CN105452284B

CN105452284B - A kind of cotton zinc finger protein ZPT5-3 and its encoding gene and application

Info

Publication number: CN105452284B
Application number: CN201380078636.1A
Authority: CN
Inventors: 何云蔚; 梁远金; 陈淼; 刘晓霞
Original assignee: Biocentury Seed Industry Co Ltd
Current assignee: Biocentury Seed Industry Co Ltd
Priority date: 2013-08-22
Filing date: 2013-08-22
Publication date: 2018-11-30
Anticipated expiration: 2033-08-22
Also published as: WO2015024145A1; CN105452284A

Abstract

Provide a kind of zinc finger protein ZPT5-3 and its encoding gene from cotton.It additionally provides zinc finger protein ZPT5-3 and its encoding gene and is cultivating the application in the genetically modified plants that salt tolerance improves.

Description

A kind of cotton zinc finger protein ZPT5-3 and its encoding gene and application

Technical field

The present invention relates to vegetable protein and its encoding gene and applications, and the zinc finger egg of cotton is derived from more particularly to one White ZPT5-3 and its encoding gene and its application in the genetically modified plants for cultivating salt tolerance raising.

Technical background

Salt stress is that world agriculture produces one of most important abiotic stress harm, and salt-affected soil is usually with sodium salt, calcium Based on salt or magnesium salts, become the principal element for influencing plant growth, leading to grain and the industrial crops underproduction.Saline-alkali soil in the world Area accounts for the 1/3 of irrigated farmland there are about 400,000,000 hectares.Salt-soda soil is extensive in distribution in China, and existing saline alkali land area about 0.4 hundred million is public Hectare.As China human mortality increases, the decrease of cultivated land, the development and utilization of saline alkali land resource have extremely important realistic meaning.And it plants Object salt resistance alkali, Drought resistance raising and be suitable for saline and alkaline aerial and with higher economy and the ecological value plant species Or the breeding of strain, then it is to utilize the economical and effective measure in salt-soda soil.For most crops, most plants pair Saline and alkaline, arid poor resistance, can only be grown in sodium chloride content is excessive Na in soil on 0.3% soil below⁺Meeting Toxic action is generated to the normal growth metabolism of plant.Therefore how to improve crop yield under salt marsh environment just becomes complete Particularly significant problem in world agriculture production.

The salt tolerance of plant is a sufficiently complex quantitative character, Mechanisms of Salt Resistance is related to from plant to organ, tissue, Each level of the Physiology and biochemistry up to molecule.The scientist of various countries has also done a large amount of work thus, and achieve it is many newly into Exhibition has the research in the field especially in terms of using salt tolerant molecule mechanism of the high model plant arabidopsis to study plant Breakthrough progress (Zhu JK.2002.Salt and drought stress singal transduction in plants.Annu.Rev.Plant Biol.53：1247-1273；Zhang ZL.2011.Arabidopsis Floral Initiator SKB1 Confers High Salt Tolerance by Regulating Transcription and Pre-mRNA Splicing through Altering Histone H4R3 and Small Nuclear Ribonucleoprotein LSM4 Methylation.Plant Cell, 23：396-411).

Higher plant cell can experience the variation of physico-chemical parameter in external environment through a variety of ways, thus by extracellular letter Number become intracellular signal, finally stress signal is transferred in nucleus by the signal transduction of series, activating transcription factor, and Activating transcription factor acts on functional gene, starts the expression of induced gene in adversity to improve the resistance of reverse of plant.Although Never ipsilateral has carried out numerous studies to researcher, but since its mechanism is sufficiently complex, and many in plant anti-salt important are asked Topic still needs to be explored.For example, the key factor of plant anti-salt is not found yet；The molecular mechanism of plant salt tolerance is not fully aware of.

Summary of the invention

The present inventor is cloned using the method that SSH (Subtractive hybridization) is combined with RACE (end cDNA rapid amplifying) The encoding gene of one zinc finger protein (being named as ZPT5-3 herein) of african cotton (Gossypium herbaceum L.), and Determine its DNA sequence dna.And it was found that the salt tolerant of recipient plant can be significantly improved after being conducted into recipient plant and expressing it Property, and these characters can stablize heredity.

The encoding gene that first aspect present invention provides a zinc finger protein ZPT5-3 for cotton (is named as herein GhZPT5-3), sequence is SEQ ID NO：2.

Second aspect of the present invention provides a kind of recombinant expression carrier, containing gene described in first aspect present invention, It is to be obtained and the gene is inserted into a kind of expression vector, and the nucleotide sequence of the gene and the expression The expression control sequence of carrier is operably connected；Preferably, the carrier is 35S-GhZPT5-3-2300 shown in Fig. 2 load Body.

