CN105073771B - A sodium-hydrogen antiporter protein NHX1 and its coding gene and application - Google Patents

Abstract

A tonoplast sodium-hydrogen antiporter NHX1 from thellungiella halophila and a coding gene thereof, and application thereof in cultivating transgenic plants with improved salt tolerance.

Description

A sodium-hydrogen antiporter protein NHX1 in the tonoplast membrane of Salt mustard and its coding gene and application

technical field

The present invention relates to plant protein and its encoding gene and application, in particular to a tonoplast membrane sodium-hydrogen antiporter NHX1 and its encoding gene derived from the small salt mustard, and its application in cultivating transgenic plants with improved salt tolerance .

Background technique

Salt stress is one of the most important abiotic stress hazards to agricultural production in the world. Saline soils are usually dominated by sodium, calcium or magnesium salts, which have become the main factors that affect plant growth and lead to reduced yields of food and economic crops. The area of saline-alkali soil in the world is about 400 million hectares, accounting for 1/3 of irrigated farmland. Saline-alkali land is widely distributed in China, and the existing saline-alkali land area is about 40 million hectares. With the increase of population and the reduction of cultivated land in our country, the development and utilization of saline-alkali land resources has extremely important practical significance. The improvement of plant resistance to saline-alkali and drought and the selection of plant species or strains suitable for growing on saline-alkali land and having high economic and ecological value are economical and effective measures to use saline-alkali land. For the vast majority of crops, most plants have poor tolerance to salinity and drought, and can only grow on soil with a sodium chloride content of less than 0.3%. Excessive Na ⁺ in the soil will affect the normal growth of plants. Growth metabolism produces toxic effects. Therefore, how to improve crop yield in saline environment has become a very important issue in agricultural production all over the world.

The salt tolerance of plants is a very complex quantitative trait, and its salt tolerance mechanism involves all levels from plants to organs, tissues, physiology and biochemistry to molecules. Scientists from various countries have also done a lot of work and made a lot of new progress, especially in the use of the higher model plant Arabidopsis to study the salt-tolerant molecular mechanism of plants, which has made a breakthrough in the research in this field ( Zhu JK.2002.Salt and drought stress signal transduction implants.Annu.Rev.Plant Biol.53:1247-1273; Zhang ZL.2011.Arabidopsis FloralInitiator SKB1Confers High Salt Tolerance by Regulating Transcription andPre-mRNA Splicing through Altering Sarbom3 Histone H LSM4Methylation. Plant Cell, 23:396-411). There are many ways for higher plant cells to sense changes in physical and chemical parameters in the external environment, thereby converting extracellular signals into intracellular signals, and finally transmitting stress signals to the nucleus through a series of signal transduction, activating transcription factors, and activating transcription Factors then act on functional genes to activate the expression of stress response genes to improve the stress tolerance of plants. Although researchers have carried out a lot of research from different aspects, many important issues in plant salt resistance remain to be explored due to the complexity of its mechanism. For example, the key factors of plant salt resistance have not yet been found; the molecular mechanism of plant salt tolerance is not very clear.

Contents of the invention

The present inventors cloned the coding gene of a tonoplast sodium-hydrogen antiporter (named NHX1 in this paper) of A. salina by combining SSH (suppressed subtractive hybridization) and RACE (rapid amplification of cDNA ends), and Its DNA sequence was determined. It was also found that the salt tolerance of transgenic plants can be significantly improved after it is introduced into plants through transgenes, and these traits can be inherited stably.

The first aspect of the present invention provides a gene encoding a tonoplast sodium-hydrogen antiporter NHX1 (named ThNHX1 herein) of Salina japonica, the sequence of which is SEQ ID NO:2.

The second aspect of the present invention provides a recombinant expression vector, which contains the gene described in the first aspect of the present invention, which is obtained by inserting the gene into an expression vector, preferably, the expression vector is pCAMBIA2300; And the nucleotide sequence of the gene is operably linked to the expression control sequence of the recombinant expression vector; preferably, the recombinant expression vector is the 35S-ThNHX1-2300 vector shown in Fig. 2 .

The third aspect of the present invention provides a recombinant cell, which contains the gene described in the first aspect of the present invention or the recombinant expression vector described in the second aspect of the present invention; preferably, the recombinant cell is a recombinant Agrobacterium cell.

The fourth aspect of the present invention provides a method for improving plant salt tolerance, comprising: introducing the gene described in the first aspect of the present invention or the recombinant expression vector described in the second aspect of the present invention into a plant or plant tissue and expressing the gene ; Preferably, the plant is Arabidopsis.

