CN102628055B - Cotton salt-tolerant gene GarCIPK for improving plant salt tolerance - Google Patents

Abstract

The invention discloses a cotton salt-tolerant gene, i.e. Gossypium wild dry land cotton CIPK-like protein phosphokinase GarCIPK. The gene has the sequence of SEQ ID No.1 in a sequence list. A cotton stress tolerance related gene is separated by an electronic cloning and reverse transcription-polymerase chain reaction (RT-PCR) technology, and function verification is performed by transferring gene into tobacco and shows that the salt tolerance of a transgenic plant is obviously improved.

Description

A kind of cotton resistant gene of salt GarCIPK that improves plant salt endurance

Technical field

The invention belongs to technical field of biological genetic engineering, is a kind of cotton of improving plant salt endurance GarCIPKGene.

Background technology

The soil salinization is current global resource environment problem and ecological problem.According to statistics, the whole world has 1,000,000,000 hectares soil existence salinification in various degree approximately, account for about 10% of the world land total area, and just there are nearly 100,000,000 hectares of salinification soils in China, along with expanding economy, the aggravation of industrial pollution, reason such as irrational irrigation and chemical fertilizer application are improper, the secondary salinization soil area makes agricultural sustainable development be subjected to serious obstruction enlarging year by year.Improvement utilizes, comprehensive regulation saline soil, and cultivating the salt tolerant new variety has become the key subjects of development the future of agriculture and environmental improvement to improve plant salt endurance.Therefore, discussion salt coping mechanism, excavation salt tolerant functional gene, cultivation salt tolerant new variety have important significance for theories to improve salt resistance of plants.

Utilize transgenic technology will have in the gene transferred plant of good character, developing efficiently with this, transgenosis new variety have broad application prospects.Some researchs have shown and plant itself have been reached salt-resistant related gene changes in the plant in other plants, can improve the salt tolerance of transgenic plant by transcriptional expression.

CIPK and CBL effectively in conjunction with forming the CBL-CIPK complex body, participate in Ca ²⁺Signalling system is replied environment stress, passes the signal along to the expression of coercing corresponding gene in terminal regulation and control downstream, interior certain of plant materials is coerced reach balance.At present, identified the member of portion C BL-CIPK signalling system, and in the research of some model plants, resolved this signal network and replied the function of environment stress plant, but the correlative study in the cotton is less.

Summary of the invention

The invention provides a kind of cotton protein phosphatase kinase c IPK proteinoid gene that improves plant salt endurance GarCIPK, described gene cDNA nucleotide sequence is shown in SEQ ID NO.1.

The cotton of described raising plant salt endurance GarCIPKThe protein of genes encoding has the described aminoacid sequence of SEQ ID NO.2 in the sequence table.

The invention provides and contain above-mentioned cotton protein phosphatase kinase gene GarCIPKPlant expression vector pCAMBIA2301.With cotton protein phosphatase kinase gene GarCIPKBe cloned into pCAMBIA2301, obtain pCAMBIA2301-CaMV35S-GarCIPK and pCAMBIA2301-RD29A-GarCIPK.

Gene of the present invention GarCIPKApplication in cultivating salt-tolerant plant.Described plant optimization is tobacco.

Beneficial effect of the present invention: utilize existing plant gene engineering technology, utilize electronic cloning and RT-PCR technology, separate and evaluation cotton salt-resistant related gene sequence information, and change gene over to tobacco by agrobacterium tumefaciens-mediated transformation, obviously improve through the salt tolerant power of salt tolerant phenotypic evaluation proof transfer-gen plant.

Description of drawings

The amplification of Fig. 1 GarCIPK full length gene cDNA sequence

Fig. 2,3 real-time fluorescence quantitative PCR methods (qRT-PCR) are analyzed salt and are handled different times GarCIPKThe expression of gene in blade and root

The structure of Fig. 4 plant expression vector pCAMBIA2301-CaMV35S-GarCIPK and pCAMBIA2301-RD29A-GarCIPK

(a) intestinal bacteria pCAMBIA2301-CaMV35S-GarCIPK PCR detects electrophoresis result; (b) intestinal bacteria pCAMBIA2301-RD29A-GarCIPK PCR detects electrophoresis result; (c) enzyme of pCAMBIA2301-CaMV35S-GarCIPK is cut evaluation; (d) pCAMBIA2301-RD29A-GarCIPK plasmid enzyme restriction is identified

