CN108948161B

CN108948161B - Application of four plant NAC transcription factor NAC089 genes in soybean and Nicotiana benthamiana and expression vector thereof

Info

Publication number: CN108948161B
Application number: CN201810758001.0A
Authority: CN
Inventors: 窦道龙; 景茂峰; 艾干; 白甜; 郑芷若
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2018-07-11
Filing date: 2018-07-11
Publication date: 2020-10-16
Anticipated expiration: 2038-07-11
Also published as: CN108948161A

Abstract

The invention belongs to the field of genetic engineering, and discloses application of four plant NAC transcription factor NAC089 genes and expression vectors thereof in soybean and Nicotiana benthamiana to resistance of phytophthora infestans of plants. Take Ben's tobacco as an example. The soybean and NAC089 gene in the Nicotiana benthamiana are transiently expressed in the Nicotiana benthamiana, so that the resistance of the Nicotiana benthamiana to phytophthora can be remarkably improved. Under the current situation that no particularly good method for preventing and controlling phytophthora exists, cloning of NAC089 gene is of great significance for cultivating crop varieties with phytophthora resistance by using genetic engineering means.

Description

Application of four plant NAC transcription factor NAC089 genes in soybean and Nicotiana benthamiana and expression vector thereof

Technical Field

The invention belongs to the field of genetic engineering, and discloses application of four plant NAC transcription factor NAC089 genes and expression vectors thereof in soybean and Nicotiana benthamiana to resistance of phytophthora infestans of plants.

Background

Phytophthora capsici is a broad-spectrum pathogenic bacterium and can cause serious harm to various economic crops such as hot pepper, tobacco and the like. Phytophthora capsici belongs to oomycetes, although the pathogenic bacteria are similar to fungi in form, the pathogenic bacteria are closely related to diatoms and blue-green algae in evolution and belong to the kingdom of pilos-penis organisms, so that common fungus bactericides are often ineffective to Phytophthora sojae and other oomycetes. The application of the plant disease-resistant variety overcomes the problems of phytotoxicity, environmental pollution and the like, and becomes an important means for realizing disease resistance in agricultural production.

During the long-term co-evolution of plants and pathogenic bacteria, a large number of disease resistance related genes are evolved by the plants in order to resist the pathogenic bacteria, wherein the disease resistance related genes comprise a plurality of NAC transcription factors which play a role in resisting diseases. NAC089 is a relatively specific transcription factor that contains not only the NAC domain but also a transmembrane domain, and plays an important role in the endoplasmic reticulum-mediated immune system. NAC089 can be introduced into crops to improve the resistance of the crops to phytophthora capsici. Taking Nicotiana benthamiana as an example, the resistance of Nicotiana benthamiana to phytophthora capsici can be remarkably improved by transiently expressing the NAC089 gene in soybean and Nicotiana benthamiana. Under the current situation that no particularly good method for preventing and controlling phytophthora capsici exists, cloning NAC089 is of great significance for cultivating crop varieties with phytophthora capsici resistance by using genetic engineering means.

Disclosure of Invention

The invention aims to make up the deficiency of preventing and treating crop epidemic diseases at present, and provides application of four plant NAC transcription factor NAC089 genes and expression vectors thereof in soybean and Nicotiana benthamiana in plant phytophthora resistance.

The purpose of the invention can be realized by the following technical scheme:

four NAC transcription factors NAC089 genes, NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2 genes from two plant materials of Nicotiana benthamiana and soybean (Glycine max) Williams 82 are shown in sequence as SEQ ID No. 1-4 in nucleotide sequences of the NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2 genes.

The proteins coded by the four NAC transcription factor NAC089 genes are NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2, and the amino acid sequences thereof are SEQ ID NO. 5-8.

An expression cassette, a recombinant expression vector, a transgenic cell line or a transgenic recombinant bacterium containing the NAC transcription factor NAC089 gene.