The fifth aspect of the present invention provides a method for preparing a transgenic plant, comprising: cultivating a plant or plant tissue containing the gene described in the first aspect of the present invention or the recombinant expression vector described in the second aspect of the present invention under conditions effective for plant production ; Preferably, the plant is Arabidopsis.

The sixth aspect of the present invention provides the gene described in the first aspect of the present invention, the recombinant expression vector described in the second aspect of the present invention or the recombinant cell described in the third aspect of the present invention for improving plant salt tolerance and for plant breeding purposes; preferably, the plant is Arabidopsis.

The seventh aspect of the present invention provides the protein encoded by the gene described in the first aspect of the present invention, the amino acid sequence of which is shown in SEQ ID NO:1.

Description of drawings

Fig. 1 is the construction flow of the plant expression vector (35S-ThNHX1-2300) of NHX1 gene (Fig. 1a-1b).

Fig. 2 is a plasmid map of the plant expression vector (35S-ThNHX1-2300) of the NHX1 gene.

Fig. 3 is the cultured test plant Arabidopsis thaliana.

Fig. 4 is the salt tolerance test results of T1 generation plants of ThNHX1 transgenic Arabidopsis thaliana, T1a4 showed obvious salt tolerance, T1a17, T1a19 had similar results, not shown here.

Fig. 5 is the result of detecting the transcription level of _ThNHX1 gene in T1 generation transgenic tobacco plants and non-transgenic control plants by reverse transcription PCR at the molecular level. M is DNALadder Marker (DL2000), 1-4 is salt-intolerant control Arabidopsis plants, 13 is plasmid PCR positive control (35S-ThNHX1-2300 plasmid), 5-12 is salt-tolerant T1 transgenic Arabidopsis plants .

Detailed ways

The following examples are provided to facilitate those skilled in the art to better understand the present invention. The examples are for illustrative purposes only and are not intended to limit the scope of the invention.

The restriction endonucleases mentioned in the following examples were all purchased from New England Biolabs.

Example 1. Construction of the SSH library of P. salina under salt stress:

The specific method is:

The SSH library (subtractive library) was constructed by suppression subtractive hybridization method according to the method shown in the instructions of the PCR-select ^TM cDNA Subtraction Kit kit of Clontech Company. During the experiment, the mRNA extracted from the tissue of Salina japonica treated with salt during the growth process was used as the sample (Tester), and the mRNA extracted from the tissue of Untreated Salina japonica was used as the control (Driver). Specific steps are as follows:

(1) Test materials:

Salt mustard (Thellungiella halophila, purchased from Halophyte Breeding Center of Wulan Buhe Desert Green Botanical Garden, Bayannaoer City, Inner Mongolia, China) was sown on sterilized vermiculite, at 22 °C, with a photoperiod of 12 hours light/12 hours dark ( Light intensity 3000-4000Lx), pour 1/2 MS medium (containing 9.39mM KNO ₃ , 0.625mM KH ₂ PO ₄ , 10.3mM NH ₄ NO ₃ , 0.75mM MgSO ₄ , 1.5mM CaCl ₂ , 50μM KI , 100 μM H ₃ BO ₃ , 100 μM MnSO ₄ , 30 μM ZnSO ₄ , 1 μM Na ₂ MoO ₄ , 0.1 μM CoCl ₂ , 100 μM Na ₂ EDTA, 100 μM FeSO ₄ ) once. When the plant diameter reaches 5-6cm, it is used for the experiment.

(2) Material handling:

The test plants were divided into 2 groups, with 4 pots in each group and 3 plants in each pot. The first group is the control group, which is normally watered with 1/2MS; the second group is the salt treatment group, which is watered with 1/2MS solution containing 300mM NaCl. (Light intensity 3000-4000Lx) was cultured and treated for 10 days, and then two groups of plants were collected in time (the roots were washed with distilled water), quickly frozen with liquid nitrogen, and stored in a -70°C refrigerator.

(3) total RNA extraction:

Take 3.0 g of Salina japonica from the control group and the salt treatment group respectively, and extract the total RNA with a plant RNA extraction kit (purchased from Invitrogen). Measure the absorbance value of the total RNA at 260nm and 280nm with the ultraviolet spectrophotometer U-2001 of HITACHI company, and the ratio of OD ₂₆₀ /OD ₂₈₀ is 1.8-2.0, indicating that the purity of the total RNA is relatively high. Electrophoresis with 1.0% agarose gel To detect the integrity of the total RNA, the brightness of the 28S band is about twice that of the 18S band, indicating that the integrity of the RNA is good. mRNA was isolated using Qiagen's Oligotex mRNA purification kit (purification of polyA+RNA from total RNA).

