CN105073771B

CN105073771B - A sodium-hydrogen antiporter protein NHX1 and its coding gene and application

Info

Publication number: CN105073771B
Application number: CN201380074515.XA
Authority: CN
Inventors: 王建胜; 王君丹; 陈淼; 梁丽
Original assignee: BIOCENTURY TRANSGENE (CHINA) CO LTD
Current assignee: BIOCENTURY TRANSGENE (CHINA) CO LTD
Priority date: 2013-04-22
Filing date: 2013-04-22
Publication date: 2018-03-09
Anticipated expiration: 2033-04-22
Also published as: CN105073771A; WO2014172824A1

Abstract

A tonoplast sodium-hydrogen antiporter NHX1 from Halona salina and its encoding gene, as well as its use in breeding transgenic plants with improved salt tolerance.

Description

A kind of small salt mustard tonoplast sodium hydrogen antiporter protein NHX1 and its encoding gene with Using

Technical field

The present invention relates to vegetable protein and its encoding gene and application, more particularly to a vacuole for deriving from small salt mustard Film sodium hydrogen antiporter protein NHX1 and its encoding gene, and its answering in the genetically modified plants for cultivating salt tolerance raising With.

Background technology

Salt stress is that world agriculture produces one of most important abiotic stress harm, and salt-affected soil is generally with sodium salt, calcium Based on salt or magnesium salts, turn into the principal element for influenceing plant growth, causing grain and the industrial crops underproduction.Saline-alkali soil in the world Area there are about 400,000,000 hectares, account for the 1/3 of irrigated farmland.Salt-soda soil is extensive in distribution in China, and existing saline alkali land area about 0.4 hundred million is public Hectare.As China human mortality increases, the decrease of cultivated land, the utilization of saline alkali land resource have extremely important realistic meaning.And plant Thing salt resistance alkali, the raising of Drought resistance and suitably in saline and alkaline aerial and plant species with higher economy and the ecological value Or the seed selection of strain, then it is to utilize the economical and effective measure in salt-soda soil.For most crops, most plants pair Saline and alkaline, arid poor resistance, it can only be grown on the soil that sodium chloride content is less than 0.3%, excessive Na in soil⁺Meeting Toxic action is produced to the normal growth metabolism of plant.Therefore crop yield how is improved under salt marsh environment just turns into complete The problem of particularly significant in world agriculture production.

The salt tolerance of plant is a sufficiently complex quantitative character, its Mechanisms of Salt Resistance is related to from plant to organ, tissue, Physiology and biochemistry is until each level of molecule.The scientist of various countries has also done substantial amounts of work for this, and achieves and much newly enter Exhibition, especially in terms of using salt tolerant molecule mechanism of the high model plant arabidopsis to study plant, makes the research in the field have Breakthrough progress (Zhu JK.2002.Salt and drought stress singal transduction in plants.Annu.Rev.Plant Biol.53：1247-1273；Zhang ZL.2011.Arabidopsis Floral Initiator SKB1Confers High Salt Tolerance by Regulating Transcription and Pre-mRNA Splicing through Altering Histone H4R3and Small Nuclear Ribonucleoprotein LSM4Methylation.Plant Cell, 23：396-411).Higher plant cell can have a variety of Approach experiences the change of physico-chemical parameter in external environment, so as to which extracellular signal is changed into intracellular signal, passes through the signal of series Stress signal is finally transferred in nucleus by conduction, activating transcription factor, and activating transcription factor is remake for functional gene, Start the expression of induced gene in adversity so as to improving the resistance of reverse of plant.Although researcher never carried out and largely ground by ipsilateral Study carefully, but because its mechanism is sufficiently complex, many major issues in plant anti-salt still need to be explored.For example, the pass of plant anti-salt The key factor is not found yet；The molecular mechanism of plant salt tolerance is not fully aware of.

The content of the invention

The method clone that the present inventor is combined using SSH (Subtractive hybridization) with RACE (cDNA ends rapid amplifying) The encoding gene of a tonoplast sodium hydrogen antiporter protein (being named as NHX1 herein) for small salt mustard, and determine its DNA Sequence.And it was found that after being conducted into plant by transgenosis, it can obviously improve the salt tolerance of transfer-gen plant, and these property Shape can stablize heredity.

First aspect present invention provides a tonoplast sodium hydrogen antiporter protein NHX1 for small salt mustard encoding gene (this Text is named as ThNHX1), its sequence is SEQ ID NO：2.

Second aspect of the present invention provides a kind of recombinant expression carrier, and it contains the gene described in first aspect present invention, its A kind of expression vector is inserted into by the gene to obtain, it is preferable that the expression vector is pCAMBIA2300；And And the nucleotide sequence of the gene is operably connected with the expression control sequence of the recombinant expression carrier；Preferably, institute Recombinant expression carrier is stated as the 35S-ThNHX1-2300 carriers shown in accompanying drawing 2.