The PCR of Fig. 5 transfer-gen plant identifies

(a) PCR amplification vector pCAMBIA2301-CaMV35S-CIPK resistance tobacco goal gene; (b) PCR amplification vector pCAMBIA2301-RD29A-CIPK resistance tobacco goal gene

Fig. 6 transgene tobacco and wild-type are to impinging upon the growth under the different concns NaCl processing

(a) and (b), (c): be grown on the MS substratum that contains different concns NaCl

Under the measuring N aCl condition of Fig. 7 root length, 25 ° of C cultivate the 10th day the long performance of root.This figure represents the statistical study of wild-type and transgenic line germination rate under 0mM, 150mM and the 200mM NaCl condition

Embodiment

Embodiment 1, GarCIPKThe acquisition of gene

1.1 the extraction of RNA

Extract RNA

(1) gets the fresh cotton tissue of 0.5g, add 0.1g crosslinked polyethylene arsenic pyrrolidone (PVPP), in liquid nitrogen, fully be ground to powder, the agar end is changed over to rapidly in the 10ml centrifuge tube, the Tris-HCl that adds 5ml CTAB extracting solution and 500 μ L0.1M pH8.0,65 ℃ of water-bath 20min, mixing overturns midway;

(2) add the abundant mixing of equal-volume chloroform, ice bath leaves standstill 10min;

(3) 4 ℃, the centrifugal 20min of 10000rpm.Be sub-packed in 4 1.5ml centrifuge tubes;

(4) suct clearly, add the 8M LiCl mixing of 1/3 volume ,-70 ℃ of 30min or-20 ℃ spend the night;

(5) 4 ℃, the centrifugal 20min of 10000rpm.Abandon supernatant, after twice of 70% washing with alcohol, dry up resolution of precipitate in 30 μ L DEPC water;

(6) add DNase and the 25U RNase Inhabitor that 10U does not have the RNase activity, add the equal-volume chloroform behind 10 * buffer digestion 30min, extracting once;

(7) supernatant is transferred in the new pipe, adds 3M pH 5.2 NaAc of 1/10 volume and the dehydrated alcohol of isopyknic Virahol or 2.5 times of volumes, and-20 ℃ of placements are spent the night or-70 ℃ of ice bath 3h;

(8) 4 ℃, the centrifugal 20min of 10000rpm abandons supernatant, is dissolved in 30 μ L DEPC water after twice of 70% washing with alcohol.Namely get cotton RNA.

1.2 cDNA's is synthetic

System:

Synthesizing of cDNA first chain

Template (the RNA 100ng that above-mentioned no DNA pollutes) 6 μ L

OligdT universal primer (50 μ M) 1 μ L

dNTP（10mM） 2 μL

RNase inhibitor (40U/ μ L) 0.5 μ L

DEPC water 6 μ L

65 ° of C(10 min) → on ice place (2 min)

M-MLV (ThermoScript II, takara, 200U μ L ^-1) 0.5 μ L

5×buffer 4 μL

42 °C（2h）→ 70 °C （10min）→ 4 °C

1.3 cDNA clone

About 576bp protein phosphatase kinases distinguished sequence (SEQ ID NO.9) of transcribing group order-checking acquisition according to this nonirrigated farmland, laboratory cotton is probe, utilize the method for electronic cloning, the NCBI on-line analysis obtains a series of homology EST (NP_851258.2, BAB11035.1, ABF99892.1, AAB65477.1, AAA02840.1, AAB65483.1, AAM13129.1, AAM60822.1, AAP68289.1).The splicing sequence, through predictive genes, use software ORF Finder(http then: //www.ncbi.nlm.nih.gov/gorf/gorf. html) predict complete ORF.

At ORF sequence both sides design upstream primer 5 '-GATGGTG GTGAGA AAAGTAGGGAA GTA-3 ' (SEQ ID NO.3) and downstream primer 5 '-CAGGTCAACGT-CTTTTA CTCCTAGA – 3 ' (SEQ ID NO.4), carry out RT-PCR with nonirrigated farmland cotton cDNA (synthetic by step 1.2), obtain comprising whole encoder block GarCIPKThe cDNA clone, total length 1350bp(Fig. 1).Reclaim this fragment, be cloned in the T-carrier and identify, check order.Sequencing result is compared through Blast, prove to expand sequence correct, compare with the electronic cloning sequence, the sequence similarity degree is 97.34%.

