CN104837999B - Cotton zinc finger protein (Czf6) and coding gene and use thereof - Google Patents

Abstract

Provided are a zinc finger protein (Czf6) from cotton and the coding gene thereof, and the use thereof in the incubation of transgenic plants with increased drought resistance.

Description

One grows cotton zinc finger protein (Czf6) and its encoding gene and application

Technical field

The present invention relates to vegetable protein and its encoding gene and application, the more particularly to one zinc finger egg from Cotton Gossypii (Czf6) and its encoding gene in vain, and its application in the transgenic plant that drought resistance is improved is cultivated.

Background technology

Abiotic stress, such as arid, salting, extreme temperature, chemical contamination and oxygen injury can be sent out the growth of plant Educate and cause serious harm, extreme loss is caused to crop yield.Wherein impact of the arid to crop yield, many naturally inverse First place is accounted in border, its harm equivalent to other disaster sums, be many areas be agricultural development bottleneck.According to statistics, the world does Drought, semiarid zone account for the 34% of land surface；China's arid, semiarid zone account for the 52% of area, face of suffering from drought in year Product reaches ten thousand hectares of 200-270, and the annual billion cubic meter of hydropenia about 30 in national irrigation district receives less grain 350-400 hundred million because of hydropenia public Jin；Particularly China relationship and primary grain producing such as North China, northeast and northwest, is the area of China's hydropenia most serious, and spring drought frequently reaches Meet within 10 years nine.

Because the resistance to coercive of plant belongs to quantitative trait mostly, existing available germ plasm resource is deficient, using routine The difficulty of breeding technique improvement stress tolerance in plants is quite big, cultivates real resistance to stress kind just particularly difficult.In recent years, With to plant stress-resistance molecular mechanism research deepen continuously and Protocols in Molecular Biology fast development, degeneration-resistant research from Physiological level is deep into molecular level, promotes the engineered development of plant stress-resistance.When plant can produce when being forced Corresponding responsing reaction is reducing or eliminate the harm brought to plant.This responsing reaction of plant is one and is related to many bases Cause, multi signal approach, the complex process of polygenes product.These genes and its expression product can be divided into 3 classes：(1) letter is participated in Number Cascaded amplification system and the gene and product of transcription control；(2) gene directly to protecting biomembrane and protein to work And its expression product；(3) protein related to the intake of water and ion and transhipment.In recent years, improved by transgenic technology Research of the plant to stress-tolerance ability, and to crops of the stress with tolerance, xerophyte and halophytess Research all achieves significant achievement, and stress-related genes and signal transduction system there has also been with further understanding (Liu Q.1998.Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA Binding domain, separate two cellular signal transduction pathways in drought- And low temperature-responsive gene expression, respectively, in Arabidopsis.Plant Cell, 10：1391-1406；KANG JY.2002.Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling.Plant Cell, 14：343-357；ABE H.2003.Arabidopsis AtMYC2(bHLH)and AtMYB2(MYB)function as Transcriptional activators in abscisic acid signaling.Plant Cell, 15：63-78.).

But for current research situation, because its mechanism is sufficiently complex, many plants are to the biochemistry under adverse circumstance Still need to be studied with physiological response mechanism.Research in terms of the function and expression regulation of degeneration-resistant response gene will Research to the related signaling pathways of plant stress-resistance and signal transmission network system provides important basis.

The content of the invention

Method clone of the present inventor using SSH (Subtractive hybridization) in combination with RACE (cDNA ends rapid amplifying) Go out the encoding gene of a zinc finger protein (being named as Czf6 herein) of Cotton Gossypii, and determine its DNA sequence.And it is it was found that logical Cross transgenic to be conducted into after plant, can obviously improve the drought resistance of transfer-gen plant, and these character can stablize heredity.

First aspect present invention provides the encoding gene (being named as GhCzf6 herein) of a zinc finger protein Czf6 of Cotton Gossypii, Its sequence is SEQ ID NO：2.

Second aspect present invention provides a kind of recombinant expression carrier, its contain the gene described in first aspect present invention and The nucleotide sequence of the gene is operably connected with the expression control sequenc of the expression vector；Preferably, the carrier Rd29A-Gh Czf6-2300 carriers shown in accompanying drawing 2.