(4) Suppression of subtractive hybridization:

Suppression subtractive hybridization was carried out according to the method indicated in the instruction manual of the PCR-select ^TM cDNA Subtraction Kit kit from Clontech Company. First, the Driver mRNA and Tester mRNA were reverse-transcribed to obtain double-stranded cDNA, and then subtractive hybridization was performed using 2 μg Tester cDNA and 2 μg Driver cDNA as starting materials. The Tester cDNA and Driver cDNA were digested with Rsa I for 1.5 hours in a water bath at 37°C, and then the digested Tester cDNA was divided into two equal parts, and different adapters were connected, while the Driver cDNA was not connected. Two Tester cDNAs connected with different adapters were mixed with excess Driver respectively, and the first forward subtractive hybridization was carried out. The two products of the first forward subtractive hybridization were mixed, and then the second forward subtractive hybridization was performed with the newly denatured Driver cDNA, and the fragments enriched for differentially expressed genes were amplified by two suppression PCRs (PCR Before, the second forward subtractive hybridization product was filled in at the end).

(5) Construction and preliminary screening, cloning and identification of subtractive library

According to the instructions of the pGEM-T Easy kit (purchased from Promega), the second suppression PCR amplification product of the second forward subtractive hybridization cDNA fragment (purified using QIAquick PCR Purification Kit, purchased from Qiagen) Ligate with pGEM-T Easy vector, the specific steps are as follows: Add the following components in sequence to a 200 μl PCR tube: 3 μl of purified second PCR product, 5 μl of 2×T4 ligase buffer, 1 μl of pGEM-T Easy vector, T4 DNA ligase 1 μl, ligated overnight at 4°C. Then take 10 μl of the ligation reaction product, add it to 100 μl competent Escherichia coli JM109 (purchased from TAKARA), ice bath for 30 minutes, heat shock at 42°C for 60 seconds, ice bath for 2 minutes, and add 250 μl LB liquid medium (containing 1% Tryptone (Tryptone, purchased from OXOID), 0.5% yeast extract (Yeast Extract, purchased from OXOID) and 1% NaCl (purchased from Sinopharm)) were then placed in a shaker at 37°C and cultured with shaking at 225rpm for 30 minutes, and then Take 200 μl of the bacterial liquid and inoculate it into LB (same as above)/X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside)/IPTG (isopropyl- β-D-thiogalactopyranoside) (X-gal/IPTG purchased from TAKARA) culture plate, incubated at 37°C for 18 hours. Count clear white and blue colonies with a diameter > 1 mm in the culture plate, and randomly pick 450 white colonies (number: Th-S001 to Th-S450). The picked white colony clones were inoculated into LB liquid medium containing 50 μg/ml ampicillin in a 96-well cell culture plate (CORNING), cultured overnight at 37° C., and then added glycerol until the final concentration of glycerol was 20% (volume ratio). Then store at -80°C for later use. The cultured colony clones were verified by bacterial liquid PCR amplification with nested PCR primers Primer 1 and Primer 2R (from the PCR-select ^TM cDNA Subtraction Kit kit of Clontech Company), and 342 positive clones were obtained, and then all positive clones were Sequencing was sent to Yingwei Jieji (Shanghai) Trading Co., Ltd.

(6) cDNA sequencing analysis of differential clones:

After removing the vector, unclear sequence and redundant cDNA from the DNA sequencing results, a total of 301 effective expressed sequence tags (Expressed sequence tag, EST) (Unigene) were obtained.

Example 2 Cloning of ThNHX1 Gene ThNHX1

After the redundant DNA was removed from the clone from the colony Th-S211 in the identified S. salina SSH library, the sequence was SEQ ID No: 3. Sequence analysis showed that the protein encoded by this sequence belonged to the tonoplast membrane sodium-hydrogen antiporter . In this paper, the full-length coding gene corresponding to the sequence of SEQ ID No: 3 is named ThNHX1, and the corresponding protein is named NHX1.

SEQ ID No: 3:

Cloning of ThNHX1 full-length coding gene

According to the obtained sequence of SEQ ID No: 3, the following two specific primers were designed as the 5' end specific primers of 3' RACE.

ThNHX1GSP1: SEQ ID No: 4:

TCTTCTGTGG CGTTTTAATG TC

ThNHX1GSP2: SEQ ID No: 5:

TCACTTCAAG GCATGTGTTT GCA

The experimental steps were operated according to the instructions of the kit (the 3'RACE System for Rapid Amplification of cDNA Ends kit was purchased from Invitrogen).