1.3.1 PCR reaction system (20 μ L)

cDNA 1μL

10×PCR buffer 2μL

MgCl ₂(10mmol/L) 1.6μL

10mM dNTP 0.4μL

Primer1(10μM) 1μL

Primer1(10μM) 1μL

rTaq 0.2μL

ddH ₂O 12.8μL

1.3.2 pcr amplification program: 94 ℃ of 5min; 94 ℃ of 30sec, 55 ℃ of 45sec, 72 ℃ of 1 min30sec, 36 circulations; 72 ℃ of 10 min; 4 ℃ of insulations.

C, amplification obtain this gene ORF sequence, and reclaim amplified production, and be cloned into the PTG19-T carrier, screening positive clone, order-checking is finished by the handsome company in Shanghai.

1.4 gene expression analysis (qRT-PCR)

1.4.1 the extraction of RNA under the salt stress

Material Gossypium wild species nonirrigated farmland cotton is sowed at nonirrigated farmland cotton seed in the basin alms bowl, waits that the seedling that grows to about 20cm takes out from soil, and the earth on the flush away root is immersed in seedling and contains 200 mM NaCl solution (C wherein _Na+: C _Ca2+Be 15:1) nutritive medium in, handle seedling (0h, 1h, 3h, 6h, 12h, 24h, 36 h, 48 h, 72h) by different treatment time, get blade, root respectively, extract RNA, method is the same.

1.4.2 reverse transcription (RT) produces cDNA

Method is the same.

1.4.3 PCR reaction

1. be template with cDNA, primer is

GarCIPK-RT-F：5‘-CGAAAGCGTTGCCATGAAAGTCCTC-3’（ SEQ ID NO.5）

GarCIPK-RT-R：5‘-GCTTCCGCTTCACTAAGACGACCTT-3’（ SEQ ID NO.6）

2. PCR reaction system:

SYBR Premix Ex Taq（2×） 10μL

GarCIPK-RT-F（10μM） 0.4μL

GarCIPK-RT-R（10μM） 0.4μL

ROX Reference Dye ll (50×) 0.4μL

cDNA 2.0μL

ddH ₂O 6.8μL

3. PCR program:

The group of PCR reaction is added on respectively in the special-purpose 96-orifice plate of qRT-PCR (Applied Biosystems), add a cover special-purpose high transmission rate and seal film (Applied Biosystems), with Applied Biosystems 7500 Fast Real-Time PCR System) carry out qRT-PCR, adopt two-step approach pcr amplification standard program: 95 ℃ of 30 sec; 95 ℃ of 40 sec, 60 ℃ of 30 sec totally 40 circulation; 95 ℃ of 15sec, 60 ℃ of 1min, 95 ℃ of 15 sec.

Each sample repeats for three times.

Reaction finishes the back and confirms amplification curve and solubility curve, can be by the big specificity of solubility curve analysis confirmation PCR reaction.Calculate the CT value, the results are shown in Figure 2,3.

The structure of embodiment 2, plant expression vector

2.1 the structure of pCAMBIA2301-CaMV35S-GarCIPK plant expression vector

Plant expression vector pCAMBIA2301-CaMV35S (available from Biovector Science Lab) plasmid, selecting for use BamH I and Knp I respectively pCAMBIA2301 and target gene fragment to be carried out enzyme cuts, reclaim the big fragment of carrier and target gene fragment, connect back transformed into escherichia coli DH5 α competent cell with the T4 ligase enzyme, namely obtain having the plant expression vector of goal gene behind the evaluation recon.

The enzyme of pCAMBIA2301 plasmid and target gene fragment is cut

Plasmid double digestion system is as follows:

10×K buffer 5μL

2301 plasmids, 25 μ L

BamHⅠ 0.5μL

KnpⅠ 0.5μL

Aseptic dd H ₂O 19 μ L

Cut 5h in 30 ℃ of enzymes.Sepharose carries out electrophoresis detection to the double digestion product behind the double digestion, the results are shown in Figure 3.

GarCIPK fragment double digestion system:

10×K buffer 5μL

The GarCIPK PCR product 30 μ L of purifying

BamHⅠ 1μL

KnpⅠ 1μL

Aseptic dd H ₂O 13 μ L

30 ℃ of enzymes are cut 12h

Reclaim the big fragment of pCAMBIA2301 carrier and target gene fragment.