Third aspect present invention provides a kind of reconstitution cell, its contain the gene described in first aspect present invention or this Recombinant expression carrier described in bright second aspect；Preferably, the reconstitution cell is restructuring agrobatcerium cell.

Fourth aspect present invention provides a kind of method for improving plant drought resistance, including：By described in first aspect present invention Recombinant expression carrier described in gene or second aspect present invention imports plant or plant tissue and makes the gene expression；It is excellent Selection of land, the plant is Nicotiana tabacum L..

Fifth aspect present invention provides a kind of method of prepare transgenosis plant, including：In the condition for effectively producing plant Lower plant of the culture containing gene described in first aspect present invention or the recombinant expression carrier described in second aspect present invention or Plant tissue；Preferably, the plant is Nicotiana tabacum L..

Sixth aspect present invention provides gene, the restructuring table described in second aspect present invention described in first aspect present invention It is used to improve plant drought resistance and the use for plant breeding up to the reconstitution cell described in carrier or third aspect present invention On the way；Preferably, the plant is Nicotiana tabacum L..

Seventh aspect present invention provides the protein of the gene code described in first aspect present invention, and its aminoacid sequence is such as SEQ ID NO：Shown in 1.

Description of the drawings

Fig. 1 is the structure flow process of the plant expression vector (rd29A-GhCzf6-2300) of GhCzf6.

Fig. 2 is the plasmid figure of the plant expression vector (rd29A-GhCzf6-2300) of GhCzf6.

Fig. 3 is the drought resistance growing state for compareing Nicotiana tabacum L. and transgene tobacco；CK (left side)：Control Nicotiana tabacum L.；T1F9 (in) and T1F12 (right side)：Transgene tobacco strain.

Fig. 4 is drought-resistant and the results of the not drought-resistant T1 for transgenic tobacco plant on transcriptional level.M is Marker, 1-8 be drought-resistant T1 for transgenic tobacco plant, 9-12 is not drought-resistant T1 for transgenic tobacco plant.

Specific embodiment

Following examples are provided, to facilitate those skilled in the art to more fully understand the present invention.The embodiment merely for Exemplary purpose, is not intended to limit the scope of the present invention.

Cotton Gossypii SSH library constructions under the drought stress of embodiment 1：

Concrete grammar is：

Using the PCR-select of Clontech companies^TMMethod shown in cDNA Subtraction Kit is by suppressing Subtractive hybridizing method builds subtracted library.Made with the mRNA extracted in the blade of the cotton seedling of Osmotic treatment in experimentation For sample (tester), the mRNA extracted using in the blade of untreated cotton seedling is used as control (driver).Concrete steps It is summarized as follows：

(1) material to be tested：

(National Cotton mid-term storehouse obtains unit Cotton institute, Unified number to african cotton：ZM-06838) it is seeded into On sterilized Vermiculitum, cultivate under the conditions of 25 DEG C, photoperiod 16h/8h (light intensity 2000-3000Lx), 1/2MS cultures are poured weekly Base is (containing 9.39mM KNO₃, 0.625mM KH₂PO₄, 10.3mM NH₄NO₃, 0.75mM MgSO₄, 1.5mM CaCl₂, 50 μM KI, 100 μM of H₃BO₃, 100 μM of MnSO₄, 30 μM of ZnSO₄, 1 μM of Na₂MoO₄, 0.1 μM of CoCl₂, 100 μM of Na₂EDTA, 100 μ M FeSO₄) once.It is used to test when Seedling plant height reaches 25-30cm.

(2) material process：

2 groups will be divided into for trying seedling, per group of 4 basins, per 1 plant of basin.First group is matched group, in 25 DEG C, photoperiod 16h/8h Cultivate under the conditions of (light intensity 2000-3000Lx), it is normal to pour.Second group be Osmotic treatment group, 25 DEG C, photoperiod 16h/8h (light Strong 2000-3000Lx) under the conditions of cultivate, stop pouring, process 10 days, timely two groups of seedling apicals 1/3 of clip after being disposed Blade, with liquid nitrogen quick freeze after, in -70 DEG C of refrigerators preserve.