Third aspect present invention provides a kind of recombinant cell, and it contains gene or this hair described in first aspect present invention Recombinant expression carrier described in bright second aspect；Preferably, the recombinant cell is restructuring agrobatcerium cell.

Fourth aspect present invention provides a kind of method for improving plant salt endurance, including：By described in first aspect present invention Recombinant expression carrier described in gene or second aspect of the present invention imports plant or plant tissue and makes the gene expression；It is excellent Selection of land, the plant are arabidopsis.

Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：Effectively producing the condition of plant It is lower culture the plant containing gene described in first aspect present invention or the recombinant expression carrier described in second aspect of the present invention or Plant tissue；Preferably, the plant is arabidopsis.

Sixth aspect present invention provides the gene described in first aspect present invention, the restructuring table described in second aspect of the present invention It is used to improve plant salt endurance and use for plant breeding up to the recombinant cell described in carrier or third aspect present invention On the way；Preferably, the plant is arabidopsis.

Seventh aspect present invention is provided as the protein of the gene code described in first aspect present invention, its amino acid sequence Such as SEQ ID NO：Shown in 1.

Brief description of the drawings

Fig. 1 is plant expression vector (35S-ThNHX1-2300) the structure flow (Fig. 1 a-1b) of NHX1 genes.

Fig. 2 is the plasmid figure of the plant expression vector (35S-ThNHX1-2300) of NHX1 genes.

Fig. 3 is the test plant arabidopsis of culture.

Fig. 4 is salt tolerant experimental results of the T1 for plant of ThNHX1 transgenic arabidopsis, and T1a4 shows obvious salt tolerant Property, T1a17, T1a19 result are similar with its, are not shown here.

Fig. 5 is to T using reverse transcription PCR₁For ThNHX1 genes in transgenic tobacco plant and non-transgenic reference plant Transcriptional level carry out molecular level detection result.M is DNALadder Marker (DL2000), and 1-4 is pair of not salt tolerant According to Arabidopsis plant, 13 be plasmid PCR positive control (35S-ThNHX1-2300 plasmids), and 5-12 is that salt tolerant T1 intends for transgenosis Southern mustard plant.

Embodiment

Following examples are provided, to facilitate those skilled in the art to more fully understand the present invention.The embodiment merely for Exemplary purpose, it is not intended to limit the scope of the present invention.

The restriction enzyme in the unreceipted source mentioned in example below is purchased from New England Biolabs public affairs Department.

Small salt mustard SSH library constructions under the salt stress of embodiment 1.：

Specific method is：

According to the PCR-select of Clontech companies^TMShown in cDNA Subtraction Kit kit specifications Method builds SSH libraries (subtracted library) by Subtractive hybridization method.With salt treatment in growth course in experimentation Small salt mustard tissue in the mRNA that extracts be used as sample (Tester), the mRNA extracted in being organized using untreated small salt mustard as Compare (Driver).Comprise the following steps that：

(1) material to be tested：

Small salt mustard (Thellungiella halophila, it is green purchased from inner mongolia Ba Yan Nor City carex meyeriana Color botanical garden halophytes Breeding Center) be seeded on the vermiculite of sterilizing, 22 DEG C, 12 hours photoperiods illumination/12 hour it is black Secretly cultivated under the conditions of (light intensity 3000-4000Lx), pour 1/2MS culture mediums weekly (containing 9.39mM KNO₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM of KI, 100 μM of H₃BO₃, 100 μM of MnSO₄, 30 μM ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM of FeSO₄) once.When plant diameter reaches It is used to test during 5-6cm.

(2) material process：

2 groups will be divided into for examination plant, every group of 4 basins, per 3 plants of basin.First group is control group, is normally poured with 1/2MS；The Two groups are salt treatment group, pour the 1/2MS solution containing 300mM NaCl, by two groups of plants 22 DEG C, 12 small time of photoperiod According to culture processing under the conditions of/12 hours dark (light intensity 3000-4000Lx) 10 days, two groups of plant were then collected in time (with distillation Water cleans root), after liquid nitrogen quick freeze, preserved in -70 DEG C of refrigerators.

(3) Total RNAs extraction：

Control group and the small salt mustard 3.0g of salt treatment group are taken respectively, (are purchased from plant RNA extraction kit Invitrogen total serum IgE) is extracted.With the ultraviolet specrophotometer U-2001 measure gained total serum IgEs of HITACHI companies in 260nm With 280nm absorbance, OD₂₆₀/OD₂₈₀Ratio is 1.8-2.0, shows that total serum IgE purity is higher, is coagulated with 1.0% agarose Gel electrophoresis detect the integrality of total serum IgE, and the brightness of 28S bands is about 2 times of 18S bands, shows that RNA integrality is good.Make MRNA is separated with the Oligotex mRNA purification kits (polyA+RNA is purified from total serum IgE) of Qiagen companies.