The recombinant expression vector containing the NAC transcription factor NAC089 gene is pBinGFP₂:NbNAC089-1，pBinGFP₂:NbNAC089-2，pBinGFP₂GmNAC089-1 and pBinGFP₂GmNAC 089-2. Constructing the recombinant expression vector pBinGFP of the NAC transcription factor genes NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2₂:NbNAC089-1，pBinGFP₂:NbNAC089-2，pBinGFP₂:GmNAC089-1，pBinGFP₂GmNAC 089-2. Expression vector pBinGFP from plant₂For starting vectors, NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2 genes are respectively inserted into pBinGFP₂The digestion site of Sam 1.

The NAC transcription factor NAC089 gene and the expression vector thereof can be used for constructing phytophthora-resistant (such as phytophthora capsici, phytophthora sojae and the like) crop varieties.

A method for constructing phytophthora-resistant crop varieties is characterized in that the genes or the recombinant expression vectors are introduced into crop plants, and positive transformation plants are obtained through resistance screening to obtain the phytophthora-resistant crop varieties.

The advantages and positive effects of the invention are shown in:

the invention clones four plant NAC transcription factor NAC089 genes from soybean and Nicotiana benthamiana, inserts the genes into an expression vector pBinGFP₂. The vector is introduced into crops, so that the resistance of the crops to phytophthora can be improved. The NAC transcription factor can be used for genetic engineering to construct epidemic disease-resistant crops, and provides powerful guidance for formulating disease-resistant strategies and controlling diseases in agricultural production.

Drawings

FIG. 1 transient expression of NAC089 gene in Nicotiana benthamiana increased resistance of Nicotiana benthamiana to Phytophthora capsici.

FIG. 2 is a statistic of lesion diameter of 36h inoculated with Phytophthora capsici after the left and right leaves of Nicotiana benthamiana express GFP and NAC089 proteins respectively.

Detailed Description

The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention.

Example 1 transient expression of NbNAC089-1, NbNAC089-2, GmNAC089-1, GmNAC089-2 in B.benthamiana improves resistance of B.benthamiana to Phytophthora capsici

1. Test strains

The test strain phytophthora capsici LT263 was stored in a plant of the phytophthora interaction laboratory of the university of agriculture of Nanjing (a conventional strain widely used by those skilled in the art). The strain is preserved in 10% V8 solid culture medium at 10 deg.c.

2. Preparation of test Nicotiana benthamiana seedlings

Nicotiana benthamiana (Nicotiana benthamiana) is sown in a plastic flowerpot (d is 10cm) filled with vermiculite (2-4mm), and is placed in a greenhouse with the light intensity of 14 h/10 h dark. After the plant grows for 7 days and two true leaves grow, the plant is transplanted until the volume ratio of vermiculite black soil is 5: 1 for 30 days, and leaves at the same 3, 4, 5 leaf positions were used to express GFP and NAC089 proteins, followed by inoculation with phytophthora capsici.

3. Preparation of test Soybean seedlings

The differential host soybean is sowed in a plastic flowerpot (d is 10cm) filled with vermiculite (2-4mm), 15 seeds are planted in each pot, the pot is placed in a greenhouse with 14h of illumination (strong light illumination)/10 h of darkness for growth, and after 7 days, two true leaves grow out, and 10 seedlings are reserved for inoculation. The variety used was Williams.

4. Extracting RNA from soybean and Nicotiana benthamiana, and obtaining cDNA of NAC089 gene

Collecting leaves of semen glycines and Nicotiana benthamiana, picking, quickly freezing with liquid nitrogen, cooling in mortar, and grinding. And (3) extracting and purifying the total RNA of the soybeans and the Nicotiana benthamiana according to a recommended method of the Tiangen total RNA extraction and purification kit. Referring to the method provided by the RNA reverse transcription kit of Novozan, oligo (dT) is used as a primer for reverse transcription synthesis of cDNA. The cDNA is taken as a template, corresponding upstream and downstream primers are used for PCR amplification, and the sequences of the primers are shown as SEQ ID NO. 9-16 in sequence.