(3) Total RNAs extraction：

The cotton leaf 0.5g of matched group and Osmotic treatment group is taken respectively, (is purchased from plant RNA extraction test kit Invitrogen the total serum IgE of cotton leaf) is extracted.Total serum IgE is determined with the ultraviolet spectrophotometer U-2001 of HITACHI companies to exist The absorbance of 260nm and 280nm, OD₂₆₀/OD₂₈₀Ratio is 1.8-2.0, shows that total serum IgE purity is higher, with 1.0% agar The integrity of sugared detected through gel electrophoresis total serum IgE, the brightness of 28S bands is about 2 times of 18S bands, shows that the integrity of RNA is good It is good.Using Oligotex mRNA purification kits (the purification of polyA+RNA from of Qiagen companies Total RNA) separate mRNA.

(4) Subtractive hybridization：

By the PCR-select of Clontech companies^TMMethod shown in cDNA Subtraction Kit test kits is carried out Subtractive hybridization.It is first using the PCR-Select cDNA Subtraction Kits subtractive hybridization kits of Clontech Driver mRNA and Tester mRNA is distinguished into reverse transcription, double-strand cDNA is obtained, then with 2 μ g Tester cDNA and 2 μ g Driver cDNA carry out subtractive hybridization as parent material.Respectively by Tester cDNA and Driver under 37 DEG C of water-baths CDNA Rsa I enzyme action 1.5h, are then divided into two equal portions by the Tester cDNA after enzyme action, different joint in connection, and Driver cDNA are not connected to head.Two kinds of Tester cDNA for being connected with different joints mix respectively with excessive Driver, carry out Positive subtractive hybridization for the first time.By the product mixing of two kinds of first time subtractive hybridization, then enter with Fresh denatured Driver cDNA Second positive subtractive hybridization of row, expands the fragment of differential expression so as to be enriched with by inhibition PCR twice.

(5) structure of cDNA subtracted libraries and preliminary screening, clone, identification

According to the program of pGEM-T Easy test kits, the positive subtractive is hybridized into second PCR primer of cDNA fragments (QIAquick PCR Purification Kit purification being used, purchased from Qiagen) (tries with pGEM-T Easy purchased from Promega Agent box) carrier connection, it is comprised the following steps that：Following ingredients are sequentially added with 200 μ l PCR pipes：The positive subtractive hybridization of purification The μ l of second PCR primer 3 of cDNA fragments, the μ l of 2 × T4 ligase buffer solutions 5, the μ l of pGEM-T Easy carriers 1, T4DNA connect The μ l of enzyme 1, in 4 DEG C of connections overnight.10 μ l coupled reaction products are taken, 100 μ l competence e. coli jm109s is added to and (is purchased from TAKARA in), ice bath 30min, heat shock 60 seconds, ice bath 2min separately add 250 μ l LB culture fluid (containing 1%Tryptone (purchases From OXOID), 0.5%Yeast Extract (be purchased from OXOID), 1%NaCl (being purchased from traditional Chinese medicines)) 37 DEG C of water-baths are put, with 225rpm shaken cultivation 30min, takes 200 μ l bacterium solutions and is inoculated in LB (the ibid)/X-gal/IPTG containing 50 μ g/ml ampicillin On (X-gal/IPTG is purchased from TAKARA) culture plate, 37 DEG C of cultivation 18h.Count culture plate in diameter ＞ 1mm it is clear white and Blue colonies number, 540 white colonies of random picking (numbering：Gh-D2-001 to Gh-D2-540).All white colonies are connect Plant in 96 porocyte culture plates (CORNING) of the LB fluid mediums containing 50 μ g/ml ampicillin, 37 DEG C were cultivated Glycerol adding is saved backup to final concentration 20% in -80 DEG C after night.With nest-type PRC primer Primer 1 and Primer 2R (the PCR-select of Clontech companies^TMCDNA Subtraction Kit test kits are carried) amplification of bacterium solution PCR is carried out, obtain To 452 positive colonies, then Invitrogen (Shanghai) trade Co., Ltd is sent to be sequenced all positive colonies.

