CN105008389B - A kind of small salt mustard molybdenum cofactors vulcanization enzyme MCSU-2 and its encoding gene and application - Google Patents

Abstract

The present invention relates to vegetable protein and its encoding gene and applications, more particularly to a molybdenum cofactors vulcanization enzyme ThMCSU-2 and its encoding gene from small salt mustard and its application in the genetically modified plants for cultivating drought tolerance raising.

Description

A kind of small salt mustard molybdenum cofactors vulcanization enzyme MCSU-2 and its encoding gene and application

Technical field

The present invention relates to vegetable protein and its encoding gene and applications, auxiliary more particularly to a molybdenum from small salt mustard The enzyme factor vulcanizes enzyme MCSU-2 and its encoding gene and it is cultivating the application in the genetically modified plants that drought tolerance improves.

Background technique

The environment stresses such as temperature, salt marsh and arid can cause to seriously endanger to the growth and development of higher plant, lead to crop Yield reduces, and quality decline seriously threatens agricultural production and natural environment.Wherein influence of the arid to crop yield, many Account for the first in natural adverse circumstance, harm are equivalent to the sum of other disasters, are the bottlenecks that many areas are agricultural development.According to statistics, World's arid, semiarid zone account for the 34% of land area；China's arid, semiarid zone account for about the 52% of national territorial area, year Area suffered from drought reaches ten thousand hectares of 200-270, and national about 30 billion cubic meter of the annual water shortage in irrigation district receives grain 350- because of water shortage less 40000000000 kilograms；Especially China relationship and primary grain producing such as North China, northeast and northwest is the area of China's water shortage most serious, spring drought frequency It is numerous to reach 10 years nine chances.

Drought resistance in plants belongs to the quantitative character of controlled by multiple genes mostly, utilizes the drought resisting of conventional breeding methods Crop Improvement Property by the period is long, quality germplasm shortage is limited.Transcription group in recent years, protein science and gene expression regulation Preliminary Study discloses the effect molecule mechanism of plant drouhgt stress.Currently, improving plant using drought stress related gene Drought-resistant ability has become the research hotspot of plant stress-resistance molecular biology and the research side that plant stress-resistance genetic engineering is important To.

Corresponding responsing reaction can be generated when plant is by environment stress, is come with reducing or eliminating environment stress to vegetational zone Harm.This responsing reaction of plant is one and is related to the complex process of polygenes, multi signal approach and polygenes product.But For current research situation, since its mechanism is sufficiently complex, many plants are to the biochemistry under adverse circumstance and physiologically Response mechanism still need to be studied.Research in terms of the function of degeneration-resistant response gene and expression regulation will be to plant stress-resistance The research of connection and entire signal transmitting network system between relevant signaling pathways provides important basis.

Summary of the invention

The present inventor is cloned using the method that SSH (Subtractive hybridization) is combined with RACE (end cDNA rapid amplifying) The encoding gene of molybdenum cofactors vulcanization enzyme (being named as MCSU-2 herein) of small salt mustard, and determine its DNA sequence dna. And it was found that the drought tolerance of transgenic plant, and these characters can be significantly improved after being conducted into recipient plant overexpression Heredity can be stablized.

The encoding gene that first aspect present invention provides the molybdenum cofactors vulcanization enzyme MCSU-2 of small salt mustard (is ordered herein Entitled ThMCSU-2), sequence is SEQ ID NO：2.

Second aspect of the present invention provides a kind of recombinant expression carrier, containing gene described in first aspect present invention, It is to be inserted into a kind of expression vector by the gene to obtain, it is preferable that the expression vector is pCAMBIA2300；And And the nucleotide sequence of the gene is operably connected with the expression control sequence of the recombinant expression carrier；Preferably, institute Stating recombinant expression carrier is attached 35S-ThMCSU-2-2300 carrier shown in Fig. 2.

Third aspect present invention provides a kind of recombinant cell, contains gene or this hair described in first aspect present invention Recombinant expression carrier described in bright second aspect；Preferably, the recombinant cell is recombination agrobatcerium cell.

Fourth aspect present invention provides a kind of method for improving drought resistance in plants, including：It will be described in first aspect present invention Gene or second aspect of the present invention described in recombinant expression carrier import plant or plant tissue and make the gene expression； Preferably, the plant is arabidopsis.

Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：In the condition for effectively generating plant Lower plant of the culture containing recombinant expression carrier described in gene or second aspect of the present invention described in first aspect present invention Or plant tissue；Preferably, the plant is arabidopsis.

Sixth aspect present invention provides gene described in first aspect present invention, recombination table described in second aspect of the present invention Up to recombinant cell described in carrier or third aspect present invention for improving drought resistance in plants and for the use of plant breeding On the way；Preferably, the plant is arabidopsis.

Seventh aspect present invention provides the protein of the coding of the gene as described in first aspect present invention, amino acid sequence Such as SEQ ID NO：Shown in 1.

Detailed description of the invention

Fig. 1 is the building process (Fig. 1 a-1b) of the plant expression vector (35S-ThMCSU-2-2300) of ThMCSU-2.

Fig. 2 is the plasmid figure of the plant expression vector (35S-ThMCSU-2-2300) of ThMCSU-2.

Fig. 3 be ThMCSU-2T2 for transgenic Arabidopsis plants (in figure, T2H3；T2H4) and as control non-transgenic The drought-enduring simulated experiment result of Arabidopsis plant (in figure, CK1, CK2).(Fig. 3 a is 20 days Arabidopsis plants of normal growth；Figure 3b is 14 days Arabidopsis plants of Osmotic treatment after normal growth 20 days).