Third aspect present invention provides a kind of recombinant cell, contains gene or this hair described in first aspect present invention Recombinant expression carrier described in bright second aspect；Preferably, the recombinant cell is recombination agrobatcerium cell.

Fourth aspect present invention provides a kind of method for improving plant salt endurance, including：It will be described in first aspect present invention Gene or second aspect of the present invention described in recombinant expression carrier import plant or plant tissue and make the gene expression； Preferably, the plant is arabidopsis.

Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：In the condition for effectively generating plant Lower plant of the culture containing recombinant expression carrier described in gene or second aspect of the present invention described in first aspect present invention Or plant tissue；Preferably, the plant is arabidopsis.

Sixth aspect present invention provides gene described in first aspect present invention, recombination table described in second aspect of the present invention Up to recombinant cell described in carrier or third aspect present invention for improving plant salt endurance and for the use of plant breeding On the way；Preferably, the plant is arabidopsis.

Seventh aspect present invention provides the protein of the coding of the gene as described in first aspect present invention, amino acid sequence Such as SEQ ID NO：Shown in 1.

Detailed description of the invention

Fig. 1 is building process (Fig. 1 a- of the plant expression vector (35S-GhZPT5-3-2300) of GhZPT5-3 gene 1b)。

Fig. 2 is the plasmid figure of the plant expression vector (35S-GhZPT5-3-2300) of GhZPT5-3 gene.

Fig. 3 is the T for turning GhZPT5-3 gene₁For transgenic Arabidopsis plants (right figure, T₁F6-4) and as non-turn of control The salt tolerant simulated experiment result of gene Arabidopsis plant (left figure, CK).

Fig. 4 is using reverse transcription PCR to T₁For GhZPT5-3 in transgenic Arabidopsis plants and non-transgenic control plant The verification result of gene Molecular Detection at transcriptional level.M is DL2000 DNA Ladder Marker, and 1-4 is not salt tolerant Non-transgenic control Arabidopsis plant, 5-12 be salt tolerant T1 (successively belong to T for transgenic Arabidopsis plants₁F6-4、T₁F6- 6、T₁F6-8 and T₁Tetra- salt-resistance strains of F6-9,2 plants of each strain), 13 is right for the 35S-GhZPT5-3-2300 plasmid PCR positive According to 14 compare for blank water.

Specific embodiment

Below in conjunction with non-limiting embodiment, invention is further explained.

It is public that the restriction enzyme that source is not specified mentioned in following embodiment is purchased from New England Biolabs Department.

Cotton SSH library construction under embodiment 1, salt stress：

Specific method is：

Utilize the PCR-select of Clontech company^TMMethod shown in cDNA Subtraction Kit passes through inhibition The building of subtractive hybridizing method inhibits subtracted library.During the experiment using the mRNA of the blade of the cotton seedling of salt treatment as sample This (tester), using the mRNA of the blade of untreated cotton seedling as control (driver).Specific steps are summarized as follows：

(1) material to be tested：

(National Cotton mid-term library obtains unit Cotton research institute, Unified number to african cotton：ZM-06838 it) is seeded into By being cultivated under the conditions of 25 DEG C, light dark period 16h/8h, pouring 1/2MS Liquid Culture weekly on the vermiculite matrix of sterilization treatment Base (KNO containing 9.39mM₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM of KI, 100μM H₃BO₃, 100 μM of MnSO₄, 30 μM of ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM FeSO₄) primary.As the long up to 25-30cm of seedling strain for testing.

(2) material processing：

2 groups, every group 4 plants will be divided into for examination seedling.First group is control group, cultivates under 25 DEG C, illumination, is placed into 1/2 In MS fluid nutrient medium.Second group is processing group, 25 DEG C, cultivate under illumination, is placed into added with final concentration of 200mM NaCl 1/2 MS fluid nutrient medium in, handle 6 hours, the blade of two groups of seedling of timely clip, cold rapidly with liquid nitrogen after being disposed After jelly, saved in -70 DEG C of refrigerators.

(3) Total RNAs extraction：

Control group and each 0.5g of the cotton leaf of salt treatment group are taken respectively, with plant RNA extraction kit (Invitrogen) total serum IgE of cotton leaf is extracted.Total serum IgE is measured with the ultraviolet specrophotometer U-2001 of HITACHI company In the absorbance value of 260nm and 280nm, OD₂₆₀/OD₂₈₀Ratio is 1.8-2.0, shows that total serum IgE purity is higher, with 1.0% fine jade The integrality of sepharose electrophoresis detection total serum IgE, the brightness of 28S band are about 2 times of 18S band, show that the integrality of RNA is good It is good.Use Oligotex mRNA purification kit (the Purification of poly A+ RNA from of Qiagen company Total RNA) separation mRNA.