Using SEQ ID NO: 4 and the universal primer AUAP (included in the kit), the first round of PCR amplification was performed using the cDNA reverse-transcribed from the mRNA extracted from the salt-treated group A. salina as a template. Specific steps are as follows:

50 μl PCR reaction system: 5 μl 10×Ex Buffer, 3 μl 2.5 mM dNTP, 2.0 μl mRNA reverse-transcribed cDNA, 1.0 μl Ex Taq (purchased from TAKARA), 10 μM primers SEQ ID NO: 4 and 2.0 μl each of AUAP and 35 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute), and extension at 72°C for 10 minutes.

The resulting PCR product was diluted 50 times with double distilled water, and 2.0 μl was taken as a template, and the second round of PCR amplification was performed with SEQ ID NO: 5 and the universal primer AUAP. The specific steps were as follows:

50 μl PCR reaction system: 5 μl 10×Ex Buffer, 3 μl 2.5 mM dNTP, 2.0 μl diluted first-round PCR product, 1.0 μl Ex Taq, 10 μM primers SEQ ID NO: 5 and 2.0 μl AUAP each, and 35 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute), and extension at 72°C for 10 minutes. Reclaim the band (Gel Extraction Kit is purchased from OMEGA) of fragmentation about 800bp in the PCR product for the second time, and it is ligated in pGEM-T Easy carrier, then transforms in Escherichia coli JM109 competent cell (specific method is the same as above), And screened on LB solid medium containing 50 μg/mL ampicillin. Randomly pick 10 white colonies and inoculate them in LB liquid medium containing 50 μg/ml ampicillin, culture overnight at 37°C, add glycerol to a final concentration of 20% (volume ratio), and store at -80°C for later use. Use SEQ ID NO: 5 and the universal primer AUAP to carry out bacterial liquid PCR amplification, and obtain 6 positive clones, send 4 positive clones to Yingwei Jieji (Shanghai) Trading Co., Ltd. for sequencing, and obtain the 3' of the cDNA of the gene end.

According to the obtained ThNHX1 gene fragment, the following three specific primers were designed as the 3' end specific primers of 5'RACE.

ThNHX1GSP3: SEQ ID No: 6:

AGTGATTCTTGAACTTTCTGTC

ThNHX1GSP4: SEQ ID No: 7:

AACATATATG AAAGGTATGC CA

ThNHX1GSP5: SEQ ID No: 8:

GATCGCGAGTTCACGTGTAGTTG

The experimental steps were operated according to the instructions of the kit (the 5'RACE System for Rapid Amplification of cDNA Ends kit was purchased from Invitrogen).

Using SEQ ID NO: 7 and the universal primer AAP (included in the kit), the first round of PCR amplification was carried out using the reverse-transcribed cDNA (reverse transcription primer SEQ ID NO: 6) from the mRNA extracted from the salt-treated group A. increase, the specific steps are as follows:

50 μl PCR reaction system: 5 μl 10×Ex Buffer, 3 μl 2.5 mM dNTP, 2.0 μl mRNA reverse-transcribed cDNA, 1.0 μl Ex Taq (purchased from TAKARA), 10 μM primers SEQ ID NO: 7 and 2.0 μl each of AAP and 35 μl of double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute), and extension at 72°C for 10 minutes.

The obtained PCR product was diluted 50 times with double distilled water, and 2.0 μl was taken as a template, and the second round of PCR amplification was performed with SEQ ID NO: 8 and primer AUAP. The specific steps were as follows:

50 μl PCR reaction system: 5 μl 10×Ex Buffer, 3 μl 2.5 mM dNTP, 2.0 μl diluted first-round PCR product, 1.0 μl Ex Taq, 10 μM primers SEQ ID NO: 8 and 2.0 μl AUAP each, and 35 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute), and extension at 72°C for 10 minutes. Reclaim the band (Gel Extraction Kit is purchased from OMEGA) of fragmentation about 800bp in the PCR product for the second time, and it is ligated in pGEM-T Easy carrier, then transforms in Escherichia coli JM109 competent cell (specific method is the same as above), And screened on LB solid medium containing 50 μg/mL ampicillin. Randomly pick 10 white colonies and inoculate them in LB liquid medium containing 50 μg/ml ampicillin, culture overnight at 37°C, add glycerol to a final glycerol concentration of 20% (volume ratio), and store at -80°C for later use. Use SEQ ID NO: 8 and primer AUAP to carry out bacterial liquid PCR amplification (reaction system and reaction conditions are the same as above), and obtain 7 positive clones, select 4 of them and send them to Yingwei Jieji (Shanghai) Trading Co., Ltd. for sequencing, and obtain The 5' end of the cDNA of the gene. After the obtained 5'RACE product was cloned and sequenced, it was spliced with the sequencing result of the 3'RACE product and the sequence of SEQ ID No:3. Get ThNHX1 full-length cDNA sequence SEQ ID No: 9:

A pair of primers were designed according to the sequence of SEQ ID NO: 9 as follows:

SEQ ID No: 10:

ATGGGTGTTGGATT TACAGAGTT

SEQ ID No: 11:

CTAGCATTCT GGTTGATTAT CTC

The full-length coding gene of ThNHX1 was cloned by SEQ ID NO:10 and SEQ ID NO:11.