(4) Subtractive hybridization：

By the PCR-select of Clontech companies^TMSide shown in cDNA Subtraction Kit kit specifications Method carries out Subtractive hybridization.Driver mRNA and Tester mRNA are first distinguished into reverse transcription, obtain double-strand cDNA, then with 2 μ G Tester cDNA and 2 μ g Driver cDNA carry out subtractive hybridization as parent material.Respectively will under 37 DEG C of water-baths Tester cDNA and Driver cDNA Rsa I digestions 1.5 hours, are then divided into two etc. by the Tester cDNA after digestion Part, different joint in connection, and Driver cDNA are not connected to head.Two kinds of Tester cDNA for being connected with different joints respectively with Excessive Driver mixing, carry out positive subtractive hybridization for the first time.By two kinds of first times, the product of positive subtractive hybridization mixes, then Second of positive subtractive is carried out with the Driver cDNA being newly denatured to hybridize, and enrichment differential expression is expanded by inhibition PCR twice The fragment of gene (before PCR is carried out, second of positive subtractive hybrid product carries out end-filling).

(5) structure of subtracted library and preliminary screening, clone, identification

According to the specification of pGEM-T Easy kits (being purchased from Promega), second of positive subtractive is hybridized Second of inhibition pcr amplification product of cDNA fragments (is purified using QIAquick PCR Purification Kit, is purchased from Qiagen) it is connected with pGEM-T Easy carriers, it is comprised the following steps that：Following ingredients are sequentially added in 200 μ l PCR pipes： Second of μ l of PCR primer 3, the μ l of 2 × T4 ligase buffer solutions 5, μ l of pGEM-T Easy carriers 1, the μ l of T4DNA ligases 1 are purified, In 4 DEG C of connections overnight.Then 10 μ l coupled reaction products are taken, 100 μ l competence e. coli jm109s is added to and (is purchased from TAKARA in), ice bath 30 minutes, 42 DEG C of heat shocks 60 seconds, ice bath 2 minutes, separately plus 250 μ l LB fluid nutrient mediums (contain 1% Tryptone (Tryptone, purchased from OXOID), 0.5% yeast extract (Yeast Extract, purchased from OXOID) and 1% NaCl (being purchased from traditional Chinese medicines)) after be placed in 37 DEG C of shaking tables, with 225rpm shaken cultivations 30 minutes, then therefrom take 200 μ l bacterium solutions to connect Kind is (different in LB (being same as above)/X-gal (the chloro- 3- indoles-β-D- galactosides of 5- bromo- 4)/IPTG containing 50 μ g/ml ampicillins Propyl group-β-D- Thiogalactopyranosides) on (X-gal/IPTG is purchased from TAKARA) culture plate, 37 DEG C are cultivated 18 hours.Count Diameter ＞ 1mm clear white and blue colonies, random 450 white colonies of picking (numbering in culture plate：Th-S001 to Th- S450).Institute picking white colony clone is inoculated in 96 porocyte culture plates (CORNING) and contains 50 μ g/ml ammonia benzyl moulds The LB fluid nutrient mediums of element, glycerol adding to final glycerol concentration be 20% (volume ratio) after 37 DEG C of overnight incubations, is then protected in -80 DEG C Deposit standby.To the colony clone cultivated with nest-type PRC primer Primer 1 and Primer 2R (from Clontech companies PCR-select^TMCDNA Subtraction Kit kits) bacterium solution PCR amplification checkings are carried out, 342 positive colonies are obtained, Then Invitrogen (Shanghai) Trading Co., Ltd. is sent to be sequenced all positive colonies.

(6) the cDNA sequencing analysis of differential cloning：

After DNA sequencing result is removed into carrier and the cDNA of indefinite sequence and redundancy, 301 effective expression sequences are obtained Column label (Expressed sequence tag, EST) (Unigene).

The small salt mustard tonoplast sodium hydrogen antiporter gene ThNHX1 of embodiment 2 clone

After the clone from bacterium colony Th-S211 removes redundant DNA in the small salt mustard SSH libraries of the identification, sequence For SEQ ID No：3, sequence analysis shows that the albumen of the sequential coding belongs to tonoplast sodium hydrogen antiporter protein.Herein will SEQ ID No：Total length encoding gene is named as ThNHX1 corresponding to 3 sequences, and its corresponding albumen is named as NHX1.

SEQ ID No：3：

The clone of ThNHX1 total length encoding genes

According to the SEQ ID No obtained：3 sequences, following two specific primers are designed, the 5 ' ends as 3 ' RACE Specific primer.