Fig. 4 is T2 under drought stress and normal growing conditions for transgenic Arabidopsis plants and adjoining tree ABA content Change testing result.1-8 is followed successively by strain：T2H1, T2H2, T2H3, T2H4, T2H5, T2H6, CK1, CK2, wherein T2H1, T2H2, T2H3, T2H4, T2H5, T2H6 are transgenic plant, and CK1, CK2 are adjoining tree.

Fig. 5 is to T2 using reverse transcription PCR for ThMCSU-2 in transgenic Arabidopsis plants and non-transgenic control plant The result for the molecular level detection that gene is carried out in transcriptional level.M is DNA Ladder Marker (DL2000, TakaRa), 1- 4 be the inapparent transgenic arabidopsis T2 of drought-enduring effect for plant, and 5-11 is drought-enduring effective transgenic arabidopsis T1 generation Plant (is followed successively by：T2H1, T2H2, T2H3, T2H4, T2H5, T2H6, T2H7), 12-17 is non-transgenic Arabidopsis plant.

Specific embodiment

Below with reference to non-limiting embodiment, invention is further explained.

It is public that the restriction enzyme that source is not specified mentioned in following example is purchased from New England Biolabs Department.

Small salt mustard SSH library construction under embodiment 1, drought stress：

Specific method is：

According to the PCR-select of Clontech company^TMShown in cDNA Subtraction Kit kit specification Method passes through the Subtractive hybridization method building library SSH (subtracted library).During the experiment in growth course arid at The mRNA of the blade of the small salt mustard seedling of reason is made as sample (Tester) with the mRNA of the blade of untreated small salt mustard seedling For control (Driver).Specific step is as follows：

(1) material to be tested：

(it is green to be purchased from inner mongolia Bayannur carex meyeriana to small salt mustard by Thellungiella halophila Color botanical garden halophytes Breeding Center) it is seeded on the vermiculite of sterilizing, in 25 DEG C, 16 hours photoperiods illumination/8 hour dark It is cultivated under the conditions of (light intensity 2000-3000Lx), pours 1/2MS culture medium (9.39mM KNO weekly₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM of KI, 100 μM of H₃BO₃, 100 μM of MnSO₄, 30 μM ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM of FeSO₄) primary.When seedling strain diameter reaches 5- For testing when 6em.

(2) material processing：

2 groups will be divided into for examination seedling, every group of 4 basins, 1 plant of every basin.First group is control group, at 25 DEG C, the photoperiod 16 hours It is cultivated under the dark condition of illumination/8 hour, just common 1/2MS culture medium pours.Second group is Osmotic treatment group, 25 DEG C, photoperiod It is cultivated under 16 hours illumination/8 hour dark conditions, stops pouring, processing 10 days, then two groups of seedling apicals 1/3 of timely clip Blade saved in -70 DEG C of refrigerators after liquid nitrogen quick freeze.

(3) Total RNAs extraction：

The small salt mustard blade 0.5g for taking control group and Osmotic treatment group respectively, (is purchased from plant RNA extraction kit Invitrogen the total serum IgE of small salt mustard blade) is extracted.Gained is measured with the ultraviolet specrophotometer U-2001 of HITACHI company Absorbance value of the total serum IgE in 260nm and 280nm, OD₂₆₀/OD₂₈₀Ratio is 1.8-2.0, shows that total serum IgE purity is higher；With The integrality of 1.0% agarose gel electrophoresis detection total serum IgE, the brightness of 28S band is about 2 times of 18S band, shows RNA Integrality it is good.Use the Oligotex mRNA purification kit (polyA+RNA is purified from total serum IgE) of Qiagen company Separate mRNA.

(4) Subtractive hybridization：

By the PCR-select of Clontech company^TMMethod shown in cDNA Subtraction Kit kit specification Carry out Subtractive hybridization.Driver mRNA and Tester mRNA are first distinguished into reverse transcription, obtain double-strand cDNA, then with 2 μ g Tester cDNA and 2 μ g Driver cDNA carries out subtractive hybridization as starting material.Respectively by Tester under 37 DEG C of water-baths CDNA and Driver cDNA Rsa I digestion 1.5 hours, is then divided into two equal portions for the Tester cDNA after digestion, connection Upper different connector, and Driver cDNA is not connected to head.Two kinds of Tester cDNA for being connected with different connectors respectively with it is excessive Driver cDNA mixing carries out positive subtractive hybridization for the first time.The product of two kinds of first time subtractives hybridization is mixed, then with newly The Driver cDNA of denaturation carries out second of positive subtractive hybridization, then passes through the piece of inhibition PCR amplification differential expression twice Section, is enriched with it.

The effective of EST (Expressed Sequence Tag, EST) (Unigene) is obtained in order to increase Property, avoid gene without restriction enzyme site and obtained sequence in non-translational region, this experiment presses above-mentioned step with restriction endonuclease HaeIII simultaneously Suddenly digestion is carried out to Tester cDNA and Driver cDNA and successively carries out positive subtractive hybridization and twice inhibition PCR twice Amplification finally merges second of inhibition PCR product of two groups of forward direction subtractive hybridization cDNA segments.