The PCR reaction system comprises 2.5. mu.L of 10 × PCR reaction buffer, 1.5. mu.L of 1.5mM MgCl₂(ii) a 0.5. mu.L of 2.5mM dNTPs; 0.25. mu.L Taq DNA polymerase (5.0U/. mu.L); 0.5. mu.L of primer; 0.5 μ L template; make up to 25. mu.L with sterile water.

The reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1:30min, and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

Electrophoresis: the PCR product was detected by 1% agarose gel electrophoresis and the desired fragment (size approximately 1023bp) was excised using a UV gel imager. The PCR product was recovered by TaKaRa gel recovery kit and sent to Kingsry for sequencing. Four NAC transcription factors NAC089 genes, NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2 are obtained by amplification, and the sequencing result shows that the sequence of the NbNAC089-1 gene is shown as SEQ ID No.1, the sequence of the NbNAC089-2 gene is shown as SEQ ID No.2, the sequence of the GmNAC089-1 gene is shown as SEQ ID No.3, and the nucleotide sequence of the GmNAC089-2 gene is shown as SEQ ID No. 4. The amino acid sequences of the proteins encoded by four NAC transcription factor NAC089 genes NbNAC089-1, NbNAC089-2, GmNAC089-1 and GmNAC089-2 are shown as SEQ ID NO. 5-8 in sequence.

5. Construction of pBinGFP₂:NbNAC089-1，pBinGFP₂:NbNAC089-2，pBinGFP₂:GmNAC089-1，pBinGFP₂GmNAC089-2 expression vector

pBinGFP₂The empty vector plasmid SamI was digested. The cDNA and the vector were ligated using homologous recombinase from Novowed.

The reaction system is as follows: 2 μ L of 10 × CE II reaction buffer; mu.L of the PCR product; 2 mu L of the empty vector after enzyme digestion; 1 μ L of homologous recombinase; make up to 10. mu.L sterile water.

The reaction program is that the ligation product is transformed into colon bacillus DH5 α under the condition of 37 ℃ for 30min, transformants are screened on Kan resistance culture medium, positive clone is selected to extract plasmid for colony PCR identification, the identified positive clone is sequenced, and the pBinGFP is obtained correctly₂:NbNAC089-1，pBinGFP₂:NbNAC089-2，pBinGFP₂:GmNAC089-1，pBinGFP₂GmNAC089-2 expression vector.

6. Obtaining agrobacterium-infected cells

Carrying out streak culture on agrobacterium GV3101 strain on an LB solid culture medium plate, and carrying out inverted culture for 18-20h at the temperature of 28 ℃; placing the single colony in LB liquid culture medium (containing 100mg/L Rif), and performing shaking culture at 28 ℃ for 18-20 h; adding 100 times the volume of LB liquid culture medium (containing 100mg/L Rif) without antibiotics into the bacterial liquid, and performing shaking culture at 28 ℃ until OD600 is 0.3-0.5; cooling on ice, centrifuging at 4000r/min at 4 deg.C for 5min, and removing supernatant; adding 20mmol/L CaCl₂Suspending the precipitate with the solution, centrifuging at 4000r/min at 4 deg.C for 5min, and removing the supernatant; adding 20mmol/L CaCl₂The solution again suspended the pellet for further use.