(4) Subtractive hybridization：

By the PCR-select of Clontech company^TMSide shown in cDNA Subtraction Kit kit specification Method carries out Subtractive hybridization.Driver mRNA and Tester mRNA are first distinguished into reverse transcription, obtain double-strand cDNA, then with 2 μ G Tester cDNA and 2 μ g Driver cDNA carries out subtractive hybridization as starting material.Respectively will under 37 DEG C of water-baths Tester cDNA and Driver cDNA Rsa I digestion 1.5h, are then divided into two equal portions for the Tester cDNA after digestion, Different connector in connection, and Driver cDNA is not connected to head.Two kinds of Tester cDNA for being connected with different connectors respectively with mistake The Driver cDNA of amount is mixed, and carries out positive subtractive hybridization for the first time.The product of two kinds of first time subtractive hybridization is mixed, then Second of positive subtractive is carried out with the Driver cDNA being newly denaturalized to hybridize, and then passes through inhibition PCR amplification differential expression twice Segment, be enriched with it.

(5) building of cDNA subtracted library and preliminary screening, clone, identification

Method shown in product description according to pGEM-T Easy kit (being purchased from Promega), just by above-mentioned merging It (is purified, is purchased from using QIAquick PCR Purification Kit to second of PCR product of subtractive hybridization cDNA segment Qiagen it) is connect with pGEM-T Easy carrier, specific step is as follows：Following ingredients are sequentially added with 200 μ l PCR pipes：Purifying Positive subtractive hybridization cDNA segment second of PCR product, 3 μ l, T4 ligase buffer solution, 5 μ l, pGEM-T Easy carrier, 1 μ 1 μ l of l, T4 DNA ligase, overnight in 4 DEG C of connections.10 μ L connection reaction products are taken, 100 μ L e. coli jm109 senses are added to By in state cell (being purchased from TAKARA), then ice bath 30min, heat shock 60s, ice bath 2min are added 250 μ L LB culture solutions and (contain 1%Tryptone is purchased from OXOID, and 0.5%Yeast Extract is purchased from OXOID, and 1%NaCl is purchased from traditional Chinese medicines) set 37 DEG C of water-baths In, with 225r/min shaken cultivation 30min, the bacterium solution plantation after taking 200 μ L shaken cultivations is in containing 50 μ g/mL ampicillins (being purchased from Beijing Baeyer enlightening), 40 μ g/mL X-gal (the chloro- 3- indoles-β-D- galactoside of 5- bromo- 4), 24 μ g/mL IPTG are (different Propyl-β-D- Thiogalactopyranoside) (X-gal and IPTG are purchased from TAKARA) LB (ibid) solid culture plate on, 37 DEG C cultivate 18h.Count the clear white and blue colonies number of diameter > 1mm in culture plate, 300 white colonies of random picking (number：Gh-S2-001 to Gh-S2-300).All white colonies are inoculated in the LB containing 50 μ g/mL ampicillins respectively In 96 porocyte culture plates (CORNING) of fluid nutrient medium, glycerol adding is to final concentration 20% after 37 DEG C of overnight incubations, in -80 It DEG C saves backup.With nest-type PRC primer Primer 1 and the Primer 2R (PCR-select of Clontech company^TM cDNA Subtraction Kit kit is included) verifying of bacterium solution PCR amplification is carried out, 231 positive colonies are obtained, to all positive grams It is grand that Invitrogen (Shanghai) Trading Co., Ltd. is being sent to be sequenced

(6) the cDNA sequencing analysis of differential cloning：

After the cDNA that the DNA sequencing result of above-mentioned 231 differential clonings is removed to carrier and indefinite sequence and redundancy, altogether Obtain 203 effective EST (Unigene).

The clone of 2 african cotton zinc finger protein gene GhZPT5-3 of embodiment

After the sequencing result of clone Gh-S2-084 is removed redundant DNA, sequence is SEQ ID No：3, herein by SEQ ID No：3 corresponding overall length encoding genes are named as GhZPT5-3, and corresponding albumen is named as ZPT5-3.

SEQ ID No：3

The clone of GhZPT5-3 overall length encoding gene

To the SEQ ID No obtained：In 3 sequences, it was found that terminator codon TAA needs to obtain complete gene Carry out 5 ' RACE.

According to the SEQ ID No obtained：3 sequences design three specific primers, as reverse transcription primer and 5 ' 3 ' the end-specificity primers of RACE.

GhZPT5-3 GSP1：SEQ ID NO：4：

CGCTTGGGTT CAAAGCAG

GhZPT5-3 GSP2：SEQ ID NO：5：

GGCAGAGGTG GTTGTCGAC

GhZPT5-3 GSP3：SEQ ID NO：6：

CGCTGCAGTT GTAGCTAACC

Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification CDNA Ends kit is purchased from Invitrogen company).