(5) building of subtracted library and preliminary screening, clone, identification

According to method shown in pGEM-T Easy kit (kit purchased from Promega) product description, by above-mentioned conjunction And positive subtractive hybridization cDNA segment second of pcr amplification product (use QIAquick PCR Purification Kit Purifying is purchased from Qiagen) it is connect with pGEM-T Easy carrier, specific step is as follows：It is sequentially added in 200 μ l PCR pipes Following ingredients：Second 3 μ l of inhibition PCR product, 2 × T4DNA of the positive subtractive hybridization cDNA segment after the merging of purifying 5 μ l of ligase buffer solution, 1 μ l of pGEM-T Easy carrier, 1 μ l of T4DNA ligase, overnight in 4 DEG C of connections.Then 10 μ l is taken to connect Reaction product is connect, is added in 100 μ l competent E.coli JM109 (purchased from TAKARA), ice bath 30 minutes, heat shock 60 Second, ice bath 2 minutes, separately adding 250 μ l LB culture solutions, (1% tryptone (Tryptone is purchased from OXOID), 0.5% yeast extracts Object (Yeast Extract is purchased from OXOID), 1%NaCl (being purchased from traditional Chinese medicines)) it is placed in 37 DEG C of shaking tables, it was shaken with 225r/ minutes Culture 30 minutes is swung, then therefrom takes that 200 μ l bacterium solutions are coated on containing 50 μ g/ml ampicillins, (5- is bromo- by 40 μ g/ml X-gal 4 chloro- 3- indoles-β-D- galactosides), 24 μ g/ml IPTG (isopropyl-beta D-thio galactopyranoside) (X-gal/IPTG Purchased from TAKARA) LB (ibid) solid culture plate on, 37 DEG C cultivate 18 hours.Diameter > 1mm's is clear in counting culture plate Clear white and blue colonies number, 198 white colonies of random picking (number：Gh-B001 to Gh-B198).By the white of institute's picking Color colony clone is inoculated in the LB liquid training containing 50 μ g/ml ampicillins in 96 porocyte culture plates (CORNING) respectively Base is supported, glycerol adding to final glycerol concentration is 20% (volume ratio) after 37 DEG C of overnight incubations, is then saved backup in -80 DEG C.To institute The colony clone of culture is with nest-type PRC primer Primer 1 and the Primer 2R (PCR-select from Clontech company^TM CDNA Subtraction Kit kit) verifying of bacterium solution PCR amplification is carried out, 166 positive colonies are obtained, then by all sun Property, which is cloned in, send Invitrogen (Shanghai) Trading Co., Ltd. to be sequenced.

(6) the cDNA sequencing analysis of differential cloning：

After the cDNA that DNA sequencing result is removed to carrier and indefinite sequence and redundancy, 123 expressed sequence marks are obtained It signs (Expressed sequence tag, EST) (Unigene).There are 22 contigs through analysis, there are 101 single sequences. Through BlastN discovery, wherein 53 EST (Unigene) have a homologous sequence in GenBank, 21 EST Unknown Functions or be false Determine albumen, separately there are 27 EST not obtain homologous matching, thus it is speculated that may be the shorter sequence in 3 ' or 5 ' end non-translational regions.

The clone of the small salt mustard molybdenum cofactors of embodiment 2 vulcanization enzyme coding gene ThMCSU-2

After the clone from bacterium colony Gh-B001 removes redundant DNA in the small library salt mustard SSH of the identification, sequence For SEQ ID No：3, sequence is analysis shows the amino acid sequence of the coding of the sequence and known molybdenum cofactors vulcanize enzyme amino Acid sequence has compared with high homology, and the corresponding overall length encoding gene of clone YLS-1 is named as ThMCSU-2 herein, corresponding Albumen is named as MCSU-2.

SEQ ID No：3

The clone of MCSU-2 overall length encoding gene

According to the SEQ ID No obtained：The analysis of 3 sequences：SEQ ID No：3 be the 3 end sequences of encoding gene MCSU-2 Column.

According to the SEQ ID NO obtained：3 sequences design following three specific primers, as reverse transcription primer and 3 ' the end-specificity primers of 5 ' RACE.

YLS-1GSP1：SEQ ID NO：4：

CATTGATTCTAGTTTCCTCGTC

YLS-1GSP2：SEQ ID NO：5：

ATGGCTCCTTGGATCATATG

YLS-1 GSP3：SEQ ID NO：6：

CGAGAATGGA TGATTCAGG

Kit carries universal primer：

AAP：SEQ ID NO：7：

GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG

AUAP：SEQ ID NO：8：

GGCCACGCGTCGACTAGTAC

Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification CDNA Ends kit is purchased from Invitrogen company).

With YLS-1GSP1 (SEQ ID NO：It 4) is reverse transcription primer, the mRNA extracted with the small salt mustard leaf of Osmotic treatment group Reverse transcription is carried out for template, cDNA template is obtained, then adds Poly C according to the step in above-mentioned 5 ' RACE kit specification Tail carries out first round PCR amplification by template of the product after tailing, and the primer is SEQ ID NO：4 and universal primer SEQ ID NO：7 (kit is included, and I is a, c, g or t) of hypoxanthine modification, and specific step is as follows：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l mRNA reverse transcriptions CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：4 and SEQ ID NO：7 each 2.0 μ l and 35 The distilled water of μ l.PCR reaction condition：94 DEG C initial denaturation 5 minutes, 33 circulation (94 DEG C be denaturalized 50 seconds, 54 DEG C anneal 50 seconds, 72 DEG C extend 1 minute), 72 DEG C extend 10 minutes.

