its mechanism is sufficiently complex, many plants are to the biochemistry under adverse circumstance
Still needed to be studied with physiological response mechanism.Research in terms of the function and expression regulation of degeneration-resistant response gene is accounted for
The mechanism of contact between majority, but degeneration-resistant related signaling pathways and whole signal transmission network system need into
One step research.Although many research institutions are by modern biotechnology, obtain all kinds of with degeneration-resistant energy such as certain salt tolerant, drought resistings
The genetically modified plants of power, but also it is not up to the standard of industrialization.Therefore in terms of stress resistance of plant is improved, also many work are needed
Do.
The content of the invention
Inventor clones AVP1 genes from cotton, is transformed into tobacco, obtains the transgenosis that salt tolerance, drought resistance are improved
Tobacco, has obvious application prospect improving stress resistance of plant research field.
The present inventor has cloned the coding base of an AVP1 albuminoid for cotton using SSH and the RACE method being combined
Because of the DNA sequence dna of (being named as GhAVP1-2 genes herein).And find to be conducted into after transfer-gen plant, it can obviously improve and turn base
Because of the salt tolerance and drought resistance of plant, and these characters can stablize heredity.
The first aspect of the present invention provides an AVP1 albuminoid for cotton, and its sequence is SEQ ID No：1.
The second aspect of the present invention provides the nucleotide sequence of the albumen described in coding first aspect present invention.Preferably,
The nucleotide sequence of encoding said proteins has SEQ ID NO:Nucleotide sequence shown in 2.
The third aspect of the present invention provides a kind of recombinant expression carrier, and it contains the nucleotides described in second aspect of the present invention
Sequence, and the nucleotide sequence is operably connected with the expression control sequence of the expression vector.In another implementation
In scheme, the expression vector is rd29A-GhAVP1-2-2300, as shown in Figure 2.
The fourth aspect of the present invention provides a kind of recombinant cell, containing the nucleotide sequence described in second aspect of the present invention or
Recombinant expression carrier described in person's third aspect present invention.In one embodiment, the recombinant cell is recombinational agrobacterium
Cell.
A kind of method that the fifth aspect of the present invention provides improvement plant salt endurance and/or drought resistance, including：By the present invention
Recombinant expression carrier described in nucleotide sequence or third aspect present invention described in second aspect imports plant or plant group
Knit and make the gene expression.In one embodiment, the plant is tobacco.
The sixth aspect of the present invention provides a kind of method of prepare transgenosis plant, including：Effectively producing the bar of plant
Cultivate and carried containing the recombination expression described in the nucleotide sequence or third aspect present invention described in second aspect of the present invention under part
The plant of body or plant tissue.In one embodiment, the plant is tobacco.
The seventh aspect of the present invention provides the albumen described in first aspect present invention, the nucleosides described in second aspect of the present invention
The recombinant cell described in recombinant expression carrier or fourth aspect present invention described in acid sequence, third aspect present invention is used to improve
Plant salt endurance and/or drought resistance and the purposes for plant breeding.In one embodiment, the plant is tobacco.
Brief description of the drawings
Fig. 1 plant expression vectors rd29A-GhAVP1-2-2300 builds flow (Fig. 1 a-c).
Fig. 2 plant expression vectors rd29A-GhAVP1-2-2300 plasmid map.
The drought resistance growing state of Fig. 3 transgene tobaccos and check plant；It is left：Transfer-gen plant (T1N1-3)；It is right：It is right
According to tobacco 9.
The salt tolerance growing state of Fig. 4 transgene tobaccos and check plant；It is left：Transfer-gen plant (T1N4-12)；It is right：It is right
According to tobacco 12.
Embodiment
AVP1 genes are tonoplast H+Pyrophosphatase gene.
Cotton SSH library constructions under embodiment 1, drought stress：
Specific method is：
Utilize the PCR-select of Clontech companiesTMMethod shown in cDNA Subtraction Kit is by suppressing
Subtractive hybridization method builds subtractive library.MRNA using the leaf of the cotton seedling of Osmotic treatment in experimentation is used as sample
(tester) control (driver), is used as using the mRNA of the leaf of untreated cotton seedling.Specific steps are summarized as follows：
(1) material to be tested：
(National Cotton mid-term storehouse obtains unit Cotton research institute, Unified number to Ji cotton 14：ZM-30270) it is seeded into
On sterilized vermiculite, cultivated under the conditions of 25 DEG C, photoperiod 16h/8h, 1/2MS culture mediums (9.39mM KNO are poured weekly3,
0.625mM KH2PO4, 10.3mM NH4NO3, 0.75mM MgSO4, 1.5mM CaCl2, 50 μM of KI, 100 μM of H3BO3, 100 μM
MnSO4, 30 μM of ZnSO4, 1 μM of Na2MoO4, 0.1 μM of CoCl2, 100 μM of Na2EDTA, 100 μM of FeSO4) once.When seedling strain
It is used to test during up to 25-30cm.