Using TaKaRa's PrimeSTAR HS DNA polymerase, PCR reaction was carried out using the cDNA of Salina japonica from the salt treatment group as template. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 2.0 μl cDNA, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 10 and 2.0 μl each of SEQ ID NO: 11, and 30 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes), and extension at 72°C for 10 minutes.

Add A tail to the PCR amplification product: Add 2.5 times the volume of absolute ethanol to the PCR product, place it at -20°C for 10 minutes, centrifuge, remove the supernatant, dry it in the air, and then dissolve it with 21 μl double distilled water. Then, 2.5 μl of 10×Ex Buffer, 0.5 μl of 5 mM dATP, and 1.0 μl of Ex Taq were added thereto. Reaction conditions: react at 70°C for 30 minutes. The obtained DNA fragment of about 1600bp is recovered (Omega recovery kit), and it is connected to the pGEM T-easy vector (obtaining the ThNHX1-pGEM plasmid), and then transformed into Escherichia coli JM109 competent cells (method is the same as above), and Selection was performed on LB solid medium containing 50 μg/mL ampicillin. Randomly pick 10 white colonies and inoculate them in LB liquid medium containing 50 μg/ml ampicillin, culture overnight at 37°C, add glycerol to a final concentration of 20% (volume ratio), and store at -80°C for later use. Use SEQ ID NO: 10 and SEQ ID NO: 11 to carry out bacterial liquid PCR amplification (reaction system and reaction conditions are the same as above), and 5 positive clones are obtained, and 4 positive clones are selected and sent to Yingwei Jieji (Shanghai) Trading Co., Ltd. Sequenced by the company, the obtained sequence is SEQ ID NO: 2, and the amino acid sequence of the encoded protein is SEQ ID NO: 1.

Amino acid sequence of NHX1 protein: SEQ ID NO: 1

Nucleotide sequence of ThNHX1 gene SEQ ID NO: 2

The plant expression vector construction of embodiment 3ThNHX1 gene

The plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as the plant expression vector, and the 35S promoter of the NPTII gene containing double enhancers was replaced with the Pnos promoter to reduce the expression of NPTII protein in plants . The 35S promoter and the Tnos terminator were selected as the promoter and terminator of the ThNHX1 gene respectively, and the construction flow chart is shown in Figure 1.

Primers SEQ ID NO: 12 and SEQ ID NO: 13 were used to amplify Pnos using the plant expression vector pBI121 (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) as a template, and TaKaRa's PrimeSTAR HS DNA polymerase was used. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl pBI121, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 12 and 2.0 μl each of SEQ ID NO: 13, and 31 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 30 seconds), and extension at 72°C for 10 minutes. The resulting PCR product was ligated to pCAMBIA2300 according to the kit instructions (Promega, T4 ligase kit) by EcoRI and BglII digestion to obtain pCAMBIA2300-1.

SEQ ID NO: 12

GCACGAATTC ggcgggaaac gacaatctga

SEQ ID NO: 13

ATCCAGATCTAGATCCGGTGCAGATTATTTG

Primers SEQ ID NO: 14 and SEQ ID NO: 15 were used to amplify Tnos using pBI121 as a template, using TaKaRa's PrimeSTAR HS DNA polymerase. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl pBI121, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 14 and 2.0 μl each of SEQ ID NO: 15, and 31 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds), and extension at 72°C for 10 minutes. The resulting PCR product was ligated (Promega T4 ligase kit) to pCAMBIA2300-1 by KpnI and EcoRI digestion to obtain pCAMBIA2300-2.

SEQ ID NO: 14:

AAGGGTAACGAATTTCCCCGATCGTTCAAA

SEQ ID NO: 15:

TCAGAATTCCCAGTGAATTCCCGATCTAGTA

The 35S promoter was amplified using primers SEQ ID NO: 16 and SEQ ID NO: 17 using pCAMBIA2300 as a template. TaKaRa's PrimeSTAR HS DNA polymerase was used. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl pCAMBIA2300, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 16 and 2.0 μl each of SEQ ID NO: 17, and 31 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds), and extension at 72°C for 10 minutes. The resulting PCR product was ligated to pCAMBIA2300-2 by HindIII and SalI digestion (the ligation method was the same as above) to obtain pCAMBIA2300-3.