(6) the cDNA sequencing analysis of differential cloning：

DNA sequencing result is removed after the cDNA of carrier and indefinite sequence and redundancy, 405 effective EST are obtained (unigene)。

The clone of the Cotton Gossypii zinc finger protein gene GhCzf6 of embodiment 2

Clone Gh-D2-153 is removed after redundant DNA, and sequence is SEQ ID No：3, sequence analysis show the sequential coding Albumen belong to zinc finger protein, herein by SEQ ID No：The corresponding total length encoding gene of 3 sequences is named as GhCzf6, corresponding Albumen is named as Czf6.

SEQ ID No：3

The clone of GhCzf6 total length encoding genes

According to the SEQ ID No for having obtained：3 sequences, design following three specific primers, hold as the 3 ' of 5 ' RACE Specific primer.

GhCzf6 GSP3：SEQ ID NO：4：

TCACGATCTT CTCTGCTTTG AC

GhCzf6 GSP4：SEQ ID NO：5：

CACGGGATTG GCACGTGCAA TC

GhCzf6 GSP5：SEQ ID NO：6：

CCCAATCTTC TTGAAATCGA AC

Experimental procedure operates (5 ' RACE System for Rapid Amplification of by kit specification CDNA Ends test kits are purchased from invitrogen companies).

With SEQ ID NO：5 and 5 ' universal primer AAP (test kit is carried), with the cDNA of mRNA reverse transcriptions, (reverse transcription is drawn Thing SEQ ID NO：4) amplification of first round PCR is carried out for template, is comprised the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l mRNA reverse transcriptions CDNA, 1.0 μ l Ex Taq (being purchased from TAKARA), 10 μM of primer SEQ ID NO：5 and AAP each 2.0 μ l and 35 μ l are double to be steamed Water.PCR reaction conditions：94 DEG C of denaturations 5min, 33 circulations (94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extension 10min.

The PCR primer distilled water of gained takes 2.0 μ l as template after diluting 50 times, with SEQ ID NO：8 draw with 3 ' ends Thing AUAP carries out the second wheel PCR amplifications, comprises the following steps that：

50 μ l PCR reaction systems：5 μ l 10 × Ex Buffer, the dNTP of 3 μ l 2.5mM, the first round of 2.0 μ l dilutions PCR primer, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：6 and AUAP each 2.0 μ l and 35 μ l distilled waters.PCR is anti- Answer condition：94 DEG C of denaturations 5min, 33 circulations (94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extensions 10min.The band (Gel Extraction Kit are purchased from OMEGA) that fragment in second PCR primer is about 500bp is reclaimed, and PGEM-T Easy Vector are coupled with, JM109 (concrete grammar is ibid), the white bacterium of random picking 10 is then transformed into Fall and be inoculated in the LB fluid mediums containing 50 μ g/ml ampicillin, glycerol adding is to final concentration after 37 DEG C of overnight incubations 20%, -80 DEG C save backup.With SEQ ID NO：8 and 3 ' end primer AUAP carry out the amplification of bacterium solution PCR (reaction system and reaction Condition is ibid), 7 positive colonies are obtained, choose wherein 4 clones and deliver to the sequencing survey of Invitrogen (Shanghai) trade Co., Ltd Sequence, obtains the 5 ' ends of the cDNA of the gene.

After 5 ' the RACE product clonings sequencing of gained, by itself and SEQ ID No：3 sequence assemblies.Obtain GhCzf6 total lengths CDNA sequence SEQ ID No：7：

According to SEQ ID NO：7 sequential design pair of primers are as follows：

GhCzf6：SEQ ID NO：8：

ATGGCGGAGG AACATAAATG CC

GhCzf6：SEQ ID NO：9：

TCAAATCCTC ACGATCTTCT CT

By SEQ ID NO：8 and SEQ ID NO：9 cloning GhCzf6 total length encoding genes.

Using the PrimeSTAR HS archaeal dna polymerases of TaKaRa, by template of the cDNA of Cotton Gossypii performing PCR reaction is entered.50μl PCR reaction systems：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM Primer SEQ ID NO：8 and SEQ ID NO：9 each 2.0 μ l and 30 μ l distilled waters.PCR reaction conditions：94 DEG C of denaturations 5min, 33 circulations (94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extension 10min.