Resulting PCR product takes 2.0 μ l as template after using distilled water to dilute 50 times, with SEQ ID NO：5 draw with general Object SEQ ID NO：8 carry out the second wheel PCR amplification, and specific step is as follows：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, the 2.0 μ l diluted first round PCR product, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：5 and SEQ ID NO：Double steamings of 8 each 2.0 μ l and 35 μ l Water.PCR reaction condition：94 DEG C initial denaturation 5 minutes, 33 circulation (94 DEG C be denaturalized 50 seconds, 54 DEG C anneal 50 seconds, 72 DEG C extend 1 point Clock), 72 DEG C extend 10 minutes.Recycle band (the Gel Extraction Kit purchase of about 1Kbp size in second of PCR product From OMEGA), and it is connected to pGEM-T Easy carrier, is then transformed into escherichia coli jm109 competent cell (specific Method is same as above), and screened on the LB solid medium containing 50 μ g/mL ampicillins.The white bacterium of random picking 10 It falls to be inoculated in respectively in the LB liquid medium containing 50 μ g/ml ampicillins and cultivate, glycerol adding is extremely after 37 DEG C of overnight incubations Final glycerol concentration is 20% (volume ratio), and -80 DEG C save backup.With primer SEQ ID NO：5 and 3 ' end primer SEQ ID NO：6 It carries out bacterium solution PCR amplification (reaction system and reaction condition are same as above), obtains 3 positive colonies (YJ1-1, YJ1-2, YJ1-3), send Invitrogen's sequencing sequencing, obtains one section of 5 ' terminal sequence of the cDNA of the gene.

It is SEQ ID NO that the resulting sub- YJ1-1 sequencing of 5 ' RACE product cloning, which obtains sequence,：9：

The sequence SEQ ID NO that 5 ' RACE are obtained：9, the sequence SEQ ID NO with acquisition：3 splicings, obtain SEQ ID NO：10：

According to SEQ ID NO：The analysis of 10 sequences, SEQ ID NO：The full length sequence of 10 non-ThMCSU-2.Need further into 5 ' RACE of row.Following three specific primers are designed, the 3 ' end-specificity as the reverse transcription primer of a new round and 5 ' RACE are drawn Object.

SEQ10 GSP1：SEQ ID NO：11：

CAAGTTGAATGTAACCGTTGG

SEQ10 GSP2：SEQ ID NO：12：

AGAACACATACACCAGTCCCG

SEQ10 GSP3：SEQ ID NO：13：

ACTGTTGCTGCTTCAATTGCTG

Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification CDNA Ends kit is purchased from Invitrogen company).

With SEQ ID NO：11 be reverse transcription primer, is carried out using the mRNA that the small salt mustard leaf of Osmotic treatment group extracts as template Reverse transcription obtains cDNA template, then adds Poly C tail according to the step in above-mentioned 5 ' RACE kit specification, after tailing Product be template carry out first round PCR amplification, the primer be SEQ ID NO：11 and universal primer SEQ ID NO：7 (examinations Agent box is included, and I is a, c, g or t) of hypoxanthine modification,

Specific step is as follows：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l mRNA reverse transcriptions CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：11 and SEQ ID NO：7 each 2.0 μ l and The distilled water of 35 μ l.PCR reaction condition：94 DEG C initial denaturation 5 minutes, 33 circulation (94 DEG C be denaturalized 45 seconds, 57 DEG C anneal 45 seconds, 72 DEG C extend 90 seconds), 72 DEG C extend 10 minutes.

Resulting PCR product takes 2.0 μ l as template after using distilled water to dilute 50 times, with SEQ ID NO：12 draw with general Object SEQ ID NO：8 carry out the second wheel PCR amplification, and specific step is as follows：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, the 2.0 μ l diluted first round PCR product, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：12 and SEQ ID NO：Double steamings of 8 each 2.0 μ l and 35 μ l Water.PCR reaction condition：94 DEG C initial denaturation 5 minutes, 33 circulation (94 DEG C be denaturalized 45 seconds, 58 DEG C anneal 45 seconds, 72 DEG C extend 90 Second), 72 DEG C extend 10 minutes.Recycle about band (the Gel Extraction of 1.1K bp size in second of PCR product Kit is purchased from OMEGA), and it is connected to pGEM-T Easy carrier, then it is transformed into escherichia coli jm109 competent cell (specific method is same as above), and screened on the LB solid medium containing 50 μ g/mL ampicillins.Random picking 8 is white Color bacterium colony is inoculated in the LB liquid medium containing 50 μ g/ml ampicillins respectively and cultivates, after 37 DEG C of overnight incubations plus sweet Oil to final glycerol concentration is 20% (volume ratio), and -80 DEG C save backup.With primer SEQ ID NO：12 and 3 ' end primer SEQ ID NO：13 carry out bacterium solution PCR amplification (reaction system and reaction condition are same as above), obtain 3 positive colonies (Ts-2, Ts-3 and Ts- 5), Invitrogen (Shanghai) Trading Co., Ltd. is sent to be sequenced, obtains one section of 5 ' terminal sequence of the cDNA of the gene.

It is SEQ ID NO that the sub- Ts-5 sequencing of 5 ' RACE product clonings of resulting second wheel, which obtains sequence,：14：

The sequence SEQ ID NO that second 5 ' RACE of wheel are obtained：14, with sequence SEQ ID NO：10 splicings, obtain SEQ ID NO：15：

According to SEQ ID NO：15 sequence design pair of primers are as follows：

ThMCSU-2F：SEQ ID NO：16：

ATGGAAGAATTTCTTAAGGAA

ThMCSU-2R：SEQ ID NO：17：

TTATTCAGTATTTGGATTTACTTC

AP：SEQ ID NO：18：

GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT

Pass through SEQ ID NO：11 and SEQ ID NO：12 clone ThMCSU-2 complete encoding sequence.