With SEQ ID NO：5 and universal primer AAP (kit is included) is (anti-with the resulting cDNA of cotton mRNA reverse transcription Transcription primers SEQ ID NO：4) first round PCR amplification is carried out for template, specific step is as follows：

50 μ l PCR reaction systems：5 μ 10 × Ex of l μ l mRNA reverse transcriptions of Buffer, the dNTP of 3 μ l 2.5mM, 2.0 CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：5 and AAP each 2.0 μ l's and 35 μ l is double Steam water.PCR reaction condition：94 DEG C of initial denaturation 5min, (94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend 33 circulations 2min), 72 DEG C of extension 10min.

Take 2.0 μ l as template after using distilled water to dilute 50 times resulting PCR product, with SEQ ID NO：6 with it is general Primer AUAP (kit is included) carries out the second wheel PCR amplification, and specific step is as follows：50 μ l PCR reaction systems：5μl 10× Ex Buffer, the dNTP of 3 μ l 2.5mM, the diluted first round PCR product of 2.0 μ l, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：The distilled water of 6 and AUAP each 2.0 μ l and 35 μ l.PCR reaction condition：94 DEG C of initial denaturation 5min, 33 circulations (94 DEG C denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extension 10min.In recycling the second wheel PCR product about The band (being purchased from OMEGA using Gel Extraction Kit) of 650bp size, and it is connected to pGEM-T Easy carrier, Then it is transformed into JM109 competent cell (specific method is same as above), and the bacterium solution after conversion is coated on containing 50 μ g/mL Ampicillin, 40 μ g/mL X-gal, 24 μ g/mL IPTG LB solid medium on screened.Random picking 10 is white Color bacterium colony is inoculated in respectively in the LB liquid medium containing 50 μ g/mL ampicillins, and glycerol adding is extremely after 37 DEG C of overnight incubations Final concentration 20%, -80 DEG C save backup.Use SEQ ID NO：6 carry out the verifying of bacterium solution PCR amplification (instead with universal primer AUAP System and reaction condition is answered to be same as above), 3 positive colonies are obtained, send Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced, is somebody's turn to do 5 ' the ends of the cDNA of gene.

By gained sequence and SEQ ID No after the sequencing of resulting 5 ' RACE product cloning：3 sequence assemblies obtain SEQ ID NO：17：

According to SEQ ID NO：19 sequence design pair of primers are as follows：

GhZPT5-3 F：SEQ ID NO：7：

ATGGCTTTAG AAGCTCTCAA CTCTC

GhZPT5-3 R：SEQ ID NO：8：

CTAATTTGTT TCGTTGACTT GCAT

Use SEQ ID NO：7 and SEQ ID NO：8 clone GhZPT5-3 complete encoding sequence as primer.

Using the PrimeSTAR HS archaeal dna polymerase of TaKaRa, PCR reaction is carried out by template of the cDNA of cotton.50μl PCR reaction system：10 μ 5 × PS of l μ l of Buffer, the dNTP of 3 μ l 2.5mM, 2.0 cDNA, 1.0 μ l PrimeSTAR HS Archaeal dna polymerase, 10 μM of primer SEQ ID NO：7 and SEQ ID NO：The distilled water of 8 each 2.0 μ l and 30 μ l.PCR reaction Condition：94 DEG C of initial denaturation 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extensions 10min。

Pcr amplification product adds A tail：PCR product adds the dehydrated alcohol of 2.5 times of volumes, and -20 DEG C are placed 10 minutes, and centrifugation is gone Supernatant dries, and is dissolved with 21 μ l distilled waters.Be added 2.5 μ 10 × Ex of l Buffer, the dATP of 0.5 μ l 5mM, 2.5 μ l 10 × Ex Taq.Reaction condition：70 DEG C are reacted 30 minutes.The DNA fragmentation recycling for obtaining about 900bp (is used into Omega reclaim reagent Box), and be connected on pGEM T-easy carrier and (obtain GhZPT5-3-pGEM), then gained plasmid is transformed into In JM109 competent cell (method is same as above), and the bacterium solution after conversion is coated on containing 50 μ g/mL ampicillins, 40 μ g/mL X-gal, 24 μ g/mL IPTG LB solid medium on screened.Random 10 white colonies of picking be inoculated in respectively containing In the LB liquid medium of 50 μ g/mL ampicillins, glycerol adding to final concentration 20%, -80 DEG C is saved after 37 DEG C of overnight incubations It is spare.SEQ ID NO：7 and SEQ ID NO：8 carry out the verifying of bacterium solution PCR amplification (reaction system and reaction condition are same as above), obtain 4 positive colonies send to Invitrogen (Shanghai) Trading Co., Ltd. and are sequenced, and sequence is SEQ ID NO：2, coding ZPT5-3 protein amino acid sequence such as SEQ ID NO：Shown in 1.