ThNHX1GSP1：SEQ ID No：4：

TCTTCTGTGG CGTTTTAATG TC

ThNHX1GSP2：SEQ ID No：5：

TCACTTCAAG GCATGTGTTT GCA

Experimental procedure is by kit specification operation (3 ' RACE System for Rapid Amplification of CDNA Ends kits are purchased from Invitrogen companies).

With SEQ ID NO：4 and universal primer AUAP (kit carries), it is inverse with the mRNA of the small salt mustard extraction of salt treatment group The cDNA of transcription is that template carries out the amplification of first round PCR.Comprise the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l mRNA reverse transcriptions CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：Each 2.0 μ l of 4 and AUAP and the double steamings of 35 μ l Water.PCR reaction conditions：94 DEG C of pre-degenerations 5 minutes, (94 DEG C are denatured 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point for 33 circulations Clock), 72 DEG C extend 10 minutes.

The PCR primer of gained takes 2.0 μ l as template after diluting 50 times by the use of distilled water, with SEQ ID NO：5 draw with general Thing AUAP carries out the second wheel PCR amplifications, comprises the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, 3 μ l 2.5mM dNTP, the first round of 2.0 μ l dilutions PCR primer, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：5 and AUAP each 2.0 μ l and 35 μ l distilled water.PCR is anti- Answer condition：94 DEG C of pre-degenerations 5 minutes, 33 circulations (94 DEG C are denatured 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute), 72 DEG C Extension 10 minutes.Reclaiming the band that fragment is about 800bp in second of PCR primer, (Gel Extraction Kit are purchased from OMEGA), and pGEM-T Easy carriers are coupled with, are then transformed into escherichia coli jm109 competent cell (specific side Method is same as above), and screened on the LB solid mediums containing 50 μ g/mL ampicillins.10 white colonies of random picking It is inoculated in the LB fluid nutrient mediums containing 50 μ g/ml ampicillins, glycerol adding is to final concentration 20% after 37 DEG C of overnight incubations (volume ratio), -80 DEG C save backup.With SEQ ID NO：5 carry out bacterium solution PCR amplifications with universal primer AUAP, obtain 6 positives Clone, 4 positive colonies are delivered into Invitrogen's sequencing, obtain the cDNA of the gene 3 ' ends.

According to the ThNHX1 genetic fragments obtained, following three specific primers are designed, the 3 ' ends as 5 ' RACE Specific primer.

ThNHX1GSP3：SEQ ID No：6：

AGTGATTCTT GAACTTTCTG TC

ThNHX1GSP4：SEQ ID No：7：

AACATATATG AAAGGTATGC CA

ThNHX1GSP5：SEQ ID No：8：

GATCGCGAGT TCACGTGTAG TTG

Experimental procedure is by kit specification operation (5 ' RACE System for Rapid Amplification of CDNA Ends kits are purchased from Invitrogen companies).

With SEQ ID NO：7 with universal primer AAP (kit carries), the mRNA reverses extracted with the small salt mustard of salt treatment group CDNA (the reverse transcription primer SEQ ID NO of record：6) amplification of first round PCR is carried out for template, comprised the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l mRNA reverse transcriptions CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：7 and AAP each 2.0 μ l and 35 μ l double steamings Water.PCR reaction conditions：94 DEG C of pre-degenerations 5 minutes, (94 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point for 33 circulations Clock), 72 DEG C extend 10 minutes.

The PCR primer of gained takes 2.0 μ l as template after diluting 50 times by the use of distilled water, with SEQ ID NO：8 and primer AUAP carries out the second wheel PCR amplifications, comprises the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, 3 μ l 2.5mM dNTP, the first round of 2.0 μ l dilutions PCR primer, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：8 and AUAP each 2.0 μ l and 35 μ l distilled water.PCR is anti- Answer condition：94 DEG C of pre-degenerations 5 minutes, 33 circulations (94 DEG C are denatured 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute), 72 DEG C Extension 10 minutes.Reclaiming the band that fragment is about 800bp in second of PCR primer, (Gel Extraction Kit are purchased from OMEGA), and pGEM-T Easy carriers are coupled with, are then transformed into escherichia coli jm109 competent cell (specific side Method is same as above), and screened on the LB solid mediums containing 50 μ g/mL ampicillins.10 white colonies of random picking It is inoculated in the LB fluid nutrient mediums containing 50 μ g/ml ampicillins, glycerol adding is to final glycerol concentration after 37 DEG C of overnight incubations For 20% (volume ratio), -80 DEG C save backup.With SEQ ID NO：8 carry out bacterium solution PCR amplification (reaction systems with primer AUAP And reaction condition is same as above), 7 positive colonies are obtained, wherein 4 clones is chosen and delivers to Invitrogen (Shanghai) Trading Co., Ltd. Sequencing, obtain the cDNA of the gene 5 ' ends.After 5 ' the RACE product clonings sequencing of gained, it is sequenced with 3 ' RACE products and tied Fruit and SEQ ID No：3 sequences are spliced.Obtain ThNHX1 full length cDNA sequence SEQ ID No：9：

According to SEQ ID NO：9 sequences Design pair of primers are as follows：

SEQ ID No：10：

ATGGGTGTTGGATT TACAGAGTT

SEQ ID No：11：

CTAGCATTCT GGTTGATTAT CTC

Pass through SEQ ID NO：10 and SEQ ID NO：11 clone ThNHX1 total length encoding genes.