Pcr amplification product adds A tails：The dehydrated alcohol of 2.5 times of volumes is added in PCR primer, -20 DEG C are placed 10 minutes, from The heart, removes supernatant, dries, and is then dissolved with 21 μ l distilled waters.Then 2.5 μ l 10 × Ex Buffer, 0.5 μ l are added thereto to The dATP of 5mM, 2.5 μ l 10 × Ex Taq.Reaction condition：70 DEG C are reacted 30 minutes.The DNA fragmentation of the about 540bp for obtaining is returned Receive (Omega QIAquick Gel Extraction Kits), and be connected on pGEM T-easy carriers, then convert JM109 (method is ibid), with 10 white colonies of machine picking are inoculated in the LB fluid mediums containing 50 μ g/ml ampicillin, after 37 DEG C of overnight incubations To final concentration 20%, -80 DEG C save backup glycerol adding.With SEQ ID NO：8 and SEQ ID NO：9 carry out the amplification of bacterium solution PCR (instead Answer system and reaction condition ibid), 7 positive colonies are obtained, choose wherein 4 positive colonies and deliver to Invitrogen (Shanghai) trade Easily company limited's sequencing, sequence is SEQ ID NO：2, the aminoacid sequence of the protein of its coding is SEQ ID NO：1.

The aminoacid sequence of Czf6 albumen：SEQ ID NO：1

The nucleotide sequence of GhCzf6 encoding genes：SEQ ID NO：2

The GhCzf6 gene plant expression vector establishments of embodiment 3

Select plant binary expression vector pCAMBIA2300 (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd) As plant expression vector, 35S promoter of the NPTII genes containing double enhancers is replaced with Pnos promoteres, to reduce NPTII eggs The white expression in plant.The rd29A promoteres and terminator Tnos of induction type are selected respectively as the startup of GhCzf6 genes Son and terminator.

With primer SEQ ID NO：10 and SEQ ID NO：11 (are purchased from Beijing China ocean with plant expression vector pBI121 Science and Technology Ltd.) it is template amplification Pnos, using the PrimeSTAR HS archaeal dna polymerases of TaKaRa.50 μ l PCR reactants System：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：10 and SEQ ID NO：The distilled water of 11 each 2.0 μ l and 31 μ l.PCR reaction conditions：94 DEG C of denaturations 5min, 33 circulations (94 DEG C of degeneration 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.By EcoRI, PCR primer connection (promega, T4 ligase box) of gained is obtained pCAMBIA2300- by BglII enzyme action to pCAMBIA2300 1。

SEQ ID NO：10：

GCACGAATTCATACAAATGGACGAACGGAT

SEQ ID NO：11：

ATCCAGATCTAGATCCGGTGCAGATTATTTG

With primer SEQ ID NO：12 and SEQ ID NO：13 with pBI121 as template amplification Tnos, using TaKaRa's PrimeSTAR HS archaeal dna polymerases.50 μ l PCR reaction systems：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 1.0 μ l pBI121,1.0 μ l PrimeSTAR, 10 μM of primer SEQ ID NO：12 and SEQ ID NO：13 each 2.0 μ l and 31 μ L distilled waters.PCR reaction conditions：94 DEG C of denaturations 5min, 33 circulations (94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extensions 30s), 72 DEG C of extension 10min.PCR primer connection (promega T4 ligase boxes) as SacI, EcoRI enzyme action by obtained by PCAMBIA2300-2 is obtained to pCAMBIA2300-1.

SEQ ID NO：12：

AAGGAGCTCGAATTTCCCCGATCGTTCAAA

SEQ ID NO：13：

TCAGAATTCCCAGTGAATTCCCGATCTAGTA

With primer SEQ ID NO：14 and SEQ ID NO：15 with arabidopsiss, (Colombia's type, is purchased from Www.arabidopsis.org) DNA be template amplification arabidopsiss rd29A promoteres (refer to Zeng J., et al.2002, Preparation of total DNA from " recalcitrant plant taxa ", Acta Bot.Sin., 44 (6)： Method in 694-697 extracts arabidopsiss DNA).Using the PrimeSTAR HS archaeal dna polymerases of TaKaRa.50 μ l PCR react System：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 1.0 μ l arabidopsiss DNA, 1.0 μ l PrimeSTAR, 10 μM Primer SEQ ID NO：14 and SEQ ID NO：15 each 2.0 μ l and 31 μ l distilled waters.PCR reaction conditions：94 DEG C of denaturations 5min, 33 circulations (94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s), 72 DEG C of extension 10min.By HindIII, PCR primer connection (method of attachment is ibid) of gained is obtained pCAMBIA2300-3 by PstI enzyme action to pCAMBIA2300-2.