Small salt mustard RNA is extracted, with primer SEQ ID NO：18 be reverse transcription primer, obtains small salt mustard cDNA.Using The PfuUltra II Fusion HS DNA Polymerase of Stratagene carries out PCR by template of the cDNA of small salt mustard Reaction.50 μ l PCR reaction systems：5 μ l 10 × PfuUltra II reaction Buffer, 0.5 μ l 25mM dNTP, 2.0 μ l cDNA, 1.0 μ l PfuUltra II Fusion HS DNA Polymerase, 10 μM of primer SEQ ID NO：16 With SEQ ID NO：The distilled water of 17 each 2.0 μ l and 37.5 μ l.PCR reaction condition：95 DEG C initial denaturation 2 minutes, 35 circulation (95 DEG C are denaturalized 25 seconds, and 50 DEG C are annealed 30 seconds, and 72 DEG C extend 2 minutes), 72 DEG C extend 5 minutes.

Pcr amplification product adds A tail：PCR product adds the dehydrated alcohol of 2.5 times of volumes, and -20 DEG C are placed 10 minutes, and centrifugation is gone Supernatant dries, and is dissolved with 21 μ l distilled waters.2.5 μ 10 × Ex of l Buffer, the dATP of 0.5 μ l 5mM, 1.0 μ l Ex are added Taq.Reaction condition：70 DEG C are reacted 30 minutes.It will obtain the DNA fragmentation recycling (Omega QIAquick Gel Extraction Kit) of about 2.4Kbp, connection (ThMCSU-2-pGEM plasmid is obtained) on to pGEM T-easy carrier, then converts JM109,8 white colonies of random picking It is inoculated in the LB liquid medium containing 50 μ g/ml ampicillins and cultivates respectively, glycerol adding is to end after 37 DEG C of overnight incubations Concentration 20% (volume ratio), -80 DEG C save backup.With primer SEQ ID NO：16 and SEQ ID NO：17 carry out bacterium solution PCR expansion Increase (reaction system and reaction condition are same as above), obtain 3 positive colonies, send to Invitrogen (Shanghai) Trading Co., Ltd. and survey Sequence, sequence are SEQ ID NO：2, the amino acid sequence of the albumen of coding is SEQ ID NO：1.

The amino acid sequence of MCSU-2 albumen：SEQ ID NO：1

The nucleotide sequence of encoding gene ThMCSU-2：SEQ ID NO：2

3 ThMCSU-2 gene plant expression vector establishment of embodiment

Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd) As plant expression vector, 35S promoter of the NPTII gene containing double enhancers is replaced with Pnos promoter, to reduce NPTII egg The white expression in plant.35S promoter and Tnos terminator of the selection containing double enhancers are respectively as ThMCSU-2 gene Promoter and terminator.It is as shown in Figure 1 to construct flow chart.

Use primer SEQ ID NO：19 and SEQ ID NO：20 is (remote purchased from Beijing China with plant expression vector pBI121 Foreign Science and Technology Ltd.) it is template amplification Pnos, using the PrimeSTAR HS archaeal dna polymerase of TaKaRa.50 μ l PCR reaction System：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM draw Object SEQ ID NO：19 and SEQ ID NO：The distilled water of 20 each 2.0 μ l and 31 μ l.PCR reaction condition：94 DEG C of initial denaturations 5 are divided Clock, 33 circulations (94 DEG C are denaturalized 30 seconds, and 56 DEG C are annealed 30 seconds, and 72 DEG C extend 30 seconds), 72 DEG C extend 10 minutes.By EcoRI, Gained PCR product pCAMBIA2300 (Promega, T4 connect enzyme reagent kit) is connected to after BglII digestion to obtain pCAMBIA2300-1。

SEQ ID NO：19：

GCACGAATTCATACAAATGGACGAACGGAT

SEQ ID NO：20：

ATCCAGATCTAGATCCGGTGCAGATTATTTG

SEQ ID NO：21 and SEQ ID NO：22 using pBI121 as template amplification Tnos, using TaKaRa's PrimeSTAR HS archaeal dna polymerase.50 μ l PCR reaction systems：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：16 and SEQ ID NO：17 each 2.0 μ l and 31 μ l Distilled water.PCR reaction condition：94 DEG C initial denaturation 5 minutes, 33 circulation (94 DEG C be denaturalized 30 seconds, 58 DEG C anneal 30 seconds, 72 DEG C Extend 30 seconds), 72 DEG C extend 10 minutes.PCAMBIA2300-1 is connected to as the PCR product by obtained by after KpnI, EcoRI digestion (Promega T4 connection enzyme reagent kit) obtains pCAMBIA2300-2.