7、pBinGFP₂:NbNAC089-1，pBinGFP₂:NbNAC089-2，pBinGFP₂:GmNAC089-1，pBinGFP₂:GmNAC089-2 expression vector and pBinGFP₂Empty vector transformation of agrobacterium

pBinGFP was prepared by electrotransformation₂:NbNAC089-1，pBinGFP₂:NbNAC089-2，pBinGFP₂:GmNAC089-1，pBinGFP₂GmNAC089-2 expression vector and pBinGFP₂Transforming agrobacterium cells by the empty vector; the cuvette was rinsed three times with 70% alcohol and then completely air dried. 100ng of the expression vector was added to the Agrobacterium-infected state and left on ice for 30 min. The agrobacterium-infected cells are transferred to an electric shock cup, and electric shock transformation is carried out by using the voltage of 2.5 kV. After the electric shock is finished, the agrobacterium competent cells are added into 400 mu L of LB liquid culture medium and are cultured for 2h under shaking at the temperature of 28 ℃. 20 mu L of the bacterial liquid is sucked and evenly smeared on a solid LB culture medium plate containing 50mm kanamycin and 25mm rifampicin, and inverted culture is carried out for 48h at the temperature of 28 ℃. And selecting a single colony for colony PCR to obtain a positive clone.

8. Transient expression of GFP and NAC089 proteins in Nicotiana benthamiana

The positive clones are placed in an LB liquid culture medium and shake-cultured for 30h at 28 ℃. The bacterial liquid was collected, centrifuged at 8000rpm for 2min, and 10mM MgCl was used₂And washing for three times. Finally, 10mM MgCl was used₂Diluting the bacterial liquid to OD₆₀₀The value is 0.3. Bacterial suspension and bacterial suspension 1 containing suppressor for silencing P19: mixing at a volume ratio of 1. The left and right sides of the same Benzenbacco lamina were separately injected with 1mL syringe.

9. Bunsen disease resistance assay with transient expression of GFP and NAC089 proteins

The leaf sections for which the expression of the protein was confirmed were cut and placed in a tray with a filter paper kept moist. Punching holes on the flat plate growth edge of the phytophthora capsici LT263 by using a 7mm puncher, and placing the punched bacterium plates on the left side and the right side of the tobacco leaf of the Nicotiana benthamiana in a left-right symmetrical mode. The trays were placed in an incubator at 25 ℃ in the dark for 36 h. The leaf was removed and then irradiated with a hand-held uv-luminometer. The darker colored region is the infected region of Phytophthora capsici LT 263. The diameter of the infected area was measured with a measuring ruler, and the leaf surface expressing GFP protein was used as a control to compare the effect of the four proteins on the resistance to Nicotiana benthamiana. It was found that four NAC089 proteins from soybean and nicotiana benthamiana significantly increased the resistance of nicotiana benthamiana to phytophthora capsici LT 263.

Sequence listing

<110> Nanjing university of agriculture

<120> application of four plant NAC transcription factor NAC089 genes and expression vectors thereof in soybean and Nicotiana benthamiana

<130>2018

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>1411

<212>DNA

<213> Ben tobacco (Nicotiana benthamiana)