SEQ ID NO：14：

ACTAAGCTTCCTTCTTGACATCATTCAATTTTA

SEQ ID NO：15：

TGACTGCAGTCCAAAGATTTTTTTCTTTCCAATAG

With primer SEQ ID NO：16 and SEQ ID NO：(template is real to the full length sequence of 17 amplification GhCzf6 encoding genes Apply example 2 and obtain GhCzf6 total length encoding genes), using the PrimeSTAR HS archaeal dna polymerases of TaKaRa.50 μ l PCR are anti- Answer system：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 1.0 μ l GhCzf6-pGEM, 1.0 μ l PrimeSTAR, 10 μM primer SEQ ID NO：16 and SEQ ID NO：17 each 2.0 μ l and 31 μ l distilled waters.PCR reaction conditions：94 DEG C of pre- changes Property 5min, 33 circulation (94 DEG C of degeneration 30s, 58 DEG C annealing 30s, 72 DEG C extension 2min), 72 DEG C extension 10min.By PstI, PCR primer connection (method of attachment is ibid) of gained to pCAMBIA2300-3, is obtained plant expression vector by SacI enzyme action rd29A-GhCzf6-2300。

SEQ ID NO：16：

TGACTGCAGATGGCGGAGGA ACATAAATGCC

SEQ ID NO：17：

AAGGAGCTC TCAAATCCTC ACGATCTTCT CT

The rd29A-GhCzf6-2300 expression vectors of embodiment 4 convert Agrobacterium

The preparation of Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competent cell：1-2 in advance Agrobacterium LBA4404 is drawn single speckle and is inoculated with by it on the LB solid mediums containing 50 μ g/ml rifampicin and 50 μ g/ml streptomycins, 28 DEG C are cultivated 1 to 2 day.Picking single bacterium colony is inoculated in LB liquid cultures of the 5ml containing 50 μ g/ml rifampicin and 50 μ g/ml streptomycins In base, at 28 DEG C wave and culture overnight (about 12-16h) to OD₆₀₀It is worth for 0.4, forms seed bacterium solution.Take the bacterium solution after 5ml activation (1: 20 ratio) is inoculated in LB fluid mediums of the 100ml containing 50 μ g/ml rifampicin and 50 μ g/ml streptomycins, and 28 DEG C are shaken Dynamic culture 2-2.5h to OD₆₀₀=0.8.Ice bath bacterium solution 10min, shakes up once every 3min, makes the antibacterial even into dormancy State.4000g centrifugations 10min, abandons supernatant at 4 DEG C；Add 10% glycerol resuspension thalline of a certain amount of ice pre-cooling, 4 DEG C Lower 4000g is centrifuged 10min, collects precipitation；Ice-cold 10% glycerol repeats to wash 3-4 time；It is subsequently adding appropriate ice bath pre-cooling 10% glycerol again suspended bacterial precipitation, with 40 μ l/ pipes by its subpackage, save backup in -70 DEG C.

Conversion Agrobacterium：In the competent cell described in thawed on ice, the matter of 1 μ l is added toward the competent cell of 40 μ l Grain, ice bath about 10min after mixing.The mixture liquid-transfering gun of competent cell and DNA is transferred to into the electric shock cup (purchase of ice pre-cooling From bio-rad) in, rapping makes suspension reach electric shock cup bottom, has been careful not to bubble.The electric shock cup is put into into electroporation chamber Slideway on, promote slideway by shock by electricity cup put to electroporation chamber base electrode.Using 0.1em specifications electric shock cup when, The program of MicroPulser (being purchased from bio-rad) is set to " Agr ", and electric shock is once.Electric shock cup is taken out immediately, adds 28 DEG C in advance The LB culture medium of heat.Quick and soft is beaten in cell with liquid-transfering gun.Suspension is proceeded to into the centrifuge tube of 1.5ml, at 28 DEG C 225rpm wave and culture 1h.The bacterium solution for taking 100-200 μ l coats (LB solid culture on corresponding resistance screening culture medium flat plate Base, containing 50 μ g/ml rifampicin, 50 μ g/ml streptomycins, 50 μ g/ml kanamycin), 28 DEG C of cultures.

Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method

With 75% alcohol-pickled tobacco seed, (countries tobacco mid-term storehouse obtains unit：Compile in Nicotiana tabacum L. institute of the Chinese Academy of Agricultural Sciences, storehouse Number I5A00660) 30s, is then washed twice with sterilizing distilled water.Again 8min is soaked with 0.1% mercuric chloride, then with sterilizing distilled water Wash twice, complete surface sterilizing.The tobacco seed of surface sterilizing is placed in into MS solid mediums (containing 18.78mM KNO₃、 1.25mM KH₂PO₄、20.6mM NH₄NO₃、1.5mM MgSO₄、3.0mM CaCl₂、50μM KI、100μM H₃BO₃、100μM MnSO₄、30μM ZnSO₄、1μM Na₂MoO₄、0.1μM CoCl₂、100μM Na₂EDTA、100μM FeSO₄, 7.4g/l agar, 30g/l sucrose) under aseptic condition germinate, prepare aseptic seedling.The leaf dish that tests for sterility is cut into 5mm × 5mm sizes is taken, is used In During Agrobacterium leaf dish 10min containing expression vector rd29A-GhCzf6-2300 of exponential phase, bacterium solution is blotted, 2 days (MS solid mediums) is co-cultured under dark condition.Blade is gone to into differentiation solid medium (the MS+1mg/l basic elements of cell division (BA)+0.1mg/l naphthalene acetic acids (NAA)+50mg/l kanamycin+500mg/l cephamycins) on, photoperiod 16h/8h (light intensity Cultivate 45 days or so under the conditions of 2000-3000Lx), cut after bud is grown up and be transferred to rooting solid culture medium (MS+50mg/l cards That mycin+500mg/l cephamycins) middle culture 30 days or so, seedling is proceeded to only added with 500mg/L cephalos after well developed root system Preservation is numbered on the MS solid mediums of mycin.

The blade of the transgenic tobacco plant that clip is obtained, extracts DNA (with arabidopsiss DNA extraction method in embodiment 3), With SEQ ID NO：8 and SEQ ID NO：9 performing PCRs amplification identification (50 μ l PCR reaction systems：5μl 10×Ex Buffer、3μ The dNTP of l 2.5mM, 2.0 μ l DNA, 1.0 μ l Ex Taq, 10 μM of primer SEQ ID NO：8 and SEQ ID NO：9 each 2.0 μ L and 35 μ l distilled waters.PCR reaction conditions：94 DEG C of denaturations 5min, 33 circulation (94 DEG C of degeneration 30s, 58 DEG C annealing 30s, 72 DEG C of extension 2min), 72 DEG C of extension 10min), it is TOF1-TOF20 that PCR is accredited as into positive plant numbering.

Drought resisting simulation experiments of the overexpression GhCzf6 transgene tobaccos T1 of embodiment 6 for plant

Sterilized Vermiculitum is impregnated with 1/2MS culture medium.TOF1-TOF20 transgene tobaccos and the seed point of control Nicotiana tabacum L. Do not sow on Vermiculitum, 15 seeds, 25 DEG C, optical culture/14 hour light culture circulation in 10 hours are sowed per basin.One was poured per 5 days Secondary 1/2MS, culture is used for arid experiment, transgene tobacco, control in 25 days per 4-5 more consistent Seedling of basin reservation size afterwards Nicotiana tabacum L. 14 days (not watering) of arid, 25 DEG C, optical culture/14 hour light culture circulation in 10 hours.For transfer-gen plant, (in TO generations, turn T1 The plant that the seed of gene plant grows up to) Identification of Drought show that adjoining tree is all wilted seriously, and T1F5, T1F7, Seven strains of T1F9, T1F12, T1F15, T1F16, T1F19 have in totally 35 Nicotiana tabacum L.s 24 can normal growth, show substantially Drought resistance (see Fig. 3, by taking T1F9, T1F12 as an example, the result and T1F9, T1F12 of T1F5, T1F7, T1F15, T1F16, T1F19 It is similar, be not shown here).