SEQ ID NO: 16:

ACTAAGCTTTAGAGCAGCTTGCCAACATGGTG

SEQ ID NO: 17:

TGAGTCGACAGAGATAGATTTGTAGAGAGAGACT

Primers SEQ ID NO: 18 and SEQ ID NO: 19 were used to amplify the full-length sequence of the gene encoding ThNHX1 (the template is the positive ThNHX1-pGEM plasmid obtained in Example 2), and TaKaRa's PrimeSTAR HS DNA polymerase was used. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl ThNHX1-pGEM, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 18 and 2.0 μl each of SEQ ID NO: 19, and 31 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 33 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes), and extension at 72°C for 10 minutes. The resulting PCR product was ligated to pCAMBIA2300-3 by digestion with Sal I and Kpn I (the ligation method was the same as above) to obtain the plant expression vector 35S-ThNHX1-2300 ( FIG. 2 ).

SEQ ID NO: 18

ACTGTCGACATGGGTGTTGGATTTACAGAGTTTT

SEQ ID NO: 19

ACTGGTACCCTAGCATTCT GGTTGATTAT CTCG

Example 4 Transformation of 35S-ThNHX1-2300 expression vector into Agrobacterium

Preparation of Agrobacterium LBA4404 (purchased from Biovector Science Lab, Inc) competent cells: Agrobacterium LBA4404 was single-spotted on LB solid medium containing 50 μg/ml rifampicin and 50 μg/ml streptomycin 1-2 days in advance Inoculate and culture at 28°C for 1 to 2 days. Pick a single colony and inoculate it in 5ml of LB liquid medium containing 50μg/ml rifampicin and 50μg/ml streptomycin, culture it with shaking at 28°C overnight (about 12-16 hours) until the _OD600 value is 0.4, and form seed bacteria liquid. Take 5ml of cultured and activated bacterial solution (ratio of 1:20) and inoculate in 100ml of LB liquid medium containing 50μg/ml rifampicin and 50μg/ml streptomycin, culture with shaking at 28°C for 2-2.5 hours until _OD600 = 0.8. Ice-bath the bacterial solution for 10 minutes, shake well every 3 minutes, so that the bacteria enter a dormant state evenly. Centrifuge at 4000g for 10 minutes at 4°C, discard the supernatant; add 1ml of ice-cold 10% (volume ratio) glycerol to resuspend the bacteria, centrifuge at 4000g for 10 minutes at 4°C, and collect the precipitate; use ice-cold 10% (Volume ratio) Glycerol was repeatedly washed 3-4 times; then an appropriate amount of ice-precooled 10% (volume ratio) glycerol was added to resuspend the bacterial pellet to obtain LBA4404 competent cells, which were divided into 40 μl/tubes and placed in - Store at 70°C for later use.

Transformation of Agrobacterium: Thaw the LBA4404 competent cells on ice, add 1 μl of the plasmid 35S-ThNHX1-2300 obtained in Example 3 to 40 μl of the competent cells, mix well, and ice-bath for about 10 minutes. Transfer the mixture of competent cells and 35S-ThNHX1-2300 plasmid after ice bathing to an ice-cooled electric shock cup (purchased from Bio-Rad) with a pipette gun, and tap to make the suspension reach the bottom of the electric shock cup. There are bubbles. Put the electric shock cup on the slide of the electric shock chamber, push the slide to place the electric shock cup to the electrode of the base of the electric shock chamber. When using a 0.1 cm electric shock cup, the program of the MicroPulser (purchased from Bio-Rad) was set to "Agr", and electric shock was performed once. Immediately take out the electric shock cup and add 200 μl LB medium preheated at 28°C. Quickly and gently pipette the competent cells to homogenize. The suspension was transferred to a 1.5ml centrifuge tube, and shaken at 225rpm for 1 hour at 28°C. Take 100-200 μl of bacterial solution and spread it on the corresponding resistance selection medium plate (LB solid medium, containing 50 μg/ml rifampicin, 50 μg/ml streptomycin, 50 μg/ml kanamycin), 28 Cultivate at ℃. Positively transformed clones were screened, and their bacterial fluids were stored at -70°C for future use.