The amino acid sequence of ZPT5-3 albumen：SEQ ID NO：1

The nucleotide sequence of GhZPT5-3 encoding gene：SEQ ID NO：2

3 GhZPT5-3 gene plant expression vector establishment of embodiment

Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd) As plant expression vector, 35S promoter of the NPTII gene containing double enhancers is replaced with Pnos promoter, to reduce NPTII egg The white expression in plant.Constitutive promoter 35S and terminator Tnos of the selection containing double enhancers are respectively as GhZPT5-3 The promoter and terminator of gene, building process are as shown in Figure 1.

Use primer SEQ ID NO：9 and SEQ ID NO：10 is (remote purchased from Beijing China with plant expression vector pBI121 Foreign Science and Technology Ltd.) it is template amplification Pnos, using the PrimeSTAR HS archaeal dna polymerase of TaKaRa.50 μ l PCR reaction System：10 μ 5 × PS of l μ l of Buffer, the dNTP of 3 μ l 2.5mM, 1.0 pBI121,1.0 μ l PrimeSTAR HS DNA are poly- Synthase, 10 μM of primer SEQ ID NO：9 and SEQ ID NO：The distilled water of 10 each 2.0 μ l and 31 μ l.PCR reaction condition： 94 DEG C of initial denaturation 5min, 33 circulations (94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.It is logical It crosses and gained PCR product is connected to pCAMBIA2300 (purchased from Promega, T4 ligase box) after EcoR I, Bgl II digestion obtains Obtain pCAMBIA2300-1.

SEQ ID NO：9：

GCACGAATTCATACAAATGGACGAACGGAT

SEQ ID NO：10：

ATCCAGATCTAGATCCGGTGCAGATTATTTG

Use primer SEQ ID NO：11 and SEQ ID NO：12 using pBI121 plasmid as template amplification Tnos, uses The PrimeSTAR HS archaeal dna polymerase of TaKaRa.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, 3 μ l 2.5mM's DNTP, 1.0 μ l pBI121,1.0 μ l PrimeSTAR HS archaeal dna polymerases, 10 μM of primer SEQ ID NO：11 and SEQ ID NO：The distilled water of 12 each 2.0 μ l and 31 μ l.PCR reaction condition：94 DEG C of initial denaturation 5min, 33 circulation (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.It is produced as the PCR by obtained by after Sac I, EcoR I digestion Object is connected to pCAMBIA2300-1 and obtains pCAMBIA2300-2.

SEQ ID NO：11：

AAGGAGCTCGAATTTCCCCGATCGTTCAAA

SEQ ID NO：12：

TCAGAATTCCGCAGACGCTGCACTTGT

Use primer SEQ ID NO：13 and SEQ ID NO：14 using pCAMBIA2300 plasmid as template amplification CaMV 35S Promoter.Using the PrimeSTAR HS archaeal dna polymerase of TaKaRa.50 μ l PCR reaction systems：10 μ l 5 × PS Buffer, The dNTP of 3 μ l 2.5mM, 1.0 μ l pCAMBIA2300 Plasmid DNA, 1.0 μ l PrimeSTAR HS archaeal dna polymerases, 10 μM Primer SEQ ID NO：13 and SEQ ID NO：The distilled water of 14 each 2.0 μ l and 31 μ l.PCR reaction condition：94 DEG C of initial denaturations 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.Pass through Hind Gained PCR product connection (connection method is same as above) to pCAMBIA2300-2 is obtained into pCAMBIA2300- after III, Pst I digestion 3。

SEQ ID NO：13：

ACTAAGCTTATGGTGGAGCACGACACTCTC

SEQ ID NO：14：

TGACTGCAGAGAGATAGATTTGTAGAGAGAGACTGGTG

Use primer SEQ ID NO：15 and SEQ ID NO：(template is that embodiment 2 obtains sun to 16 amplification GhZPT5-3 Property GhZPT5-3-pGEM plasmid), using the PrimeSTAR HS archaeal dna polymerase of TaKaRa.50 μ l PCR reaction systems：10μl 5 × PS μ l GhZPT5-3-pGEM plasmid of Buffer, the dNTP of 3 μ l 2.5mM, 1.0,1.0 μ l PrimeSTAR HS DNA are poly- Synthase, 10 μM of primer SEQ ID NO：15 and SEQ ID NO：The distilled water of 16 each 2.0 μ l and 31 μ l.PCR reacts item Part：94 DEG C of initial denaturation 5min, 33 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extensions 10min.Gained PCR product is connected into (connection method is same as above) to pCAMBIA2300-3 with after Sac I digestion with Pst I, and is passed through Verifying obtains plant expression vector 35S-GhZPT5-3-2300 (Fig. 2).