SEQ ID NO：21：

CGGGGTACCGAATTTCCCCGATCGTTCAAA

SEQ ID NO：22：

TCAGAATTCCCAGTGAATTCCCGATCTAGTA

SEQ ID NO：23 and SEQ ID NO：24 using pCAMBIA2300 plasmid as template amplification arabidopsis 35S promoter. Using the PrimeSTAR HS archaeal dna polymerase of TaKaRa.50 μ l PCR reaction systems：10μl 5×PS Buffer,3μl The dNTP of 2.5mM, 1.0 μ l dilute 50 times of pCAMBIA2300 plasmid, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：23 and SEQ ID NO：The distilled water of 24 each 2.0 μ l and 31 μ l.PCR reaction condition：94 DEG C initial denaturation 5 minutes, 33 are followed Ring (94 DEG C are denaturalized 30 seconds, and 50 DEG C are annealed 30 seconds, and 72 DEG C extend 30 seconds), 72 DEG C extend 10 minutes.Pass through HindIII, XbaI enzyme Gained PCR product is connected to (connection method is same as above) pCAMBIA2300-2 after cutting and obtains pCAMBIA2300-3

SEQ ID NO：：23：

ACTAAGCTTATGGTGGAGCACGACACTCT

SEQ ID NO：24：

GCTCTAGAAGAGATAGATTTGTAGAGAGAGAC

SEQ ID NO：25 and SEQ ID NO：Cloned in 26 amplification embodiments 2 containing overall length ThMCSU-2 gene ThMCSU-2-pGEM plasmid is template, and amplification both ends have the ThMCSU-2 gene of designed restriction enzyme site.Using The PfuUltra II Fusion HS DNA Polymerase of Stratagene.50 μ l PCR reaction systems：5μl 10× PfuUltra II Reaction Buffer, the dNTP of 0.5 μ l 25mM, 2.0 μ l ThMCSU-2-pGEM plasmids, 1.0 μ l PfuUltra II Fusion HS DNA Polymerase, 10 μM of primer SEQ ID NO：20 and SEQ ID NO：21 is each The distilled water of 2.0 μ l and 37.5 μ l.PCR reaction condition：95 DEG C initial denaturation 2 minutes, 35 circulation (95 DEG C be denaturalized 25 seconds, 51 DEG C annealing 30 seconds, 72 DEG C of extensions 90s), 72 DEG C extension 5 minutes.(even as the connection of the PCR product by obtained by after XbaI, KpnI digestion The method of connecing is same as above) pCAMBIA2300-3 is arrived, obtain plant expression vector 35S-ThMCSU-2-2300.

SEQ ID NO：25：

AATCTAGAATGGGAGATAGATTCATGATG

SEQ ID NO：26：

GCGGTACCCATAAATGATTTCGCATACAC

4 35S-ThMCSU-2-2300 expression vector of embodiment converts Agrobacterium

The preparation of Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competent cell：1-2 in advance Agrobacterium LBA4404 is drawn single spot inoculation by it on the LB solid medium containing 50 μ g/ml rifampins and 50 μ g/ml streptomysins, 28 DEG C are cultivated 1 to 2 day.Picking single colonie is inoculated in the LB Liquid Culture that 5ml contains 50 μ g/ml rifampins and 50 μ g/ml streptomysins Overnight incubation (about 12-16 hours) is shaken in base, at 28 DEG C to OD₆₀₀Value is 0.4, forms seed bacterium solution.Take 5ml culture activation Seed bacterium solution (1: 20 ratio) afterwards is inoculated in the LB liquid medium of the same concentration antibiotic of 100ml, 28 DEG C of shake trainings 2-2.5 hours are supported to OD₆₀₀=0.8.It ice bath bacterium solution 10 minutes, was shaken up every 3 minutes once, makes bacterium even into suspend mode shape State.4000g is centrifuged 10 minutes at 4 DEG C, abandons supernatant；10% (volume ratio) glycerol resuspension thallus of 1ml ice pre-cooling is added, 4000g is centrifuged 10 minutes at 4 DEG C, collects precipitating；Ice-cold 10% (volume ratio) glycerol repeats to wash 3-4 times；It is added appropriate Again suspended bacterial precipitates 10% (volume ratio) glycerol of ice pre-cooling, obtains LBA4404 competent cell, will with 40 μ l/ pipes It is dispensed, and is saved backup in -70 DEG C.

Convert Agrobacterium：Melt LBA4404 competent cell on ice, 1 μ is added into the competent cell of 40 μ l Positive 35S-ThMCSU-2-2300 plasmid obtained in l embodiment 3, ice bath about 10 minutes after mixing.By the sense after ice bath It is transferred in the electric shock cup that ice is pre-chilled by the mixture of state cell and 35S-ThMCSU-2-2300 plasmid with liquid-transfering gun, tapping makes Suspension reaches bottom, has been careful not to bubble.Electric shock cup (being purchased from Bio-Rad) is put on the slideway of electroporation chamber, pushes and slides Road is put to electroporation chamber base electrode by electric shock cup.Using the electric shock cup of 0.1cm specification, MicroPuMUer (is purchased from Bio-Rad) Program be set as " Agr ", electric shock is primary.Electric shock cup is taken out immediately, and 200 μ l LB culture mediums of 28 DEG C of preheatings are added.Quickly and Soft is beaten competent cell with liquid-transfering gun.Suspension is transferred to the centrifuge tube of 1.5ml, the 225rpm culture 1 at 28 DEG C Hour.Taking the bacterium solution of 100-200 μ l to be coated on corresponding resistance screening culture medium flat plate, (LB solid medium contains 50 μ g/ml Rifampin, 50 μ g/ml streptomysins, 50 μ g/ml kanamycins), 28 DEG C of cultures.Screen positive transformants clone, and by its bacterium solution in- 70 DEG C save backup.