2.1.1 gene and enzyme are cut being connected of the big fragment of pCAMBIA2301 that obtains

The ligation system:

pCAMBIA2301 5μL

CIPK fragment double digestion product 3 μ L

10×ligase buffer 1μL

T4 DNA ligase 1μL

4 ℃ of connections are spent the night or 16 ℃ of connection 2h.

2.1.2 transformed into escherichia coli

Connect product transformed into escherichia coli competent cell, 37 ℃ of shaking culture in containing the LB liquid nutrient medium of Amp100mg/l.

2.1.4 the evaluation of recon

1. PCR identifies

Picking list colony inoculation contains 37 ℃ of shaking culture in the LB liquid nutrient medium of penbritin in 1.5mL, carry out pcr amplification with GarCIPK gene-specific primer GarCIPK-F-BamHI:5 ' CGCGGATCCGATGGTGGTGAGAAAAGTAGGGAAGTA3 ' (SEQ ID NO.7) and GarCIPK-R-KpnI:5 '-GGGGTACCCAGGTCAACGTCTT TTACTCCTAGA-3 ' (SEQ ID NO.8), agarose gel electrophoresis detects whether contain the expection fragment.The PCR response procedures is as follows:: 94 ℃ of 5min; 94 ℃ of 30sec, 55 ℃ of 45sec, 72 ℃ of 1 min30sec, 36 circulations; 72 ℃ of 10 min; 4 ℃ of insulations.

2. the enzyme of plasmid is cut evaluation

Extract plasmid with alkaline denaturation, choose BamH I and Knp I enzyme and carry out enzyme and cut, it is the same that enzyme is cut system, and whether agarose gel electrophoresis detects the expection fragment.

2.2 the structure of pCAMBIA2301-RD29A-GarCIPK plant expression vector

Plant expression vector pCAMBIA2301-CaMV35S (available from Biovector Science Lab) expression vector contains the binary vector of CaMV35S and NPT II gene, contains restriction enzyme Knp I and Xba I site in its multiple clone site.Use Knp I and Xba I double digestion carrier pCAMBIA2301-CaMV35S and RD29A fragment respectively, the pCAMBIA2301 carrier that excises the CaMV35S promotor is connected with the RD29A endonuclease bamhi, obtain the pCAMBIA2301-RD29A carrier.Use again pCAMBIA2301-RD29A with GarCIPKGene fragment makes up plant expression vector pCAMBIA2301-RD29A-GarCIPK, and method is the same, the results are shown in Figure 4.

Embodiment 3, the competent preparation of Agrobacterium and conversion

3.1 the competent preparation of Agrobacterium EHA105

(1) the single bacterium colony of picking EHA105 is inoculated in the 5ml LB liquid nutrient medium, and 28 ℃, 200rpm concussion overnight incubation to OD600 value is 0.4;

(2) be inoculated in (in the 1L triangular flask) in the 400-500ml LB substratum with 1:100, shaking bacterium is 0.6-0.8 to OD600, ice bath 10min;

(3) collect bacterium liquid, 4 ℃, 5000rpm, centrifugal 5min in the 50ml centrifuge tube of precooling;

(4) abandon supernatant, the precipitation 0.1MCaCl of 10ml precooling ₂Fully suspend, 4 ℃, 5000rpm, centrifugal 5min;

(5) adding 4ml(decides according to thalline) precooling contains 15%0.1mol/L CaCl2 solution, suspension cell is placed several minutes on ice gently, the competent cell suspension;

(6) be distributed into the every pipe of 100 μ L-200 μ L, liquid nitrogen flash freezer, place-80 ℃ standby.

3.2 the heat shock of Agrobacterium EHA105 transforms

(1)-80 takes out competence in ℃ refrigerator, on ice freeze thawing;

(2) get 1-2 μ L recombinant plasmid respectively to EHA105 heat shock competence, tip-tap mixing, ice bath 5min;

(3) freeze 8min with liquid nitrogen then, place 37 ℃ of 5min again;

(4) leave standstill 2min on ice after, add the 800LB nutrient solution, 4h are cultivated in 28 ℃ of concussions;

(5) centrifugal 30s collects bacterium liquid, discards the 600ml supernatant, and remaining supernatant is used for resuspended bacterium piece, with glass stick applying solid LB culture medium flat plate (containing Kan 50mg/L, Rif 50mg/L), 28 ℃, is inverted cultivation 48h.