(2) material process：
2 groups, every group of 4 basins, per 1 plant of basin will be divided into for examination seedling.First group is control group, in 25 DEG C, illumination cultivation, normally
Pour.Second group is Osmotic treatment group, and 25 DEG C, illumination cultivation stop pouring, handled 10 days, timely clip two after being disposed
The blade of group seedling apical 1/3, after liquid nitrogen quick freeze, is preserved in -70 DEG C of refrigerators.
(3) Total RNAs extraction：
Control group and the cotton leaf 0.5g of Osmotic treatment group are taken respectively, use plant RNA extraction kit
(invitrogen) total serum IgE of cotton is extracted according to specification.Determined with the ultraviolet specrophotometer U-2001 of HITACHI companies
Total serum IgE is in 260nm and 280nm absorbance, and OD260/OD280 ratios are 1.8-2.0, show that total serum IgE purity is higher, are used
1.0% agarose gel electrophoresis detects the integrality of total serum IgE, and the brightness of 28S bands is about 2 times of 18S bands, shows RNA
Integrality it is good.Use Oligotex mRNA purification kits (the purification of polyA+ of Qiagen companies
RNA from total RNA) separation mRNA.
(4) suppressed subtractive hybridization：
In order to have increased access to EST (unigene) validity, it is to avoid gene is turned over without restriction enzyme site and obtained sequence non-
Area is translated, following suppressed subtractive hybridization has been carried out.The mRNA obtained from previous step is according to the PCR- of Clontech companies
SelectTM cDNA Subtraction Kit explanation obtains cDNA.With RsaI (be purchased from New England Biolabs) and
HaeIII (being purchased from New England Biolabs) digests to double-strand cDNA respectively, does two groups of suppressed subtractive hybridizations.First
Group：The double-strand cDNA RsaI digestions that control group, arid group are obtained, then carry out suppressed subtractive hybridization；Second group：Control group,
The double-strand cDNA HaeIII digestions that arid group is obtained, then carry out suppressed subtractive hybridization.Other steps of suppressed subtractive hybridization
And shown in the PCR-selectTM cDNA Subtraction Kit product descriptions of method strictly by Clontech companies
Method is carried out, and finally merges second of PCR primer of two groups of positive subtractive hybridization cDNA fragments.
(5) structure of cDNA subtractive libraries and preliminary screening, clone, identification
Second of PCR primer (QIAquick PCR Purification of the positive subtractive hybridization cDNA fragments of merging
Kit is purified, purchased from Qiagen) it is connected with pGEM-T Easy (being purchased from Promega kits) carrier, according to pGEM-T Easy examinations
The product description of agent box, is comprised the following steps that：Following ingredients are sequentially added with 200ul PCR pipes：Purify the of cDNA fragments
Secondary PCR product 3ul, T4 ligase buffer solution 5ul, pGEM-T Easy carrier l ul, T4DNA ligase 1ul, in 4 DEG C of connections
Overnight.10 μ L coupled reaction products are taken, are added in 100 μ L competence e. coli jm109s (being purchased from TAKARA), ice bath
30min, heat shock 60s, ice bath 2min, separately adding 250 μ L LB fluid nutrient mediums, (1%Tryptone is purchased from OXOID, 0.5%
Yeast Extract are purchased from OXOID, and 1%NaCl is purchased from traditional Chinese medicines) put in 37 DEG C of shaking tables, 225r/min shakes bacterium 30min, takes 200 μ L
Bacterium solution plants in ampicillin containing 50ug/mL, 40ug/mL X-gal, 24ug/mL IPTG that (X-gal/IPTG is purchased from
TAKARA on LB solid mediums (agar that 1.5% is added in LB fluid nutrient mediums) culture plate), 37 DEG C of cultivation 18h.Count
Diameter ＞ 1mm clear white and blue colonies number, random 360 white colonies of picking (numbering in culture plate：Gh-D001 is extremely
Gh-D360).360 white colonies are chosen into the 96 hole cell culture in the LB fluid nutrient mediums containing 50ug/mL ampicillins
In plate (CORNING), glycerol adding is saved backup to final concentration 20% in -80 DEG C after 37 DEG C of overnight incubations.With nest-type PRC primer
(the PCR-select of Clontech companies of Primer 1TMCDNA Subtraction Kit kits are carried) and Primer 2R
(the PCR-select of Clontech companiesTMCDNA Subtraction Kit kits are carried) bacterium solution PCR amplifications are carried out, obtain
To 292 positive colonies, Invitrogen (Shanghai) Trading Co., Ltd. is being sent to be sequenced all positive colonies.
(6) the cDNA sequencing analysis of differential cloning：
DNA sequencing result is removed after carrier and indefinite sequence and unnecessary cDNA, 180 EST are obtained
(unigene).Find that wherein 102 unigene have homologous sequence (homology more than 50%) in GenBank through BlastN,
33 EST Unknown Functions are hypothesis albumen, separately have 45 not obtain homologous matching, supposition is probably in 3 ', 5 ' ends
The shorter sequence of non-translational region.