Embodiment 7 tests the positive Czf6 protein expressions of i on transcriptional level

In embodiment 6 24 can be in the T of normal growth under drought condition₁For randomly selecting 8 in transfer-gen plant, in fact Applying in example 6 11 can not be in the T of normal growth under drought condition₁For randomly selecting 4 in transfer-gen plant, each clip arid 14 It blade 0.05g, with plant RNA extraction test kit (invitrogen) total serum IgE is extracted.Ultraviolet spectrophotometry total serum IgE In the absorbance of 260nm and 280nm, each RNA concentration is calculated.According to invitrogen reverse transcription reagent box Method shown in SuperScript III Reverse Transcriptase carries out reverse transcription, and (1 μ g total serum IgEs are used as template, reversion Record primer SEQ ID NO：9).By SEQ ID NO：8 and SEQ ID NO：9 amplification GhCzf6, detection Czf6 albumen is with respect to table Up to situation.Using the PrimeSTAR HS archaeal dna polymerases of TaKaRa, by template of the cDNA of reverse transcription performing PCR reaction is entered.50μ L PCR reaction systems：10 μ l 5 × PS Buffer, the dNTP of 3 μ l 2.5mM, 2.0 μ l cDNA, 1.0 μ l PrimeSTAR, 10 μM primer SEQ ID NO：10 and SEQ ID NO：11 each 2.0 μ l, and the distilled water of 30 μ l.PCR reaction conditions：94 DEG C pre- Degeneration 5min, 29 circulations (94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min), 72 DEG C of extension 10min.Product electricity Swimming result is as shown in Figure 4：M is DNALadder Marker (DL2000, purchased from Shenzhen Rui Zhen Bioisystech Co., Ltd), 1-8 For normal growth plant, 9-12 is to be unable to normal growth plant.Stripe size is in the same size with GhCzf6 shown in figure.As a result Show that the transcription of GhCzf6 in normal growth plant is stronger, it is impossible to transcribe or transcribe very without GhCzf6 in normal growth plant It is weak.

It will be understood by those skilled in the art that it is suitable for the change and adjustment outside specific description, and The present invention includes all of this change and adjustment.Inventor require the modification that falls in claims which follow scope and spirit and The right of change.

Claims (9)

1. the encoding gene of a zinc finger protein of Cotton Gossypii, is named as GhCzf6, its nucleotide sequence such as SEQ ID NO：2 institutes Show.

2. a kind of recombinant expression carrier, it contains nucleotide sequence and the institute of the gene described in claim 1 and the gene The expression control sequenc for stating expression vector is operably connected.

3. the carrier described in claim 2, it is the rd29A-GhCzf6-2300 carriers shown in accompanying drawing 2.

4. a kind of reconstitution cell, it contains the recombinant expressed load described in gene or Claims 2 or 3 described in claim 1 Body.

5. the reconstitution cell of claim 4, the reconstitution cell is restructuring agrobatcerium cell.

6. a kind of method for improving Nicotiana tabacum L. drought resistance, including：By described in the gene or Claims 2 or 3 described in claim 1 Recombinant expression carrier import Nicotiana tabacum L. or Tissues of Tobacco and make the gene expression.

7. a kind of method of prepare transgenosis plant, including：The culture under conditions of plant is effectively produced contains claim 1 institute The plant of the recombinant expression carrier described in the gene stated or Claims 2 or 3 or plant tissue, wherein the plant is cigarette Grass.

8. described in the gene described in claim 1, the recombinant expression carrier described in Claims 2 or 3 or claim 4 or 5 Reconstitution cell be used for improve plant drought resistance and the purposes for plant breeding, wherein the plant is Nicotiana tabacum L..

9. the albumen of the gene code described in claim 1, its sequence such as SEQ ID NO：Shown in 1.