<400>1

atgttaccag caaagtccgt cattcaatca gataatgaat ggttcttctt ttctcctcgt 60

ggaaggaagt atccaaacgg gtcgcaaagt aaaagggcaa ctgaatctgg ttactggaag 120

gccacaggaa aagaacgtaa tgtgaaatct ggttcgaatc tcattggcac aaagagaact 180

ctggtgttcc acactggtcg agcacctaaa ggacagagga cacattggat aatgcatgaa 240

tattgcatga gcggaaacac taattatcag aagccttcac caggacttga caggttccga 300

aattcaatta tgttaccgct tccgcactct ggagattttt attatgttac cactttccgc 360

actctggaga tttttattgc acatattgat tctatggttg tctgccgcct ccggaagaat 420

agtgagtttc atttgaatgg caccccaaga aatcaaagga atcaactgtc tgctaccgct 480

actgcaaccg ctcagtctgg agcaggacaa ttgggcagct tggaattggt cactgtaggg 540

ggttgctgtt gttcaaagga agggagtagc agtttttatt cccattcggt tgagcagatg 600

gactctggat cggaatctga taaaccaact aaagagttct ctcagcacga ttcttctggc 660

cacttcaagg actgtgatgg tgaagaggac tggtttgctg atataatgaa agatgatatc 720

attaagctag acgattcttc gttgaatgac caacctattt ccatggttcc cagtaggcct 780

gaatcctcga tatcaactca tgaagctaga gctgcgatgt ccggtgtggc tcctttccag 840

ggcactgcta atcgaagact cagactagta agggaaaaag tagtggtgtg tccagtaaag 900

ggatccagaa gatatgaagc taccaaaaag aataaaatgg gagtgagcac aagtagttca 960

ggaagatggc tgagaaacat gttttcagta aaaacaatga agcaatacgt gatgcctata 1020

tttctggttg cctttatatt actggtcatg cttcttagta tgttgggagt ctcacagcaa 1080

gtgaaatggc ttaggtgtgt tttcgttttg acgagcagct gaagttaaat acctatctgg 1140

tatgttgttt tagtaatatt tagtgtggga gttgaaaaag gaatgagttg tttgtggtat 1200

ttgagcttaa cacttaatta tttcaattca gaagtacagg gctgtaaata gaatgtgtaa 1260

tagaggtaga actttagatg gtggctataa acaaccattt gtttgtactt tgatttgcct 1320

gcatgaatta ttacaacagc tgaaatgtta tgcccttgaa aaatctgaat ttttacaagg 1380

aaaatccctt gtgttacaac atataattgt g 1411

<210>2

<211>1257

<212>DNA

<213> Ben tobacco (Nicotiana benthamiana)

<400>2

atggaagatg tatcaggttc tacagatgag aaaaaaggca gagaaatagt agaaagaagt 60

gaaaataatg gtaatgacga caagaatgtg gaaatttcag tagctacagc ttctactatg 120

tttccggggt ttcggttttg tcccacggat gaagagctga tatcgtatta cttaaagaag 180

aaagttgaag ggtctgatag atgtgttgaa gttatttctg aagttgagat ttggaaacat 240

gaaccttggg atctcccaga taaatccatt gttcaatcag ataatgaatg gttcttcttc 300

tctcctcgtg gaaggaaata cccgaatggc tcgcaaagta aaagggcgac tgagtctggt 360

tactggaagg ccacaggaaa aaaacgtaat gtgaagtctg gttcaaatat gattggcaca 420

aaaagaaccc tggtgttcca cacgggtagg gcaccgaaag gacagagaac acaatggata 480

atgcatgaat attgcatgac tggaaactct tattatcagg attcagtggt tgtttgccgc 540

ctccggaaga ataatgagtt tcatttgaat gacacccacg aaaacagaag gaatcatctg 600

ggaaatgact gcgccactgc tttgtctgga gcaggaaagt tgaacagttt ggagttgata 660

aatggagggg attgctgttc aaaagagggt agcagcagtt ttagttctca ttcggttgag 720

aagattgaat ctgggtcaga ttccgataag ctgactaaag agttgccgca gcaacagtcc 780

tctagtcaat ggaaggattg tgatgaagag gactgttttg ctgatataat gaaagatgat 840

atcgttaagc tagatgattc ttcatataag gcaagataca atgtgttgcc aatagccaat 900

aggaagcttg aatcatctac aaattcatca acccaggaat tccaagatgt aatgtctcat 960

aggctgcctt tccagggtac tgctaatcga agactaagac tacaaacgga aatagtgccc 1020

cgtcgagtag ggagatatga agctaataag aagaatggcc atgctgtgga tgctagtaga 1080

catttaagga ataacattat tccagtaaga agaataaagc aatggtcgat acctctgctt 1140

ctggtttcct tggcgttact ggtcatattt ctttgtatgt ttggaattcc ccacctaaaa 1200

tggcttaggc atcttcttgt tattactcca gctgaggttg ataccagacc tgcatag 1257

<210>3

<211>1683

<212>DNA

<213> Soybean (Glycine max)