The clone of embodiment 2, GhAVP1-2 genes
There is a unigene of homologous sequence above-mentioned, clone Gh-D156 sequences：SEQ ID No：3：
Sequence analysis (nucleotide sequence is in NCBI Blast) shows that the amino acid sequence of the coding of the sequence belongs to AVP1 classes
Albumen, is named as GhAVP1-2 genes by the corresponding encoding genes of clone Gh-D156 herein.
According to the GhAVP1-2 genetic fragments obtained, two specific primers are designed, it is special as 3 ' RACE 5 ' ends
Specific primer：
GhAVP1-2GSP1：SEQ ID No：4：
ATGTTATATTTGGCCTTGCTTT
GhAVP1-2GSP2：SEQ ID No：5：
ACAAATCTGTGATCATCCCAATTT
Experimental procedure operates (3 ' RACE System for Rapid Amplification of by kit specification
CDNA Ends kits are purchased from invitrogen companies).
With SEQ ID NO:4 and 3 ' end primer AUAP (kit is carried), are carried out by template of the cDNA of mRNA reverse transcriptions
First round PCR is expanded.Comprise the following steps that：Ex Taq are purchased from TAKARA, 50 μ l PCR reaction systems：5μl 10×Ex
The cDNA of the μ l mRNA reverse transcriptions of Buffer, 3 μ l 2.5mM dNTP, 2.0,1.0 μ l Ex Taq, 10 μM of primer SEQ ID
NO:Each 2.0 μ l of 4 and AUAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C are denatured 30s, 58
DEG C annealing 30s, 72 DEG C extension 2min, 33 circulation；72 DEG C of extension 10min.
The PCR primer of gained takes 2.0 μ l as template after diluting 100 times with double distilled waters, with SEQ ID NO:5 draw with 3 ' ends
Thing AUAP carries out second and takes turns PCR amplifications, comprises the following steps that：50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ
L2.5mM dNTP, the PCR primer that the 2.0 μ l first round diluted, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO:5 Hes
Each 2.0 μ l of AUAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing
30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min.Second of PCR primer (QIAquick PCR
Purification Kit are purified, purchased from Qiagen) 3u1 is connected to pGEM-T Easy Vector, is transformed into Escherichia coli
JM109 (specific method is ibid), random 10 white colonies of picking are in the LB fluid nutrient mediums containing 50ug/mL ampicillins
Glycerol adding is to final concentration 20% after middle culture, 37 DEG C of overnight incubations, and -80 DEG C save backup.SEQ ID NO:5 and 3 ' end primers
AUAP carries out bacterium solution PCR amplification (50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l
Bacterium solution, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO:Each 2.0 μ l of 5 and AUAP, and 35 μ l distilled water.PCR reacts
Condition：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extensions
10min), 4 positive colonies are obtained, send Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced, the 3 ' of the cDNA of the gene are obtained
End.
According to the GhAVP1-2 genetic fragments obtained, three specific primers are designed, it is special as 5 ' RACE 3 ' ends
Specific primer：
GhAVP1-2GSP4：SEQ ID No：6：
TCACAAAGGC ACCAAATAGA GCC
GhAVP1-2GSP5：SEQ ID No：7：
CAATGGCAAA TCCCTTTCCA ATG
GhAVP1-2GSP6：SEQ ID No：8：
TCCAGCATTG TCACTGATGG GACC
Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification
CDNA Ends kits, purchased from invitrogen companies).SEQ ID No：6 as mRNA reverse transcriptions into cDNA primer.
With SEQ ID NO：7 and 5 ' universal primer AAP (kit is carried), with the cDNA of mRNA reverse transcriptions, (reverse transcription is drawn
Thing SEQ ID NO:6) amplification of first round PCR is carried out for template, comprised the following steps that：Ex Taq are purchased from TAKARA, 50 μ l PCR
Reaction system：The cDNA, 1.0 μ l Ex of 5 μ 10 × Ex of l μ l total serum IgE reverse transcriptions of Buffer, 3 μ l 2.5mM dNTP, 2.0
Taq, 10 μM of primer SEQ ID NO:Each 2.0 μ l of 7 and AAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min.
The PCR primer of gained takes 2.0 μ l as template after diluting 100 times with distilled water, with SEQ ID NO:8 draw with 3 ' ends
Thing AUAP carries out second and takes turns PCR amplifications, comprises the following steps that：50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ
L2.5mM dNTP, the PCR primer that the 2.0 μ l first round diluted, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO:8 Hes
Each 2.0 μ l of AUAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing
30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min.Second of PCR primer (QIAquick PCR
Purification Kit are purified, purchased from Qiagen) 3u1 is connected to pGEM-T Easy Vector, is transformed into JM109 (specific
Method is ibid), random 10 white colonies of picking are cultivated in the LB fluid nutrient mediums containing 50ug/mL ampicillins, and 37
Glycerol adding is to final concentration 20% after DEG C overnight incubation, and -80 DEG C save backup.SEQ ID NO:8 and 3 ' end primer AUAP carry out bacterium
Liquid PCR expands (50 μ l PCR reaction systems：5 μ 10 × Ex of l Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l bacterium solutions, 1.0 μ l
Ex Taq, 10 μM of primer SEQ ID NO:Each 2.0 μ l of 8 and AUAP, and 35 μ l distilled water.PCR reaction conditions：94 DEG C pre-
It is denatured 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min), obtain 4
Positive colony, send Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced, and obtains the cDNA of the gene 5 ' ends.