Embodiment 5 obtains transgenic arabidopsis using Agrobacterium-medialed transformation method

Plant culture to be transformed：(Colombia's type, the arabidopsis from Ohio State Univ-Columbus USA are raw for arabidopsis seed Object resource center (www.arabidopsis.org) is sowed in peat soil, after low-temperature treatment 3 days, is placed in 23 DEG C, 16 through 4 DEG C It germinates in the dark incubator in hour illumination/8 hour.It is transplanted to after 7-10 days equipped with peat soil and vermiculite (volume ratio 3: 1) Bore is 6 plants of every pot culture kind in the polypots of 7.5cm, is placed in 23 DEG C, life in the dark incubator in 16 hours illumination/8 hour It is long.Every alms bowl pours 1/2MS culture medium 40ml before transplanting, and moisture is replenished in time in transplanting backsight soil moisture.It is suitably poured in growth period Fill 1/2MS culture medium.Every 3-4 weeks as needed primary (or the time is longer).In order to obtain more bud on each plant, First inflorescence is cut off after first inflorescence of most of plant is formed, and is released apical dominance, is promoted the same of multiple secondary inflorescences It walks out of existing.Prepare dip dyeing when most of inflorescences about 1-10cm high (cut off first inflorescence after 4-8 days).

The culture of Agrobacterium：After taking out the bacterium liquid activation of Agrobacterium positive transformants clone of conservation in embodiment 4, picking agriculture Bacillus single colonie is inoculated into the sterile LB liquid medium of 10ml (rifampin containing 75mg/l, 100mg/l streptomysin and 100mg/l Kanamycins), the lower 250 revs/min of shakings of 28 DEG C of constant temperature are incubated overnight.Obtained bacterium solution is connect in the ratio of 1%-2% again In LB liquid medium of the kind to 200ml equally containing above-mentioned antibiotic, 28 DEG C of constant temperature shakings make the concentration of Agrobacterium reach OD₆₀₀ =1.8, then at room temperature 3000 revs/min be centrifuged 15 minutes, discard supernatant after liquid with dip dyeing culture medium (dip dyeing culture medium Silwet L-77 containing 5.0% sucrose and 0.05% (500 μ l/l)) suspend Agrobacterium again, it is suspended into OD₆₀₀About 0.80。

The dip dyeing of inflorescence：The above-mentioned dip dyeing culture medium containing Agrobacterium is added in big mouth container, the container of each bore 9cm Dip dyeing culture medium containing Agrobacterium described in middle addition 200-300ml is for disseminating.Plant is inverted, submerges aerial tissues all 3-5 seconds in agrobacterium suspension, and to be gently agitated for.There should be one layer of liquid film after infiltration on plant.The plant disseminated It is placed in vinyl disc, with clean plastics or preservative film covering with moisturizing, is then placed within dim light or dark place is stayed overnight, pay attention to careful Prevent direct sunlight plant.Remove covering within about 12-24 hours after processing.Normal culture plant, plant further growth 3-5 weeks, Until silique browning dries out.Harvest T1 for seed, and by the seed centrifuge tube at 4 DEG C dry storage.

Transgenic seed screening：Prepare 1/2MS culture medium aqueous solution (9.39mM KNO₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM of KI, 100 μM of H₃BO₃, 100 μM of MnSO₄, 30 μM of ZnSO₄, 1 μM Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μM of FeSO₄), 0.8% agar powder is added, is heated to fine jade with micro-wave oven Rouge dissolves completely, and to be cooled to 50 DEG C or so, the desired amount of final concentration of 50mgl is added^-1Kanamycins, shake up rear every training It supports in ware and pours into 25ml, can be sowed after setting experimental bench cooled and solidified.Load weighted seed is poured on a plain copying paper, Copy paper is touched with finger, seed is equably sowed on agaropectin, culture ware lid is covered, it is small to set 4 DEG C of refrigerator cold treatments 72 Shi Hou moves to 23 DEG C, germinates in the dark incubator in 16 hours illumination/8 hour, periodic statistical germination and growth of seedling feelings Resistance seedling is transplanted in Nutrition Soil by condition in time.Moisture is replenished in time in transplanting backsight soil moisture.It is suitably poured in growth period Fill 1/2MS culture medium.The Arabidopsis leaf 0.1g of growth 20 days is taken, DNA is extracted, with SEQ ID NO：16：With SEQ ID NO： 17 amplification ThMCSU-2：(50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：16 and SEQ ID NO：The distilled water of 17 each 2.0 μ l and 35 μ l.PCR Reaction condition：94 DEG C initial denaturation 5 minutes, 33 circulation (94 DEG C be denaturalized 45 seconds, 51 DEG C anneal 45 seconds, 72 DEG C extend 2 minutes), 72 DEG C extend 7 minutes), PCR is accredited as positive plant and is numbered, normally cultivates plant, plant further growth 3-5 weeks, Until silique browning dries out.Harvest T2 band seed, and by seed centrifuge tube at 4 DEG C dry storage.