SEQ ID NO：15：

TGACTGCAG ATGGCTTTAGAAGCTCTCAACTCTC

SEQ ID NO：16：

AAGGAGCTC CTAATTTGTTTCGTTGACTTGCAT

4 35S-GhZPT5-3-2300 expression vector of embodiment converts Agrobacterium

The preparation of Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competent cell：By Agrobacterium LBA4404 draws single spot inoculation on the LB solid medium containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, 28 DEG C of cultures 1 to 2 days.Picking single colonie is inoculated in LB liquid medium of the 5ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, at 28 DEG C It is 0.4 that overnight incubation (about 12-16h), which is shaken, to OD600 value, forms seed bacterium solution.Bacterium solution (1: 20 ratio after taking 5ml to activate Example) it is inoculated in LB liquid medium of the 100ml containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, 2- is cultivated in 28 DEG C of shakes 2.5h to OD₆₀₀=0.8.Ice bath bacterium solution 10min, shakes up once every 3min, enables bacterium even into dormant state.At 4 DEG C 4000g is centrifuged 10min, abandons supernatant；10% glycerol resuspension thallus of a certain amount of ice pre-cooling is added, 4000g is centrifuged at 4 DEG C 10min collects precipitating；Ice-cold 10% glycerol repeats to wash 3-4 times；10% glycerol that appropriate ice pre-cooling is added suspends again Bacterial precipitation obtains LBA4404 competent cell.Then it is dispensed with 40 μ l/ pipes, is saved backup in -70 DEG C.

Convert Agrobacterium：Melt competent cell on ice, the embodiment 3 of 1 μ l is added into the competent cell of 40 μ l Obtained in positive 35S-GhZPT5-3-2300 plasmid, ice bath about 10min after mixing.By after ice bath competent cell and The electric shock cup for the 0.1cm specification that the mixture of 35S-GhZPT5-3-2300 plasmid is transferred to ice pre-cooling with micropipettor (is purchased from Bio-rad in), tapping makes suspension reach bottom, has been careful not to bubble.The electric shock cup is put into the slideway of electroporation chamber On, push slideway to put electric shock cup to electroporation chamber base electrode.By the program setting of MicroPulser (being purchased from bio-rad) For " Agr ", electric shock is once.Electric shock cup is taken out immediately, and the LB liquid medium of 28 DEG C of 1ml preheatings is added.Quick and soft use Micropipettor beats cell.Suspension is transferred to the centrifuge tube of 1.5ml, 28 DEG C, 225rpm culture 1h.Take 100~200 μ l Bacterium solution be coated on corresponding resistance screening culture medium flat plate (LB solid medium, contain 50 μ g/ml rifampins, 50 μ g/ml chains Mycin, 50 μ g/ml kanamycins), 28 DEG C of cultures.Positive transformants clone is screened, and its bacterium solution is saved backup in -70 DEG C.

Arabidopsis plantation of the embodiment 5 for conversion

Good water absorption is selected, soft vermiculite cooperation Nutrition Soil (1: 1) of soil property is used as arabidopsis planting soil.Diameter 9cm Flowerpot, every basin sows 20-30 arabidopsis seed, and (Colombia's type, the arabidopsis from Ohio State Univ-Columbus USA are raw Object resource center).The film in flowerpot upper cover later is sowed, provides a wet environment to the growth of plant.22 DEG C of constant temperature, Intensity of illumination 3500-4000lx, periodicity of illumination are 12h dark/12h illumination cultivation, the 1/2 MS Liquid Culture of pouring in every 7 days Base.After culture 30 days, every basin retains 4-5 plant, and periodicity of illumination is adjusted to 8h dark/16h illumination cultivation.To most of plant All after bolting, entire main tongue fur is cut in inflorescence base portion, removes its apical dominance, grows 4-6 new life at axillary bud position after about 1 week Side tongue can be used to convert when side tongue inflorescence forms bud and partially blooms or form 1-2 silique.