After 5 ' the RACE product clonings sequencing of gained, splice with 3 ' RACE products sequencing results.Obtain GhAVP1-2 total lengths
CDNA sequence.Pair of primers is designed according to GhAVP1-2 full length cDNA sequences as follows：
GhAVP1-2F：SEQ ID No：9：
ATGGGGGCGGCGATGTTGTCGGAG
GhAVP1-2R：SEQ ID No：10：
CTAAAAGATC TTGAAGAGTA GACCACC
Pass through SEQ ID No：9 and SEQ ID No：10 clone GhAVP1-2 full length genes.
Using TaKaRa PrimeSTAR HS archaeal dna polymerases, performing PCR reaction is entered by template of the cDNA of cotton.50μl
PCR reaction systems：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 cDNA, 1.0 μ l PrimeSTAR, 10 μM
Primer SEQ ID No：9 and SEQ ID No：10 each 2.0 μ l, 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, after 33 circulations；72 DEG C of extension 10min.
Pcr amplification product adds A.Above-mentioned PCR primer is added to 2.5 times of absolute ethyl alcohol, -20 DEG C are placed 10 minutes, centrifugation is gone
Supernatant, dries, and is dissolved with 21 μ l distilled waters.Addition 10 × Ex of 2.5ul Buffer, 0.5ul 5mM dATP, 2.5ul 10 ×
Ex Taq.Reaction condition：70 DEG C are reacted 30 minutes.The DNA fragmentation for obtaining about 2300bp is reclaimed into (Omega QIAquick Gel Extraction Kits),
It is connected to pGEM T-easy carriers (being purchased from Promega kits), conversion JM109 (method is ibid), random 10 whites of picking
Bacterium colony is cultivated in the LB fluid nutrient mediums containing 50ug/mL ampicillins, and glycerol adding is to final concentration after 37 DEG C of overnight incubations
20%, -80 DEG C save backup.SEQ ID NO:9 and SEQ ID NO:10 carry out bacterium solution PCR amplifications (using TaKaRa's
PrimeSTAR HS archaeal dna polymerases, bacterium solution enters performing PCR reaction.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l
2.5mM dNTP, 2.0 μ l bacterium solutions, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID No：9 and SEQ ID No：10 is each
2.0 μ l, 30 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C are prolonged
2min is stretched, after 33 circulations；72 DEG C of extension 10min.) 3 positive colonies are obtained, send Invitrogen (Shanghai) Trading Co., Ltd.
Sequencing, sequence is SEQ ID NO:2.Its protein expression sequence is SEQ ID NO：1.
GhAVP1-2 amino acid sequence：SEQ ID No：1
The nucleotide sequence of GhAVP1-2 encoding genes：SEQ ID No：2
The GhAVP1-2 gene plant expression vector establishments of embodiment 3
It is as shown in Figure 1 that plant expression vector rd29A-GhAVP1-2-2300 builds flow.
Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd)
As plant expression vector, the 35S promoter that NPTII genes contain double enhancers is replaced with Pnos promoters, to reduce NPTII eggs
Expression in plant in vain.Inducible promoter rd29A and Tnos is selected as the promoter and terminator of GhAVP1-2 genes.
Specific steps are summarized as follows：
SEQ ID NO:11 and SEQ ID NO:12 (have with plant expression vector PBI121 purchased from Beijing China ocean science and technology
Limit company) it is template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10μ
5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 1.0 PBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID
NO:11 and SEQ ID NO:12 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of changes
Property 30s, 56 DEG C annealing 30s, 72 DEG C extension 30s, 33 circulation；72 DEG C of extension 10min.PCR primer passes through EcoRI, BglII
(being purchased from New England Biolabs) digestion is connected to pCAMBIA2300 and obtains pCAMBIA2300-1, coupled reaction condition
See step shown in promega T4 ligase boxes.
SEQ ID NO:11：
GCAC GAATTC ATACAAATGGACGAACGGAT
SEQ ID NO:12：
ATCC AGATCT AGATCCGGTGCAGATTATTTG
SEQ ID No：13 and SEQ ID No：14 using PBI121 as template amplification Tnos, using TaKaRa's
PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM dNTP, 1.0
μ l PBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO:13 and SEQ ID NO:14 each 2.0 μ l, and 31 μ
L distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 33
Circulation；72 DEG C of extension 10min.PCR primer is connected to by SacI, EcoRI (being purchased from New England Biolabs) digestion
PCAMBIA2300-1 obtains pCAMBIA2300-2, and coupled reaction condition is step shown in promega T4 connection enzyme reagent kits.