3.3 thalline PCR identifies

Thalline PCR method and program the same (with step 2.1.4).

Embodiment 4, transformation of tobacco and transgenosis functional verification

4.1 leaf dish method infects tobacco

4.1.1 infect

Win the blade that launches fully from tobacco seedling, place 70% ethanol to soak 1min, the 3min that sterilizes in 0.1% the mercuric chloride uses aseptic water washing 4-5 time again, after aseptic filter paper blots the moisture on surface, uses the scissors of the bacterium of going out that blade is cut into the square fritter of 1cm; The blade that shears is put into engineering bacteria liquid pCAMBIA2301-CaMV35S-GarCIPK respectively and pCAMBIA2301-RD29A-GarCIPK infects 5min, during do not stop rock bacterium liquid, the wound of blade is fully contacted with bacterium liquid; Bacterium liquid on the blade is blotted with aseptic filter paper.

4.1.2 cultivate altogether

Infected and blotted the leaf dish of surperficial bacterium liquid, pore faces up, and nestles up to be placed on (MS+ 6-BA 1.0mg/L+ IAA 0.1mg/L) on the common substratum, and 2d is cultivated at dark place.

4.1.3 screening and differentiation culture

Behind the dark cultivation 2d, be transformed on the screening division culture medium (MS+ 6-BA 1.0mg/L+ IAA 0.1mg/L+ Kan 100mg/L+ Cef 400mg/L), every 15d changes and once screens division culture medium, goes in the root media when the tobacco that differentiates grows to 3-5cm.

4.1.4 root culture

The tobacco plant division of breaking up to 3-5cm is downcut, be transferred to root media (1/2MS+ IBA 2.0mg/L)

4.1.5 transplant

When the root of regeneration plant grows to 5-8cm, open and seal film hardening 2-3d, seedling replanting to the basin alms bowl, is transplanted the initial 5-10d in back and will be covered transparent plastics, keep the humidity of 90%-100%, and beat a little apertures and be beneficial to gaseous interchange covering.The matrix of transplanting and basin alms bowl be sterilization in advance all.

4.2 the transgenic positive plant is identified

4.2.1 use the CTAB method, extract the tobacco transformed plant that screens under the kantlex selective pressure

4.2.2 PCR identifies positive plant

The genomic dna of pcr amplification transfer-gen plant is template, the primer gene-specific primer, and PCR reaction system and reaction conditions are the same, the results are shown in Figure 5.

4.3 tobacco transforms the resistance of system and identifies

4.3.1 sowing

Choose T1 for tobacco transgenic seed and wild type seeds, the ethanol with 75% (v/v) sterilization 5 min use 15% NaClO (v/v) sterilization 5 min again, use rinsed with sterile water 3-5 time, all residual NaClO solution of Ex-all; With the wild-type (in contrast) of sterilization and T1 for the homozygote seed 1/2MS (K that tiles respectively ⁺25mg L-1) and on the 1/2MS sowing substratum, secretly cultivates 2-3 d; Place 25/28 ℃ then, relative humidity 70% is cultivated under the condition of 16hr illumination every day/8hr dark.

4.3.2 the evaluation of seedling resistance of reverse test

Get wild-type plant and the transgenic positive plant of form growing way basically identical, be divided into two parts, portion is respectively to containing 0 mM L ^-1, 100 mM L ^-1With 200 mM L ^-1On the MS solid medium of different concns NaCl, in (25 ± 2) ℃, relative humidity 70%, growth during the illumination box of 16hr illumination every day/8hr dark is cultivated, each handles at least 10 young plants.Continue to cultivate after 10 days, observe transgene tobacco and wild-type tobacco growth of seedlings situation.In the whole growth process, dull and stereotyped vertical placement of MS.The results are shown in Figure 6,7.