Using TaKaRa PrimeSTAR HS archaeal dna polymerases, carried out by template of the cDNA of the small salt mustard of salt treatment group PCR reacts.50 μ l PCR reaction systems：10 μ l 5 × PS Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：10 and SEQ ID NO：11 each 2.0 μ l and 30 μ l distilled water.PCR reacts Condition：94 DEG C of pre-degenerations 5 minutes, 33 circulations (94 DEG C are denatured 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 2 minutes), 72 DEG C are prolonged Stretch 10 minutes.

Pcr amplification product adds A tails：The absolute ethyl alcohol of 2.5 times of volumes is added in PCR primer, -20 DEG C are placed 10 minutes, from The heart, supernatant is removed, dried, then dissolved with 21 μ l distilled waters.Then 2.5 μ l10 × Ex Buffer, 0.5 μ l are added thereto 5mM dATP, 1.0 μ l Ex Taq.Reaction condition：70 DEG C are reacted 30 minutes.Obtained about 1600bp DNA fragmentation is reclaimed (Omega QIAquick Gel Extraction Kits), and be connected on pGEM T-easy carriers and (obtain ThNHX1-pGEM plasmids), then convert In escherichia coli jm109 competent cell (method is same as above), and it is enterprising in the LB solid mediums containing 50 μ g/mL ampicillins Row screening.Random 10 white colonies of picking are inoculated in the LB fluid nutrient mediums containing 50 μ g/ml ampicillins, 37 DEG C of trainings To final concentration 20% (volume ratio), -80 DEG C save backup glycerol adding after supporting overnight.With SEQ ID NO：10 and SEQ ID NO：11 Bacterium solution PCR amplifications (reaction system and reaction condition are same as above) are carried out, obtain 5 positive colonies, wherein 4 positive colonies is chosen and send It is sequenced to Invitrogen (Shanghai) Trading Co., Ltd., gained sequence is SEQ ID NO：2, the amino acid of its protein encoded Sequence is SEQ ID NO：1.

The amino acid sequence of NHX1 albumen：SEQ ID NO：1

The nucleotide sequence SEQ ID NO of ThNHX1 genes：2

The plant expression vector construction of embodiment 3ThNHX1 genes

Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd) As plant expression vector, 35S promoter of the NPTII genes containing double enhancers is replaced with Pnos promoters, to reduce NPTII eggs Expression in plant in vain.35S promoter and Tnos terminators promoter and terminator respectively as ThNHX1 genes are selected, It is as shown in Figure 1 to build flow chart.

With primer SEQ ID NO：12 and SEQ ID NO：13 (are purchased from Beijing China ocean with plant expression vector pBI121 Science and Technology Ltd.) it is template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reactants System：10 μ l 5 × PS Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：12 and SEQ ID NO：13 each 2.0 μ l and 31 μ l distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5 are divided Clock, 33 circulations (94 DEG C are denatured 30 seconds, and 56 DEG C are annealed 30 seconds, and 72 DEG C extend 30 seconds), 72 DEG C extend 10 minutes.By EcoRI, The PCR primer of gained is connected to pCAMBIA2300 by BglII digestions by kit explanation (Promega, T4 connect enzyme reagent kit) Obtain pCAMBIA2300-1.

SEQ ID NO：12

GCACGAATTC ggcgggaaac gacaatctga

SEQ ID NO：13

ATCCAGATCTAGATCCGGTGCAGATTATTTG

With primer SEQ ID NO：14 and SEQ ID NO：15 using pBI121 as template amplification Tnos, using TaKaRa's PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ l 5 × PS Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：14 and SEQ ID NO：15 each 2.0 μ l and 31 μ l Distilled water.PCR reaction conditions：94 DEG C of pre-degenerations 5 minutes, (94 DEG C are denatured 30 seconds, and 58 DEG C are annealed 30 seconds, 72 DEG C for 33 circulations Extension 30 seconds), 72 DEG C extend 10 minutes.(Promega T4 connections are connected as PCR primer of KpnI, EcoRI digestion by obtained by Enzyme reagent kit) arrive pCAMBIA2300-1 acquisitions pCAMBIA2300-2.