SEQ ID No：13：
AAGGAGCTCGAATTTCCCCGATCGTTCAAA
SEQ ID No：14：
TCAGAATTC CCAGTGAATT CCCGATCTAG TA
SEQ ID NO:15 and SEQ ID NO:16 with arabidopsis, (Colombia's type, is purchased from
With reference to Zeng J., et L.2002, www.arabidopsis.org) DNA is template (Preparation of total DNA
from“recalcit rant plant taxa”,Acta Bot.Sin.,44(6):Method in 694-697 extracts arabidopsis
DNA arabidopsis rd29A promoters) are expanded.Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reactants
System：10 μ 5 × PS of l μ l arabidopsis of Buffer, 3 μ l 2.5mM dNTP, 1.0 DNA, 1.0 μ l PrimeSTAR, 10 μM draw
Thing SEQ ID NO:15 and SEQ ID NO:16 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 33 circulations；72 DEG C of extension 10min.PCR primer passes through
HindIII, SalI (being purchased from New England Biolabs) digestion is connected to pCAMBIA2300-2 and obtains pCAMBIA2300-
3, coupled reaction condition is step shown in promega T4 connection enzyme reagent kits.
SEQ ID No：15：
ACTAAGCTT CCTTCTTGACATCATTCAATTTTA
SEQ ID No：16：
TGAgtcgacTCCAAAGATT TTTTTCTTTC CAATAG
SEQ ID No：17 and SEQ ID No：18 amplification AVP1-2 genes, (template is that embodiment 2 is contained
The pGEM T-easy recombinant vectors of AVP1-2 genes), using TaKaRa PrimeSTAR HS archaeal dna polymerases.50μl PCR
Reaction system：10 μ 5 × PS of l μ l of Buffer, 3 μ l 2.5mM dNTP, 1.0 AVP1-2-pGEM, 1.0 μ l PrimeSTAR,
10 μM of primer SEQ ID NO:17 and SEQ ID NO:18 each 2.0 μ l, and 31 μ l distilled water.PCR reaction conditions：94℃
Pre-degeneration 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min.PCR is produced
Thing is connected to pCAMBIA2300-3 by SalI, SacI (being purchased from New England Biolabs) digestion, obtains plant expression
Carrier rd29A-GhAVP1-2-2300, coupled reaction condition is step shown in promega T4 connection enzyme reagent kits.
SEQ ID No：17：
TGAGTCGAC ATGGGGGCGGCGATGTTGTCGGAG
SEQ ID No：18：
AAGGAGCTC CTAAAAGATC TTGAAGAGTA GACCACC
The rd29A-GhAVP1-2-2300 expression vectors of embodiment 4 convert Agrobacterium
It is prepared by Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competent cell：1-2d will in advance
Agrobacterium LBA4404 is in LB solid mediums flat board (the LB fluid nutrient mediums containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins
It is middle add 1.5% agar) on draw single spot inoculation, 28 DEG C of cultures 1 to 2d.Picking single bacterium colony is inoculated in 5ml containing the sharp good fortune of 50 μ g/ml
It is 0.4 that overnight incubation (about 12-16h) to OD600 values are shaken in the LB fluid nutrient mediums of gentle 50 μ g/ml streptomysins, at 28 DEG C,
Form seed bacterium solution.Take the bacterium solution (1 after 5ml activation:20 ratio) it is inoculated in the LB liquid training of the same concentration antibiotic of 100ml
Support in base, 28 DEG C are shaken culture 2-2.5h to OD600=0.8.Ice bath bacterium solution 10min, shakes up once every 3min, makes bacterium equal
Even entrance resting state.10min is centrifuged in 4000g at 4 DEG C, supernatant is abandoned；Add certain glycerine resuspension bacterium of head for precooling 10%
Body, 4000g centrifugations 10min, collects precipitation at 4 DEG C；Repeated to wash 3-4 times with 10% glycerine；Add the 10% of appropriate ice bath precooling
Again suspended bacterial is precipitated glycerine, is dispensed, is saved backup in -70 DEG C with 40 μ l/ pipes.
Convert Agrobacterium：Melt above-mentioned Agrobacterium LBA4404 competent cell on ice, into 40 μ l competent cell
Add expression vector establishment rd29A-GhAVP1-2-2300, ice bath about 10min after mixing prepared by 1 μ l embodiment 3.Will be upper
State mixture to be transferred in the electric shock of precooling cup with rifle, rapping makes mixture reach bottom, has been careful not to bubble.To be shocked by electricity cup
(being purchased from bio-rad, model Micropulser) is put on the slideway of electroporation chamber, promotes slideway to put electric shock cup to electroporation chamber base
At seat electrode.Using 0.1cm electric shock cup, MicroPulser (being purchased from bio-rad) program is set to " Agr ", electric shock one
It is secondary.Take out immediately in electric shock cup, the LB fluid nutrient mediums for adding 28 DEG C of preheatings.It is quickly soft to be beaten cell with rifle.Will
Above-mentioned suspension is transferred to 1.5ml centrifuge tube, 28 DEG C, 225rpm cultures 1h.Take 100-200 μ l bacterium solution to be coated with corresponding to resist
Property screening and culturing medium (LB solid mediums, containing 50 μ g/ml rifampins, 50 μ g/ml streptomysins, 50 μ g/ml kanamycins) flat board
On, 28 DEG C of cultures.
Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method
With 75% alcohol-pickled tobacco, (countries tobacco mid-term storehouse obtains tobacco institute of unit the Chinese Academy of Agricultural Sciences, storehouse numbering
I5A00660) seed 30s, then 8min is soaked with 0.1% mercuric chloride, carry out surface sterilization.Sterilized tobacco seed is placed in MS
Solid medium (18.78mM KNO3, 1.25mM KH2PO4, 20.6mM NH4NO3, 1.5mM MgSO4, 3.0mM CaCl2, 50 μ
M KI, 100 μM of H3BO3, 100 μM of MnSO4, 30 μM of ZnSO4, 1 μM of Na2MoO4, 0.1 μM of CoCl2, 100 μM of Na2EDTA,
100μM FeSO4, 7.4g/L agar, sucrose 30g/L) on aseptic germination, prepare aseptic seedling.Take tests for sterility be cut into 5mm ×
The leaf dish of 5mm sizes, with the During Agrobacterium leaf dish 10min containing expression vector that exponential phase is in embodiment 4, is blotted
Bacterium solution, co-cultures 2 days (MS solid mediums) under dark condition；And not to be used as control leaf by the leaf dish of During Agrobacterium
Piece.The blade of During Agrobacterium is gone into differential medium (MS solid medium+1mg/L BA+0.1mg/L NAA+50mg/L
Kanamycins+500mg/L cephalosporins) on, cultivated 45 days or so under illumination condition, cut after bud is grown up and be transferred to training of taking root
Culture 30 days or so in base (MS solid medium+50mg/L kanamycins+500mg/L cephalosporins) is supported, after after well developed root system
Seedling is transferred on the MS solid mediums only added with 500mg/L cephalosporins.Meanwhile, control blade is gone into differential medium
On (MS solid medium+1mg/L BA+0.1mg/L NAA+50mg/L kanamycins+500mg/L cephalosporins), illumination condition
It is lower culture 45 days or so, cut after bud is grown up be transferred to root media (MS solid medium+50mg/L kanamycins+
500mg/L cephalosporins) in culture 30 days or so, after seedling is transferred to only added with 500mg/L cephalosporins after well developed root system
On MS solid mediums.
Take the small seedling leaf of tobacco of During Agrobacterium, extract genomic DNA (arabidopsis DNA extraction sides in be the same as Example 3
Method) after, with primer SEQ ID No：17 and SEQ ID No：18 enter performing PCR identification, and (Ex Taq are purchased from TAKARA, and 50 μ l PCR are anti-
Answer system：5 μ 10 × Ex of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ
ID NO:17 and SEQ ID No：18 each 2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degeneration 5min；94
DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 2min, 33 circulation；72 DEG C of extension 10min), 20 plants of successful conversions of selection
Transgene tobacco numbers into T0M1-T0M20。
Sterilized vermiculite is impregnated with 1/2MS culture mediums, by above-mentioned culture T0M1-T0M20 transgene tobaccos seedling and control
Seedling is transplanted on the vermiculite, 25 DEG C, optical culture/14 hour light culture circulation in 10 hours, pours a 1/2MS within every 5 days.About
Seed is obtained after 60 days.
Embodiment 6 is overexpressed drought resisting simulated experiment and the Function Identification in GhAVP1-2 transgene tobacco T1 generations
Sterilized vermiculite is impregnated with 1/2MS culture mediums.By T0For transgene tobacco T0N1、T0N2、T0N3、T0N4 and T0N5
Seed and control tobacco seed sow respectively on vermiculite, 25 DEG C, optical culture/14 hour light cultures circulation in 10 hours, every 5
It pours a 1/2MS, after culture 25 days, wins bottom leaf, extracts genomic DNA (arabidopsis in be the same as Example 3
DNA extraction method), utilize primer SEQ ID NO：17 and SEQ ID NO：18 do PCR identifications, and (Ex Taq are purchased from TAKARA, 50 μ
L PCR reaction systems：5 μ 10 × Ex of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 DNA, 1.0 μ l Ex Taq, 10 μM
Primer SEQ ID NO:17 and SEQ ID No：18 each 2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min), reject negative plant
Strain (control tobacco similarly wins leaf).Picking transgene tobacco (T of the same size1N1、T1N2、T1N3、T1N4 and
T1Each 10 plants of N5, numbering is T respectively1N1-1 to T1N1-10、T1N2-1 to T1N2-10、T1N3-1 to T1N3-10、T1N4-1 is extremely
T1N4-10 and T1N5-1 to T1N5-10), compareing tobacco, (10 plants, numbering is that 10) control 1 to control does drought-enduring experiment.Transgenosis
Tobacco, arid 14 days (not the watering) of control tobacco, 25 DEG C, optical culture/14 hour light culture circulation in 10 hours.Then take out plant
Plant is weighed.Above-mentioned T1Show for the Identification of Drought of transfer-gen plant, adjoining tree is all wilted seriously, and transgenosis
Plant can normal growth, show obvious drought resistance (referring to Fig. 3 and table 1).In figure 3, transfer-gen plant is chosen
T1N1-3 and the control exemplary display of tobacco 9, the result of other tobaccos are similar with them.