Example 5 Receptor material Arabidopsis culture

Choose vermiculite with good water absorption and soft soil quality combined with nutrient soil (1:1) as the soil for planting Arabidopsis thaliana. For flower pots with a diameter of 9cm, 20-30 seeds are sown in each pot. After sowing, cover the flowerpot with a film to provide a moist environment for the growth of the plant. Constant temperature is 22°C, light intensity is 3500-4000lx, light cycle is 12 hours dark, 12 hours light culture, watering 1/2MS every 7 days, after 30 days of cultivation, keep 4-5 plants, light cycle is adjusted to 8 hours dark, 16 hours of light cultivation, after most of the plants have bolted, cut off the entire main moss at the base of the inflorescence, and remove the dominance of its apex, after about 1 week, 4-6 new side mosses will grow on the axillary buds, and wait for the side moss to form flower buds And when it partially blooms or forms 1-2 siliques, it can be used for transformation (Fig. 3).

Embodiment 6 Arabidopsis flower dip transformation:

Inoculate the Agrobacterium bacterium liquid that has transformed the expression vector obtained in Example 4 into the LB medium containing 10-50 μg/ml kanamycin (kan) and cultivate overnight, and inoculate to the antibiotic-containing medium at 1:50 the next morning. In the new LB medium (1L), cultivate for about 8 hours, and the OD ₆₀₀ of the Agrobacterium solution should be between 1.0 and 1.2. Centrifuge at room temperature at 5000rpm for 5 minutes, discard the supernatant, and suspend the Agrobacterium pellet in the osmotic medium (1/2MS; 5% sucrose; adjust to pH 5.7 with KOH; 0.02% Silwet L-77), so that the _OD600 is at 0.8 about. Slowly and spirally immerse the upper part of the Arabidopsis thaliana prepared in Example 5 into the inoculation medium, shake it gently clockwise for about 2 minutes, cover it tightly with a transparent plastic cover to keep the humidity, and put it in the greenhouse overnight . After 24 hours, remove the plastic transparent cover and pour water thoroughly. After 2-3 weeks, ensure that the plants are well watered. When the plant stops flowering and the first fruit pod matures and turns yellow, cover it with a paper bag. When all the fruit pods in the paper bag turn yellow, stop watering and take it back to the laboratory after 1-2 weeks of drying for transformant selection. , while taking untransformed Arabidopsis pods as a control.

Example 7 Screening of Arabidopsis positive transformants:

Seed disinfection: Soak in 70% ethanol for 10 minutes, suspend the seeds from time to time during the above treatment; then wash four times with sterile water, it is best to suspend the seeds from time to time during this step. The treated seeds are evenly spread on the surface of 1/2MS solid screening medium containing 50 μg/ml kan for vernalization for 2 days (a plate with a diameter of 150 mm can sow up to 1,500 plants), at a constant temperature of 22°C, with a light intensity of 3500-4000 lx, and light The cycle is 12 hours of darkness and 12 hours of light cultivation, and the culture is 7-10 days. Judging whether it is a genetically modified seed or not is based on the growth status. The seeds successfully transformed with the recombinant plasmid can normally grow more than 4 true leaves on the resistant medium. Non-transgenic seeds cannot grow normally, only 2 cotyledons can grow, and the growth of roots is also severely inhibited, generally dying after 10 days of germination. After the transgenic seeds germinated on the MS+kan plate for 2 weeks, the positive plants were transferred to the soil to continue culturing. The transgenic Arabidopsis was detected by PCR with SEQ ID NO: 18 and SEQ ID NO: 19, and the negative plants were removed, and the seeds of the positive plants were collected , label: T0a1-T0a25.

Example 8 Planting of transgenic Arabidopsis thaliana T1 generation plants overexpressing ThNHX1

Choose vermiculite with good water absorption and soft soil quality combined with nutrient soil (1:1) as the soil for planting Arabidopsis thaliana. T0a1-T0a20 was sown in 2 pots for each transformant, and 2 pots were sown in the control Arabidopsis, and 20-30 seeds were sown in each pot. After sowing, cover the flowerpot with a film to provide a moist environment for the growth of the plant. Constant temperature 22°C, light intensity 3500-4000lx, light cycle 12 hours dark, 12 hours light culture, watering 1/2MS every 7 days, after 25 days of culture, transgenic Arabidopsis with SEQ ID NO: 18 and SEQ ID NO: 19 Do PCR testing, remove negative plants, and keep 12-14 positive seedlings. After continuing to cultivate for 10 days, select transgenic Arabidopsis of the same size and control Arabidopsis for salt tolerance experiments, and keep 7-9 plants of the same size in each pot Seedling.