SEQUENCE LISTING

＜110〉Jiangsu Province Agriculture Science Institute

＜120〉a kind of cotton resistant gene of salt GarCIPK that improves plant salt endurance

<130>

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 1350

<212> DNA

＜213〉cotton

<400> 1

atggtggtga gaaaagtagg gaagtatgag attggaagaa ctataggaga aggaaccttc 60

gctaaggtta agttcgccca aaataccgag accggcgaaa gcgttgccat gaaagtcctc 120

gatcgtagca ccattattaa acacaagatg gttgatcaga tcaaaaggga gatatctata 180

atgaagcttg ttagacatcc ttacgttgtt cgtttgcacg aggtcatagc aagccgaact 240

aagatttata taatcttgga gttcattacc ggtggtgaat tatttgataa aatagttcat 300

aaaggtcgtc ttagtgaagc ggaagctaga agattcttcc aacagctaat tgatggtgtg 360

gaatattgcc atagtaaggg agtctaccac agagatttga agcctgaaaa tcttttactt 420

gactccctgg gaaatttaaa gatttcagat tttggcctta gcgcgttgcc ggaacaagga 480

gttagcctcc tccggacaac atgtggtact ccaaactatg tggcaccaga ggtcctaagt 540

cacaagggat atgatggtgc tgtggcagat gtttggtctt gtggggtcat cctttatgtt 600

ttgatggcag gttatcttcc atttgacgag cttgatctca ccactctcta cagtaagatt 660

gagagagcag acttttcttg cccttcttgg tttcctgtgg gcgcgaaatc cttgattcat 720

agaattctag acccaaatcc tcaaactcgt attacaattg agcaaatcag gagcgatgag 780

tggtttaaca agggctatgt tcctgtcaga cttcttgagt atgaagatat taacttggat 840

gaagtaaatg ctgtttttga tgatccagag gttgataagg aagaaagggg taatgagcct 900

tcaggaaatg aggatatggg tcctttgagt cttaatgcat ttgacttgat cattctttct 960

caaggcttga accttgcaac gctttttgac cgtgggaagg acaatatgaa gtaccagaca 1020

cgatttgttt cacaaaagcc agcaagggtg gttctttcta ccatggaagt tgttgctcaa 1080

tcaatgggat ataagacaca tattcgtaat tataagatga gagttgaagg tccttcagct 1140

aataagaatt ctcatttgtc agttatcctc gaagttttcg aggtcgctcc cacattttta 1200

atggtagata tggaaaaagc agctggtgat gccggagaat acctaaagtt ttaccaggca 1260

ttttatagca acctcgagga gataatatgg aaaccaccaa atgaatcaag caaaaccagg 1320

atcaccaaat ctaggagtaa aagacgttga 1350

<210> 2

<211> 456

<212> PRT

＜213〉cotton

<400> 2

Gly Ala Arg Cys Ile Pro Lys Met Val Val Arg Lys Val Gly Lys Tyr

1 5 10 15

Glu Ile Gly Arg Thr Ile Gly Glu Gly Thr Phe Ala Lys Val Lys Phe

20 25 30

Ala Gln Asn Thr Glu Thr Gly Glu Ser Val Ala Met Lys Val Leu Asp

35 40 45

Arg Ser Thr Ile Ile Lys His Lys Met Val Asp Gln Ile Lys Arg Glu

50 55 60

Ile Ser Ile Met Lys Leu Val Arg His Pro Tyr Val Val Arg Leu His

65 70 75 80

Glu Val Ile Ala Ser Arg Thr Lys Ile Tyr Ile Ile Leu Glu Phe Ile

85 90 95

Thr Gly Gly Glu Leu Phe Asp Lys Ile Val His Lys Gly Arg Leu Ser

100 105 110

Glu Ala Glu Ala Arg Arg Phe Phe Gln Gln Leu Ile Asp Gly Val Glu

115 120 125

Tyr Cys His Ser Lys Gly Val Tyr His Arg Asp Leu Lys Pro Glu Asn

130 135 140

Leu Leu Leu Asp Ser Leu Gly Asn Leu Lys Ile Ser Asp Phe Gly Leu

145 150 155 160

Ser Ala Leu Pro Glu Gln Gly Val Ser Leu Leu Arg Thr Thr Cys Gly

165 170 175

Thr Pro Asn Tyr Val Ala Pro Glu Val Leu Ser His Lys Gly Tyr Asp

180 185 190

Gly Ala Val Ala Asp Val Trp Ser Cys Gly Val Ile Leu Tyr Val Leu

195 200 205

Met Ala Gly Tyr Leu Pro Phe Asp Glu Leu Asp Leu Thr Thr Leu Tyr

210 215 220