Embodiment 7 is overexpressed salt resistance simulated experiment and the Function Identification in GhAVP1-2 transgene tobacco T1 generations
Sterilized vermiculite is impregnated with 1/2MS culture mediums.By T0For transgene tobacco T0N1、T0N2、T0N3、T0N4 and T0N5
Seed and control tobacco seed sow respectively on vermiculite, 25 DEG C, optical culture/14 hour light cultures circulation in 10 hours, every 5
It pours a 1/2MS, after culture 25 days, wins bottom leaf, extracts genomic DNA (arabidopsis in be the same as Example 3
DNA extraction method), utilize primer SEQ ID NO：17 and SEQ ID NO：18 do PCR identifications, and (Ex Taq are purchased from TAKARA, 50 μ
L PCR reaction systems：5 μ 10 × Ex of l μ l of Buffer, 3 μ l 2.5mM dNTP, 2.0 DNA, 1.0 μ l Ex Taq, 10 μM
Primer SEQ ID NO:17 and SEQ ID No：18 each 2.0 μ l, and 35 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations
5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 33 circulations；72 DEG C of extension 10min), reject negative plant
Strain (control tobacco similarly wins leaf).Picking transgene tobacco (T of the same size1N1、T1N2、T1N3、T1N4 and
T1Each 10 plants of N5, numbering is T respectively1N1-11 to T1N1-20、T1N2-11 to T1N2-20、T1N3-11 to T1N3-20、T1N4-11
To T1N4-20 and T1N5-11 to T1N5-20), compareing tobacco, (10 plants, numbering is that 20) control 11 to control does salt tolerant experiment, is poured
100mM NaCl are filled, 25 DEG C, optical culture/14 hour light culture circulation in 10 hours observe result after 14 days：T1For transfer-gen plant
Salt-Tolerance Identification show that adjoining tree is all unable to normal growth, growth is substantially suppressed, and transfer-gen plant grow it is all bright
It is aobvious to be higher than adjoining tree, show obvious salt tolerance (referring to Fig. 4 and table 1).In Fig. 4, transfer-gen plant T is chosen1N4-12
With the control exemplary display of tobacco 12, the result of other tobaccos is similar with them.
Claims (13)
1. a kind of albumen, the albumen is cotton AVP1 albuminoids, its sequence is SEQ ID NO：1.
2. encode the nucleotide sequence of the albumen described in claim 1.
3. the nucleotide sequence described in claim 2, it is characterised in that with SEQ ID NO:Nucleotide sequence shown in 2.
4. a kind of recombinant expression carrier, its contain the nucleotide sequence described in Claims 2 or 3 and the nucleotide sequence with
The expression control sequence of the expression vector is operably connected.
5. the recombinant expression carrier described in claim 4, wherein the carrier is the rd29A-GhAVP1-2- shown in Fig. 2
2300 carriers.
6. a kind of recombinant cell, it contains the restructuring described in gene order or claim 4 or 5 described in Claims 2 or 3
Expression vector.
7. the recombinant cell described in claim 6, wherein the recombinant cell is restructuring agrobatcerium cell.
8. a kind of method of improvement plant salt endurance and/or drought resistance, including：By the nucleotide sequence described in Claims 2 or 3
Or the recombinant expression carrier described in claim 4 or 5 imports plant or plant tissue and makes the gene expression.
9. the method described in claim 8, wherein the plant is tobacco.
10. a kind of method of prepare transgenosis plant, including：Culture contains claim 2 under conditions of plant is effectively produced
Or plant or the plant tissue of the recombinant expression carrier described in the nucleotide sequence or claim 4 or 5 described in 3.
11. the method described in claim 10, wherein the plant is tobacco.
12. the nucleotide sequence described in albumen, Claims 2 or 3, the weight described in claim 4 or 5 described in claim 1
Recombinant cell described in group expression vector or claim 6 or 7 is used to improve plant salt endurance and drought resistance and for planting
The purposes of thing breeding.