Embodiment 6 is overexpressed the transgenic arabidopsis T2 of ThMCSU-2 for the drought-enduring simulated experiment of plant and Function Identification

Sterilized vermiculite is impregnated with 1/2MS culture medium.The transgenic arabidopsis T2 of ThMCSU-2 is numbered for plant T2H1-T2H6 and control arabidopsis seed are sowed on vermiculite respectively, and every basin sows 10 seeds, 25 DEG C, 10 hours optical cultures/ 14 hours dark culture circulations pour a 1/2MS for every 7 days, after culture 20 days, using kanamycin screening positive plant, and every basin 4 more consistent seedlings of reservation size, for arid experiment.Transgenic arabidopsis, arid 14 days (not the watering) of control arabidopsis, 25 DEG C, 10 hours optical culture/14 hour dark cultures circulation.T2 shows that adjoining tree all withers for the Identification of Drought of transgenic plant It is listless serious, and six strains of T2H1, T2H2, T2H3, T2H4, T2H5, T2H6, T2H7, T2H8 totally 32 each 4 of every strain) quasi- south In mustard 27 can survive and continued growth show significant drought tolerance (referring to Fig. 3 a and 3b, by taking T2H3, T2H4 as an example, T2H1, The result of T2H2, T2H5, T2H6, T2H7, T2H8 are similar with T2H3, T2H4, are not shown here).

The measurement of ABA content after 7 drought stress of embodiment

ABA is a generally acknowledged Plant Hormone relevant to environment stress, can be used as signaling molecule and regulates and controls multiple adverse circumstances The expression of induced gene, to improve the anti-adversity ability of plant.We take turn under normal growing conditions within drought stress 10 days Gene plant (T2H1, T2H2, T2H3, T2H4, T2H5, T2H6) and adjoining tree (CK1, CK2) each 0.2g of blade, with Chinese agriculture The kit measurement ABA content of Chemical control of crop research center preparation is learned by sparetime university (see Fig. 4).The experimental results showed that no matter arid at Under reason or collating condition, the ABA content of transgenic plant is above control (CK1, CK2), it was demonstrated that ThMCSU-2 gene can be with Just regulating and controlling plant endogenous ABA content.

Embodiment 8 verifies the expression of ThMCSU-2 gene on transcriptional level

Take respectively control Arabidopsis plant, significant drought-enduring transgenic arabidopsis T2 for plant (be belonging respectively to T2H1, T2H2, Six strains of T2H3, T2H4, T2H5, T2H6) and not significant drought-enduring transgenic arabidopsis T1 for plant 10 days blades of arid Each 0.05g, the total serum IgE extracted with plant RNA extraction kit (Invitrogen).With the ultraviolet spectrometry light of HITACHI company Degree meter U-2001 measurement gained total serum IgE calculates each RNA concentration in the absorbance value of 260nm and 280nm.According to Method shown in Invitrogen reverse transcription reagent box SuperScript III Reverse Transcriptase carries out reverse transcription (2 μ g total serum IgEs are as template, reverse transcription primer SEQ ID NO：18).Pass through SEQ ID NO：16 and SEQ ID NO：17 amplifications ThMCSU-2 detects ThMCSU-2 gene relative expression's situation.

Using the PrimeSTAR HS archaeal dna polymerase of TaKaRa, PCR reaction is carried out by template of the cDNA of reverse transcription.50 μ l PCR reaction system：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：16 and SEQ ID NO：The distilled water of 17 each 2.0 μ l and 30 μ l.PCR reaction condition：94℃ Initial denaturation 5 minutes, 29 circulations (94 DEG C are denaturalized 45 seconds, and 51 DEG C are annealed 45 seconds, and 72 DEG C extend 2 minutes), 72 DEG C extended 10 minutes.

Product electrophoresis result is as shown in Figure 5：M is DNA Ladder Marker (DL2000, TakaRa), and 1-4 is drought-enduring effect The inapparent transgenic arabidopsis T2 of fruit for plant, 5-11 be drought-enduring effective transgenic arabidopsis T2 for plant (successively For：T2H1, T2H2, T2H3, T2H4, T2H5, T2H6, T1H7), 12-17 is non-transgenic Arabidopsis plant.

(the about 2.4Kbp) in the same size of PCR product electrophoretic band size and ThMCSU-2 as shown in the figure.The result shows that right There is no ThMCSU-2 transcription according to arabidopsis, significant drought-enduring transgenic arabidopsis T1 is stronger for the transcription of ThMCSU-2 in plant, no Significant drought-enduring transgenic arabidopsis T2 transcribes very weak for plant ThMCSU-2.

Claims (8)

1. a molybdenum cofactors for small salt mustard vulcanize enzyme, sequence such as SEQ ID NO：Shown in 1.

2. encoding the gene of the molybdenum cofactors vulcanization enzyme of claim 1, sequence is SEQ ID NO：2.

3. a kind of recombinant expression carrier is obtained and gene as claimed in claim 2 is inserted into a kind of expression vector , and the nucleotide sequence of the gene is operably connected with the expression control sequence of the expression vector；The expression Carrier is pCAMBIA2300.

4. recombinant expression carrier as claimed in claim 3 is attached 35S-ThMCSU-2-2300 carrier shown in Fig. 2.

5. a kind of recombinant cell is carried containing recombinant expression described in gene as claimed in claim 2 or claim 3 or 4 Body；The recombinant cell is recombination agrobatcerium cell.

6. a kind of method for improving drought resistance in plants, including：It will be described in gene as claimed in claim 2 or claim 3 or 4 Recombinant expression carrier import plant or plant tissue and make the gene expression；The plant is arabidopsis.

7. a kind of method of prepare transgenosis plant, including：Culture contains claim 2 institute under conditions of effectively generating plant The plant of recombinant expression carrier described in the gene or claim 3 or 4 stated or plant tissue, the plant are arabidopsis.

8. weight described in recombinant expression carrier described in gene as claimed in claim 2, claim 3 or 4 or claim 5 For group cell for improving drought resistance in plants and the purposes for plant breeding, the plant is arabidopsis.