SEQ ID NO：14：

AAGGGTAACGAATTTCCCCGATCGTTCAAA

SEQ ID NO：15：

TCAGAATTCCCAGTGAATTCCCGATCTAGTA

With primer SEQ ID NO：16 and SEQ ID NO：17 using pCAMBIA2300 as template amplification 35S promoter.Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ l5 × PS Buffer, 3 μ l 2.5mM DNTP, 1.0 μ l pCAMBIA2300,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：16 and SEQ ID NO：17 is each 2.0 μ l and 31 μ l distilled waters.PCR reaction conditions：94 DEG C of pre-degenerations 5 minutes, (94 DEG C are denatured 30 seconds, and 58 DEG C are moved back for 33 circulations Fire 30 seconds, 72 DEG C extend 30 seconds), 72 DEG C extend 10 minutes.Connected as PCR primer of HindIII, SalI digestion by obtained by (connection method is same as above) obtains pCAMBIA2300-3 to pCAMBIA2300-2.

SEQ ID NO：16：

ACTAAGCTTTAGAGCAGCTTGCCAACATGGTG

SEQ ID NO：17：

TGAGTCGACAGAGATAGATTTGTAGAGAGAGACT

With primer SEQ ID NO：18 and SEQ ID NO：(template is real to the full length sequence of 19 amplification ThNHX1 encoding genes Apply example 2 and obtain positive ThNHX1-pGEM plasmids), using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ l PCR are anti- Answer system：10 μ l 5 × PS Buffer, 3 μ l 2.5mM dNTP, 1.0 μ l ThNHX1-pGEM, 1.0 μ l PrimeSTAR, 10 μM primer SEQ ID NO：18 and SEQ ID NO：19 each 2.0 μ l and 31 μ l distilled waters.PCR reaction conditions：94 DEG C of pre- changes Property 5 minutes, 33 circulation (94 DEG C be denatured 30 seconds, 58 DEG C anneal 30 seconds, 72 DEG C extend 2 minutes), 72 DEG C extend 10 minutes.Pass through The PCR primer connection (connection method is same as above) of gained is arrived pCAMBIA2300-3 by Sal I, Kpn I digestions, obtains plant expression Carrier 35S-ThNHX1-2300 (Fig. 2).

SEQ ID NO：18

ACTGTCGACATGGGTGTTGGATT TACAGAGTTT

SEQ ID NO：19

ACTGGTACCCTAGCATTCT GGTTGATTAT CTCG

The 35S-ThNHX1-2300 expression vectors of embodiment 4 convert Agrobacterium

The preparation of Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competent cell：1-2 in advance Agrobacterium LBA4404 is drawn single spot on the LB solid mediums containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins and is inoculated with by it, 28 DEG C are cultivated 1 to 2 day.Picking single bacterium colony is inoculated in LB Liquid Cultures of the 5ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins Overnight incubation (about 12-16 hours) is shaken in base, at 28 DEG C to OD₆₀₀It is worth for 0.4, forms seed bacterium solution.Take 5ml culture activation Bacterium solution (1: 20 ratio) afterwards is inoculated in LB fluid nutrient mediums of the 100ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins In, 28 DEG C are shaken culture 2-2.5 hours to OD₆₀₀=0.8.Ice bath bacterium solution 10 minutes, shook up once every 3 minutes, made described thin Bacterium is even into resting state.4000g is centrifuged 10 minutes at 4 DEG C, abandons supernatant；Add 10% (volume of 1ml ice precoolings Than) glycerine resuspension thalline, 4000g is centrifuged 10 minutes at 4 DEG C, collects precipitation；Ice-cold 10% (volume ratio) glycerine weight After backwashing 3-4 times；Then adding 10% (volume ratio) glycerine of appropriate ice precooling, suspended bacterial precipitates again, that is, LBA4404 is made Competent cell, dispensed with 40 μ l/ pipes, saved backup in -70 DEG C.

Convert Agrobacterium：Melt described LBA4404 competent cells on ice, added into 40 μ l competent cell The plasmid 35S-ThNHX1-2300 that 1 μ l embodiments 3 obtain, ice bath about 10 minutes after mixing.By the competent cell after ice bath and The mixture of 35S-ThNHX1-2300 plasmids is transferred to liquid-transfering gun in the electric shock cup (being purchased from Bio-Rad) of ice precooling, and rapping makes Suspension reaches electric shock bottom of a cup portion, has been careful not to bubble.The electric shock cup is put on the slideway of electroporation chamber, promotes slideway will Electric shock cup is put to electroporation chamber base electrode.Using 0.1cm specifications electric shock cup when, MicroPulser (is purchased from Bio- Rad program) is arranged to " Agr ", and electric shock is once.Electric shock cup is taken out immediately, adds 200 μ l LB culture mediums of 28 DEG C of preheatings.It hurry up It is fast and soft to be beaten competent cell with liquid-transfering gun.Suspension is transferred to 1.5ml centrifuge tube, 225rpm shakes at 28 DEG C Dynamic culture 1 hour.100-200 μ l bacterium solution is taken to be coated on corresponding resistance screening culture medium flat plate that (LB solid mediums, contain 50 μ g/ml rifampins, 50 μ g/ml streptomysins, 50 μ g/ml kanamycins), 28 DEG C of cultures.Screen positive transformants clone, and by its Bacterium solution saves backup in -70 DEG C.