13. the purposes described in claim 12, wherein the plant is tobacco.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2012/076617 WO2013181832A1 (en) | 2012-06-08 | 2012-06-08 | Cotton avp1 protein and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103842376A CN103842376A (en) | 2014-06-04 |
| CN103842376B true CN103842376B (en) | 2017-07-21 |
Family
ID=49711300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201280001632.9A Expired - Fee Related CN103842376B (en) | 2012-06-08 | 2012-06-08 | Cotton AVP1 albumen and its encoding gene and application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103842376B (en) |
| WO (1) | WO2013181832A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929492B (en) * | 2016-01-15 | 2020-03-20 | 中国林业科学研究院 | Tangut white spine blister H+-PPase protein gene NtVP1, encoding protein and cloning method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002485A (en) * | 2010-10-26 | 2011-04-06 | 复旦大学 | Pyrophosphatase of ammopiptanthus mongolicus, and coding gene and application thereof |
-
2012
- 2012-06-08 WO PCT/CN2012/076617 patent/WO2013181832A1/en active Application Filing
- 2012-06-08 CN CN201280001632.9A patent/CN103842376B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002485A (en) * | 2010-10-26 | 2011-04-06 | 复旦大学 | Pyrophosphatase of ammopiptanthus mongolicus, and coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Expression of an Arabidopsis vacuolar H+-pyrophosphatase gene(AVP1) in cotton improves drought- and slat tolerance and increases fibre yield in the field conditions;Vijaya Pasapula et al.;《Plant Biotechnology Journal》;20110131;第49卷(第8期);88-99 * |
| Properties of cotton inorganic pyrophosphatase;B. O. Beknazarov et al.;《Applied biochemistry and microbiology》;20070430;第43卷(第2期);第157页左栏第3段 * |
| Some characteristics of cotton pryophosphatase activation by magnesium;B. O. Beknazarov et al.;《 Russian Journal of Plant Physiology》;20060131;第53卷(第1期);摘要部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2013181832A1 (en) | 2013-12-12 |
| CN103842376A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103620039B (en) | Hkt protein of cotton and encoding gene thereof and application | |
| CN103842376B (en) | Cotton AVP1 albumen and its encoding gene and application | |
| CN105452272A (en) | Calcineurin b-like protein cbl-3 from cotton, and coding gene and use thereof | |
| CN105073773B (en) | A kind of small salt mustard tonoplast pyrophosphatase VP1 and its encoding gene and application | |
| CN105026565B (en) | One cotton ion channel albuminoid and its encoding gene and application | |
| CN105026564B (en) | Cotton ion channel albuminoid and its encoding gene and application | |
| CN103842377B (en) | Cotton AVP1 albumen and its encoding gene and application | |
| CN104379746B (en) | One cotton ion channel albuminoid and its encoding gene and application | |
| CN103619872B (en) | A kind of AVP1 albumen of cotton and its encoding gene and application | |
| CN105408349B (en) | A kind of Bruguiera conjugata molybdenum cofactors vulcanization enzyme MCSU and its encoding gene and application | |
| CN104884619B (en) | A kind of cotton isopentene group transferase I PT2 and its encoding gene and application | |
| CN105189535A (en) | Transporter HKT2 with high affinity for potassium ions and which is derived from cotton and the coding gene and use thereof | |
| CN105121458B (en) | A kind of Bruguiera conjugata betaine aldehyde dehydrogenase BADH and its encoding gene and application | |
| CN103703020B (en) | A DREB1 classes transcription factor for cotton and its encoding gene and application | |
| CN105452453A (en) | Thellungiella halophila calcineurin b-like protein cbl-4, coding gene of same, and application thereof | |
| CN105008386B (en) | A kind of small salt mustard tonoplast sodium hydrogen antiporter protein NHX2 and its encoding gene and application | |
| CN105008538B (en) | A kind of cotton isopentene group transferase I PT3 and its encoding gene and application | |
| CN105073984B (en) | A kind of cotton ATP hydrolase As TPase 1 and its encoding gene and application | |
| CN105026563B (en) | One cotton protein kinase and its encoding gene and application | |
| CN105073993B (en) | A kind of cotton molybdenum cofactors vulcanization enzyme MCSU 1 and its encoding gene and application | |
| CN105408350B (en) | A kind of Avicennia marina monooxygenase CMO and its encoding gene and application | |
| CN105102622B (en) | A kind of cotton zeaxanthin epoxidase ZEP 1 and its encoding gene and application | |
| CN105073771B (en) | A kind of small salt mustard tonoplast sodium hydrogen antiporter protein NHX1 and its encoding gene and application | |
| CN103842375B (en) | A DREB1 classes transcription factor for cotton and its encoding gene and application | |
| CN105073774B (en) | A kind of cotton leucine zipper protein bZIP-2 and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Applicant after: Biocentury Seed Industry Co., Ltd. Address before: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Applicant before: Biocentury Transgene Co., Ltd. |
|
| COR | Change of bibliographic data | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: 518117 7th floor, Chuangshi seed industry building, A701, No.22, Puzi Road, Pingdi street, Longgang District, Shenzhen, Guangdong Province Patentee after: Biocentury Seed Industry Co., Ltd. Address before: 518048, the 308 tower of Oriental Pearl science and technology building, Sha Mo Industrial Zone, Shenzhen, Guangdong, Futian District, 4 Patentee before: Biocentury Seed Industry Co., Ltd. |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170721 Termination date: 20200608 |