The leaching conversion of 6 thaliana flower of embodiment

By the bacterium of the Agrobacterium LBA4404 conversion positive colony of the resulting plasmid containing 35S-GhZPT5-3-2300 of embodiment 4 Liquid is seeded to overnight incubation in the LB liquid medium containing 50 μ g/ml kanamycins, and the next morning is seeded to 1: 50 to be contained Have in the new LB culture medium (1L) of 50 μ g/ml kanamycins, about 8 hours is cultivated, until agrobacterium liquid OD₆₀₀1.0 to 1.2 Between.5000rpm room temperature is centrifuged 5 minutes, abandons supernatant, and Agrobacterium precipitating is suspended in (1/2 in the dip dyeing culture medium of respective volume MS；Containing 5% sucrose；PH5.7 is adjusted to KOH；And contain 200 μ l/l Silwet L-77), make OD₆₀₀0.8 or so.By quasi- south The top of mustard slowly, is spirally immersed in the dip dyeing culture medium containing Agrobacterium, is gently shaken clockwise, about 2 minutes, with saturating Bright plastic jacket is covered tightly to keep humidity, is put into greenhouse and is stayed overnight.Plastic, transparent cover is removed after 24 hours, and water is irrigated.2-3 after immersion Guarantee that plant moisture is sufficient in week.When plant stops blooming, and first fruit pod maturation turns yellow, entangled with paper bag, when in paper bag After all fruit pods turn yellow, stop watering, seed is collected after drying in 1-2 weeks, carries out transformant screening.

The screening of 7 arabidopsis transgenic positive transformant of embodiment

Seed disinfection：It is first impregnated 10 minutes with 70% ethyl alcohol, and makes seed suspension every now and then；Then with sterile washing four It is secondary, and make seed suspension every now and then.Then, by treated, seed is uniformly coated on 1/2 MS containing 50 μ g/ml kanamycins On solid screening and culturing primary surface (plate of one piece of 150mm diameter at most sows 1500), 4 DEG C vernalization 2 days.Then, constant temperature 22 DEG C, intensity of illumination 3500-4000lx, periodicity of illumination be 8h dark/16h illumination condition under, cultivate 7-10 days.It can normally sprout It sends out and the seed grown is transgenic seed.The transgenic seed is flat in the 1/2 MS solid containing 50 μ g/ml kanamycins After sprouting 2 weeks on plate, it will survive and the positive plant of continued growth is transferred to soil and continues to cultivate, and every plant of clip 1-2 A blade extracts DNA as template, with primer SEQ ID NO：7 and SEQ ID NO：8 carry out PCR detection.Remove PCR detection Negative plant collects the seed of positive plant, respectively marked as T₀F6-1 to T₀F6-20 is simultaneously saved.

Embodiment 8 is overexpressed GhZPT5-3 transgenic arabidopsis T₁For the plantation of plant

Good water absorption is selected, soft vermiculite cooperation Nutrition Soil (1: 1) of soil property is used as arabidopsis planting soil.By T₀F2-1 To T₀The each transformation plant of F2-20 sows 2 basins, and non-transgenic control arabidopsis sows 2 basins, and every basin sows 20-30 seed.It broadcasts The film in flowerpot upper cover later is planted, provides a wet environment to the growth of plant.22 DEG C of constant temperature, intensity of illumination 3500- 4000lx, periodicity of illumination are 12h dark/12h illumination cultivation, the 1/2 MS fluid nutrient medium of pouring in every 7 days.Culture 25 days Afterwards, the blade of clip transgenic arabidopsis strain and its genomic DNA is extracted as template, with primer SEQ ID NO：7 and SEQ ID NO：8 carry out PCR detection.PCR feminine gender plant is removed, retains the positive seedling of 7-8, after continuing culture 10 days, every basin retains big Small 4-5 more consistent transgenic arabidopsis or non-transgenic control arabidopsis seedling carry out salt tolerant experiment.

Embodiment 9 is overexpressed GhZPT5-3 transgenic arabidopsis T₁For the salt tolerant experiment of plant

8 transgenic arabidopsis of Example, control each basin of arabidopsis are not dealt with, normal to pour the training of 1/2 MS liquid Support base；In addition transgenic arabidopsis, each basin of control arabidopsis are poured into the 1/2 MS fluid nutrient medium containing 150mM NaCl, 22 DEG C of constant temperature, intensity of illumination 3500-4000lx, 12 hours optical culture/12 hour dark culture circulations, observation experiment knot after 10 days Fruit.T₁For transgenic plant (T₀The plant grown up to for the seed of transgenic plant) Salt-Tolerance Identification show T₁F6-4、T₁F6- 6、T₁F6-8 and T₁Tetra- strains of F6-9 show significant salt tolerance (see Fig. 3, with T₁For F6-4, remaining person's result with etc Seemingly, not shown herein).