The acceptor material arabidopsis culture of embodiment 5

Good water absorption is selected, the soft vermiculite of soil property coordinates Nutrition Soil (1: 1) to be used as arabidopsis planting soil.Diameter 9cm Flowerpot, per basin sow 20-30.Film, the growth to plant provide the ring of a moistening in flowerpot upper cover after sowing Border.22 DEG C, intensity of illumination 3500-4000lx of constant temperature, periodicity of illumination are 12 hours dark, 12 hours illumination cultivations, are poured within every 7 days 1/2MS, after cultivating 30 days, retain 4-5 plant, periodicity of illumination is adjusted to 8 hours dark, 16 hours illumination cultivations, treated After most of plant all boltings, whole main tongue is cut in inflorescence base portion, its apical dominance is removed, is grown after about 1 week at axillary bud position Go out 4-6 newborn side tongues, when side tongue inflorescence forms bud and part is bloomed or forms 1-2 silique, can be used to convert (figure 3)。

The leaching conversion of the thaliana flower of embodiment 6：

The Agrobacterium bacterium solution for having converted expression vector that embodiment 4 is obtained is seeded to containing 10-50 μ g/ml kanamycins (kan) overnight incubation in LB culture mediums, the next morning are seeded in the new LB culture mediums containing antibiotic (1L) by 1: 50, Cultivate about 8 hours, agrobacterium liquid OD₆₀₀Should be between 1.0 to 1.2.Room temperature 5000rpm is centrifuged 5 minutes, supernatant is abandoned, by agriculture Bacillus precipitation is suspended in osmotic medium (1/2MS；5% sucrose；PH5.7 is adjusted to KOH；0.02%Silwet L-77), make OD₆₀₀0.8 or so.By embodiment 5 prepare be used for convert arabidopsis top slowly, spirally immerse inoculation medium It is interior, gently rock clockwise, about 2 minutes, covered tightly with blister pack to keep humidity, be put into greenhouse and stay overnight.Moved after 24 hours Plastic, transparent cover is removed, is irrigated with water.2-3 weeks afterwards, ensure that plant moisture is sufficient.When plant stop bloom, first Fruit pod into During ripe flavescence, entangled with paper bag, after all Fruit pods in paper bag turn yellow, stop watering, laboratory is fetched after drying in 1-2 weeks, Transformant selection is carried out, while takes the arabidopsis Fruit pod of unconverted processing as control.

The screening of the arabidopsis positive transformant of embodiment 7：

Seed disinfection：First soaked 10 minutes with 70% ethanol, to make seed suspension every now and then in above-mentioned processing；Then use It is sterile to wash four times, preferably also make seed suspension every now and then in this step processing.Seed after processing is uniformly coated on containing 50 μ g/ Vernalization 2 days (the at most sowing 1500 of the plate of one piece of 150mm diameter) on ml kan 1/2MS solid screening and culturing primary surfaces, 22 DEG C, intensity of illumination 3500-4000lx of constant temperature, periodicity of illumination are 12 hours dark, 12 hours illumination cultivations, are cultivated 7-10 days. Transgenic seed is determined whether according to upgrowth situation.The seed for being successfully transferred to recombinant plasmid can be normal on resistance culture base Grow more than 4 true leaves.Non-transgenic seed is unable to normal growth, is only capable of growing 2 cotyledons, the growth of root is also by serious Suppress, it is general to sprout death later in 10 days.After transgenic seed sprouts 2 weeks on MS+kan flat boards, positive plant is transferred to Soil continues to cultivate, transgenic arabidopsis SEQ ID NO：18 and SEQ ID NO：19 do PCR detections, remove negative plant, Collect positive plant seed, label：T0a1-T0a25.

Embodiment 8 is overexpressed ThNHX1 plantations of the transgenic arabidopsis T1 for plant

Good water absorption is selected, the soft vermiculite of soil property coordinates Nutrition Soil (1: 1) to be used as arabidopsis planting soil.T0a1- The each transformants of T0a20 sow 2 basins, and control arabidopsis sows 2 basins, 20-30 seed is sowed per basin.After sowing on flowerpot Film on cover, the growth to plant provide the environment of a moistening.22 DEG C, intensity of illumination 3500-4000lx of constant temperature, periodicity of illumination For 12 hours dark, 12 hours illumination cultivations, a 1/2MS is poured within every 7 days, after cultivating 25 days, transgenic arabidopsis SEQ ID NO：18 and SEQ ID NO：19 do PCR detections, remove negative plant, retain the positive seedling of 12-14, continue culture 10 days Afterwards, choose transgenic arabidopsis of the same size, control arabidopsis does salt tolerant experiment, more consistent 7-9 per basin reservation size Seedling.