Ser Lys Ile Glu Arg Ala Asp Phe Ser Cys Pro Ser Trp Phe Pro Val

225 230 235 240

Gly Ala Lys Ser Leu Ile His Arg Ile Leu Asp Pro Asn Pro Gln Thr

245 250 255

Arg Ile Thr Ile Glu Gln Ile Arg Ser Asp Glu Trp Phe Lys Lys Ser

260 265 270

Tyr Val Pro Ala Arg Leu Ile Glu Tyr Glu Asp Ile Asn Leu Asp Asp

275 280 285

Val Asn Ala Val Phe Asp Asp Pro Glu Ile Asp Lys Glu Glu Arg Gly

290 295 300

Asp Glu Pro Ser Arg Asn Glu Asn Met Gly Pro Leu Asn Leu Asn Ala

305 310 315 320

Phe Asp Leu Ile Ile Leu Ser Gln Gly Leu Asn Leu Ala Thr Leu Phe

325 330 335

Asp Arg Gly Lys Asp Thr Met Lys His Gln Thr Arg Phe Val Ser Arg

340 345 350

Lys Pro Ala Arg Val Val Leu Ser Ser Met Glu Val Val Ala Gln Ser

355 360 365

Met Gly Tyr Lys Thr His Ile Arg Asn Tyr Lys Met Arg Val Glu Gly

370 375 380

Pro Ser Ala Asn Lys Asn Ser His Leu Ser Val Ile Leu Glu Val Phe

385 390 395 400

Glu Val Ala Pro Thr Phe Leu Met Val Asp Met Glu Lys Ala Ala Gly

405 410 415

Asp Ala Gly Glu Tyr Leu Lys Phe Tyr Gln Ala Phe Tyr Ser Asn Leu

420 425 430

Glu Glu Ile Ile Trp Lys Pro Pro Asn Glu Ser Ser Lys Thr Arg Ile

435 440 445

Thr Lys Ser Arg Ser Lys Arg Arg

450 455

<210> 3

<211> 27

<212> DNA

＜213〉artificial sequence

<400> 3

gatggtggtg agaaaagtag ggaagta 27

<210> 4

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 4

caggtcaacg tcttttactc ctaga 25

<210> 5

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 5

cgaaagcgtt gccatgaaag tcctc 25

<210> 6

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 6

gcttccgctt cactaagacg acctt 25

<210> 7

<211> 36

<212> DNA

＜213〉artificial sequence

<400> 7

cgcggatccg atggtggtga gaaaagtagg gaagta 36

<210> 8

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 8

ggggtaccca ggtcaacgtc ttttactcct aga 33

<210> 9

<211> 576

<212> DNA

＜213〉cotton

<400> 9

atggtggtca gaaaagtagg gaagtatgag attggaagaa caatcggcga aggaactttc 60

gcgaaggtta agttcgcgca aaacacggag accggcgaaa gtgttgccat gaaagtcctc 120

gatcgcagca ccattatcaa gcataaaatg gtcgatcaga tcaaaaggga gatatctata 180

atgaagcttg ttagacatcc ttacgttgtt cgtttgcacg aggttatagc gagtcgaact 240

aggatttata tcatcttgga gttcattact ggtggcgaat tattcgataa attagttcat 300

aatggtcgtt ttagtgaagc tgaagctaga agatatttcc aacagcttat tgatggtgtg 360

gaattttgcc atagcaaggg agtctaccac agagatttga agcctgaaaa tcttttactt 420

gattcccaag gaaatttaaa gatttcagat tttggcctta gcgcgttgcc agaacaagga 480

gttagcctac ttcggaccac gtgtggaact cccaactatg tagcaccaga ggttcttagt 540

cacaaggggt atgatggtgc tgtggcggac gtctgg 576

Claims (4)

1. cotton of improving plant salt endurance GarCIPKGene is characterized in that its sequence is shown in SEQ ID N0.1.

2. the cotton of the described raising plant salt endurance of claim 1 GarCIPKThe protein of genes encoding is characterized in that its aminoacid sequence is shown in SEQ ID N0.2.

3. the cotton that contains the described raising plant salt endurance of claim 1 GarCIPKExpression carrier.

4. expression vector according to claim 3 is characterized in that it being pCAMBIA2301-CaMV35S-GarCIPK and pCAMBIA2301-RD29A-GarCIPK.

Images