Embodiment 10 verifies ZPT5-3 protein expression on transcriptional level

By the good transgenosis T of salt-tolerance character in embodiment 9₁(above-mentioned T is belonging respectively to for randomly selecting 8 in plant₁F6- 4、T₁F6-6、T₁F6-8 and T₁Tetra- salt-resistance strains of F6-9,2 plants of each strain), adjoining tree randomly selects 4 in embodiment 6, Each clip 150mM NaCl handles 14 days blade 0.05g, extracts total serum IgE with plant RNA extraction kit (Invitrogen). Ultraviolet spectrophotometry total serum IgE calculates each RNA concentration in the absorbance value of 260nm and 280nm.According to Invitrogen Method shown in reverse transcription reagent box SuperScript III Reverse Transcriptase carries out reverse transcription (1 μ g total serum IgE As template, reverse transcription primer is SEQ ID NO：8).Pass through primer SEQ ID NO：7 and SEQ ID NO：8 amplification GhZPT5- 3, detect ZPT5-3 albumen relative expression's situation.

Pass through SEQ ID NO：17 and SEQ ID NO：18 primer amplification Atactin-2 (http:// Www.uniprot.org/uniprot/Q96292), the relative expression's situation for detecting house-keeping gene Actin-2 albumen, as interior Ginseng.Using the PrimeSTAR HS archaeal dna polymerase of TaKaRa, use is with the cDNA of AP primer (kit is included) reverse transcription Template carries out PCR reaction.50 μ l PCR reaction systems：10 μ 5 × PS of l Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l CDNA, 1.0 μ l PrimeSTAR HS archaeal dna polymerases, 10 μM of primer SEQ ID NO：17 and SEQ ID NO：18 each 2.0 μ The distilled water of l and 30 μ l.PCR reaction condition：94 DEG C of initial denaturation 5min, 32 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extension 10min.

SEQ ID NO：17：

GCTGATGATATTCAACCAATCGTG

SEQ ID NO：18：

CTCTGCTGTTGTGGTGAACATG

Pass through SEQ ID NO：7 and SEQ ID NO：8 primer amplification GhZPT5-3 detect ZPT5-3 albumen relative expression's feelings Condition.Using the PrimeSTAR HS archaeal dna polymerase of TaKaRa, PCR reaction is carried out by template of the cDNA of reverse transcription.50μl PCR reaction system：10 μ 5 × PS of l μ l of Buffer, the dNTP of 3 μ l 2.5mM, 2.0 cDNA, 1.0 μ l PrimeSTAR HS Archaeal dna polymerase, 10 μM of primer SEQ ID NO：7 and SEQ ID NO：The distilled water of 8 each 2.0 μ l and 30 μ l.PCR reaction Condition：94 DEG C of initial denaturation 5min, 32 circulations (94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extensions 10min。

Product electrophoresis result is as shown in Figure 4.Two part bands up and down as shown in the figure be belonging respectively to GhZPT5-3 with Atactin-2, using Atactin-2 as internal reference.1-4 is the non-transgenic control Arabidopsis plant of not salt tolerant, and 5-12 is salt tolerant T1 (successively belong to T for transgenic Arabidopsis plants₁F6-4、T₁F6-6、T₁F6-8 and T₁Tetra- salt-resistance strains of F6-9, each strain It is 2 plants), 13 be 35S-GhZPT5-3-2300 plasmid PCR positive control, and 14-17 is that salt tolerant Arabidopsis plant (does not divide transgenosis Belong to 2 strains, each 2 plants of detection), 18 be the blank control without template.The result shows that salt tolerant non-transgenic control arabidopsis is not planted Transcription without GhZPT5-3 in strain, salt tolerant transgenic arabidopsis T₁It is higher for the transcriptional level of GhZPT5-3 in plant, not salt tolerant The transcriptional level of transgenic Arabidopsis plants GhZPT5-3 is very low.

Claims

1. a zinc finger protein for cotton, sequence is SEQ ID NO：1.

2. encoding the gene of the zinc finger protein of claim 1, sequence is SEQ ID NO：2.

3. a kind of recombinant expression carrier is obtained and gene as claimed in claim 2 is inserted into a kind of expression vector , and the nucleotide sequence of the gene is operably connected with the expression control sequence of the expression vector；The expression Carrier is pCAMBIA2300.

4. a kind of recombinant cell contains gene as claimed in claim 2 or recombinant expression carrier as claimed in claim 3； The recombinant cell is recombination agrobatcerium cell.

5. a kind of method for improving plant salt endurance, including：By gene as claimed in claim 2 or as claimed in claim 3 Recombinant expression carrier imports plant or plant tissue and makes the gene expression；The plant is arabidopsis.

6. a kind of method of prepare transgenosis plant, including：Culture contains claim 2 institute under conditions of effectively generating plant Plant or the plant tissue of the gene or recombinant expression carrier as claimed in claim 3 stated, wherein the plant is arabidopsis.

7. gene as claimed in claim 2, recombinant expression carrier as claimed in claim 3 or recombination as claimed in claim 4 Cell is for improving plant salt endurance and the purposes for plant breeding, wherein the plant is arabidopsis.