The transgenic arabidopsis T1 that embodiment 9 is overexpressed ThNHX1 tests for the salt tolerant of plant

Transgenic arabidopsis, control each basin of arabidopsis are not dealt with, and normally pour 1/2MS, transgenic arabidopsis, control Each basin of arabidopsis pours the 1/2MS containing 150Mm NaCl, 22 DEG C of constant temperature, intensity of illumination 3500-4000lx, 12 small time trainings Support light culture circulation in/12 hours.Observation experiment result after 10 days：For transfer-gen plant, (T0 grows T1 for the seed of transfer-gen plant Into plant) Salt-Tolerance Identification show that T1 is shown significantly for tri- strains of transfer-gen plant T1a4, T1a17, T1a19 Salt tolerance (see Fig. 4, with T1a4 examples, T1a7, T1a19 result are similar with its, are not shown here).

Embodiment 10 verifies the expression of ThNHX1 genes on transcriptional level

The good T1 of salt tolerant (is belonging respectively to the resistance to salt plug of above three for randomly selecting 8 in transfer-gen plant in embodiment 9 System), adjoining tree randomly selects 4 in embodiment 9, each clip salt treatment blade 0.05g of 14 days, is tried with plant RNA extraction Agent box (Invitrogen) extracts total serum IgE.Total serum IgE obtained by ultraviolet spectrophotometry 260nm and 280nm absorbance, Calculate each RNA concentration.According to Invitrogen reverse transcription reagent box SuperScript III Reverse Method shown in Transcriptase carries out reverse transcription, and (1 μ g total serum IgEs are as template, reverse transcription primer SEQ ID NO：11).Pass through SEQ ID NO：10 and SEQ ID NO：20(SEQ ID NO：20：ATTCCGAGGA TTGTGCTAGT GA) amplification ThNHX1, Detect its transcription situation.Using TaKaRa PrimeSTAR HS archaeal dna polymerases, entered using the cDNA of above-mentioned reverse transcription as template Performing PCR reacts.50 μ l PCR reaction systems：10 μ l 5 × PS Buffer, 3 μ l 2.5mM dNTP, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：10 and SEQ ID NO：20 each 2.0 μ l and 30 μ l distilled water.PCR reacts Condition：94 DEG C of pre-degenerations 5 minutes, 32 circulations (94 DEG C are denatured 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute), 72 DEG C are prolonged Stretch 10 minutes.Product electrophoresis result is as shown in Figure 5：M is DNA Ladder Marker (DL2000, purchased from the auspicious very biological skill in Shenzhen Art Co., Ltd), 1-4 compares Arabidopsis plant for not salt tolerant, and 13 be plasmid PCR positive control (35S-ThNHX1-2300 matter Grain), 5-12 is to quote thing Arabidopsis plant in salt tolerant T1 generations.Stripe size shown in figure and the in the same size of positive control (are about 700bp).As a result show, salt tolerant T1 is stronger for the transcription of ThNHX1 in transgenic Arabidopsis plants, and salt tolerant control arabidopsis is not planted There is no ThNHX1 transcription in strain.

Claims

1. A tonoplast membrane sodium-hydrogen antiporter of Salina japonica, the amino acid sequence of which is shown in SEQ ID NO:1.

2. The gene encoding the tonoplast sodium-hydrogen antiporter of claim 1, the nucleotide sequence of which is shown in SEQ ID NO:2.

3. A recombinant expression vector, which is obtained by inserting the gene according to claim 2 into an expression vector, and the nucleotide sequence of the gene is operable with the expression control sequence of the expression vector The expression vector is pCAMBIA2300.

4. The recombinant expression vector according to claim 3, which is the 35S-ThNHX1-2300 vector shown in Figure 2.

5. A recombinant cell, which contains the gene according to claim 2 or the recombinant expression vector according to claim 3 or 4; the recombinant cell is a recombinant Agrobacterium cell.

6. A method for improving plant salt tolerance, comprising: introducing the gene according to claim 2 or the recombinant expression vector according to claim 3 or 4 into a plant or plant tissue and expressing the gene; southern thaliana.

7. A method for preparing a transgenic plant, comprising: cultivating a plant or plant tissue containing the gene of claim 2 or the recombinant expression vector of claim 3 or 4 under conditions effective for producing plants, wherein the plant is Arabidopsis.

8. The gene of claim 2, the recombinant expression vector of claim 3 or 4 or the recombinant cell of claim 5 are used to improve plant salt tolerance and for plant breeding, wherein the plant is Arabidopsis.