Example 9 Salt Tolerance Experiment of Transgenic Arabidopsis T1 Generation Plants Overexpressing ThNHX1

One pot of transgenic Arabidopsis and one pot of control Arabidopsis were not treated, and 1/2 MS was normally watered, and one pot of transgenic Arabidopsis and control Arabidopsis was watered with 1/2 MS containing 150Mm NaCl, the constant temperature was 22°C, and the light intensity was 3500- 4000lx, 12 hours light culture/12 hours dark culture cycle. After 10 days, observe the experimental results: the salt tolerance identification of T1 generation transgenic plants (plants grown from the seeds of T0 generation transgenic plants) shows that three lines of T1 generation transgenic plants T1a4, T1a17, and T1a19 show obvious salt tolerance ( See Fig. 4, taking T1a4 as an example, the results of T1a7 and T1a19 are similar, not shown here).

Example 10 Verifying the expression of ThNHX1 gene at the transcriptional level

Among the salt-tolerant good T1 generation transgenic plants in Example 9, 8 were randomly selected (belonging to the above three salt-tolerant strains respectively), 4 were randomly selected from the control plants in Example 9, and 0.05% of the leaves of the salt treatment for 14 days were each cut. g, Total RNA was extracted with Plant RNA Extraction Kit (Invitrogen). The absorbance values of the obtained total RNA at 260nm and 280nm were measured by ultraviolet spectrophotometry, and the concentration of each RNA was calculated. Reverse transcription was performed according to the method indicated in the Invitrogen reverse transcription kit SuperScript III Reverse Transcriptase (1 μg of total RNA was used as a template, reverse transcription primer SEQ ID NO: 11). ThNHX1 was amplified by SEQ ID NO: 10 and SEQ ID NO: 20 (SEQ ID NO: 20: ATTCCGAGGA TTGTGCTAGT GA), and its transcription was detected. Using TaKaRa's PrimeSTAR HS DNA polymerase, the PCR reaction was carried out using the above-mentioned reverse-transcribed cDNA as a template. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 2.0 μl cDNA, 1.0 μl PrimeSTAR, 10 μM primers SEQ ID NO: 10 and 2.0 μl each of SEQ ID NO: 20, and 30 μl double distilled water. PCR reaction conditions: pre-denaturation at 94°C for 5 minutes, 32 cycles (denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute), and extension at 72°C for 10 minutes. The results of product electrophoresis are shown in Figure 5: M is DNA Ladder Marker (DL2000, purchased from Shenzhen Ruizhen Biotechnology Co., Ltd.), 1-4 are salt-intolerant control Arabidopsis plants, and 13 is the positive control of plasmid PCR (35S- ThNHX1-2300 plasmid), 5-12 is the salt-tolerant T1 generation transfer primer Arabidopsis plant. The size of the band shown in the figure is consistent with the size of the positive control (about 700bp). The results showed that ThNHX1 transcription was stronger in the salt-tolerant T1 transgenic Arabidopsis plants, but there was no ThNHX1 transcription in the salt-intolerant control Arabidopsis plants.

Claims (8)

1. a tonoplast sodium hydrogen antiporter protein for small salt mustard, its amino acid sequence such as SEQ ID NO：Shown in 1.

2. encode the gene of the tonoplast sodium hydrogen antiporter protein of claim 1, its nucleotide sequence such as SEQ ID NO：2 institutes Show.

3. a kind of recombinant expression carrier, it is by the way that the gene described in claim 2 is inserted into a kind of expression vector to obtain , and the nucleotide sequence of the gene is operably connected with the expression control sequence of the expression vector, the expression Carrier is pCAMBIA2300.

4. the recombinant expression carrier described in claim 3, it is the 35S-ThNHX1-2300 carriers shown in accompanying drawing 2.

5. a kind of recombinant cell, it contains the gene described in claim 2 or the recombination expression described in claim 3 or 4 carries Body；The recombinant cell is restructuring agrobatcerium cell.

6. a kind of method for improving plant salt tolerance, including：By described in the gene described in claim 2 or claim 3 or 4 Recombinant expression carrier imports plant or plant tissue and makes the gene expression；The plant is arabidopsis.

7. a kind of method of prepare transgenosis plant, including：Culture contains claim 2 institute under conditions of plant is effectively produced The plant for the recombinant expression carrier described in gene or claim 3 or 4 stated or plant tissue, wherein the plant is to intend south Mustard.

8. the recombinant expression carrier described in gene, claim 3 or 4 described in claim 2 or the weight described in claim 5 Group cell is used to improve plant salt endurance and the purposes for plant breeding, wherein the plant is arabidopsis.