<400>3

atgggtgagg cttcaggagc tggttctgct gattgtttca gccagatgat gtcgtcgatg 60

ccgggttttc gcttccatcc cacggatgag gagttggtga tgtactatct gaagcggaag 120

atttgtggga agaggctgaa gctcgacgtg attcgtgaaa ccgatgtgta taagtgggat 180

cctgaggatt tgcctgggca atctatattg aaaactggag ataggcaatg gttctttttc 240

tgtcacagag ataggaagta tcctaatggt ggaaggtcta accgagcaac cagacgtggg 300

tattggaaag caacgggaaa ggatcgtaac gtgatatgca attctaggtc agttggagtg 360

aaaaagaccc tggttttcta tgctggcaga gctcctagtg gtgagcggac tgattgggtt 420

atgcatgaat ataccttgga tgaagaggag cttaagagat gcctgggtgt taaggactat 480

tatgcacttt acaaggttta caagaaaagt ggacctggtc caaaaaatgg tgaacagtat 540

ggcgcaccat ttaatgaaga acagtgggca gatgatgaca tagtagattt taatatcaac 600

tcagctgatc aggaggctcc aaatgatgtt gataatggta atgtactgca gcctttgctt 660

gatgatgaaa tcgacaacat cattagggga attttggatg atgagcttgt ccttgatcag 720

cagcatgtga atggttatcc tgactttcct caggttgtta gtgaagaaac acaaagtact 780

gttgtggatc agttctctga ggctgtgatg ttccctgagc cagtcagaat cacacagcct 840

agcaaccaat tttttgatgc acagcctagc tttgacttca atcagccagt tacttctcat 900

ttgcatgttt ctgaagcatc tgaggtcact tctgcttcca gcattaaagc aaaggagctt 960

gattttaatg aggatggctt cttggaaatt aatgatctca ttgatactga acctatattg 1020

gcaaatatgg aaaatcctgt ggagtaccag cagtttgaag atgggttaag tgaacttgat 1080

ctgttccaag atgcacagat gtttcttcgt gacctggggc caattattca cgaaacagat 1140

tcacatgcat atacaaatgc atttgtcagc agcaatattg aaagtcaaag ttaccagttg 1200

ctgccaaatc cagaggatgc caatcaaact gtcggtgaat tctggatgca cggtgaaaga 1260

aacaccccaa gtgcatcaga aggctttgtt gattctttct cgctatcatc cccaggtgtt 1320

gtatatgaat ctgttggctt tcctacggaa ggcaataaca atcaaagtag cactgtggaa 1380

gatgttgcta caagtagctt ctcctctgctctctgggcct ttgttgagtc aatacctaca 1440

actcctgcat cagctgctga aagtgctttg gtgaaccgag cattgaatcg aatgtctagc 1500

ttcagcaggt tgaagatcaa gcacacaaac attgctgcag caggtaaaga cactgcaact 1560

atgaagagag caggcagaaa gggacttcca ttcctcttct tccctattat tattgcttta 1620

tgtgcttttt gttgggtttt tgttggaaac ttaagactat tggggagatg tgtctctcct 1680

tga 1683

<210>4

<211>1812

<212>DNA

<213> Soybean (Glycine max)

<400>4

atgggttcgg tggactgtta tccgtctcgt gtggacgatg cggccgtggt gtctctagat 60

tcgctgccgt tagggttccg attccgacct accgacgagg aactcgtcaa ttactacctg 120

cgacagaaga tcaacggtaa tggtcgcgag gtttgggtta tccgagaaat tgatgtctgc 180

aaatgggagc cttgggacat gcccggtttg tcggtggtac agactaagga tccggagtgg 240

ttcttcttct gtccacagga ccgaaagtat ccaaatgggc atcgattgaa cagagcgacg 300

aataatgggt attggaaggc gacggggaag gatcgtaaaa tcaagtctgg gacgattttg 360

attggaatga agaagacttt ggtgttctac actggtcgag cacccaaggg gaataggacc 420

aattgggtta tgcatgagta tcgccccact ttgaaggagc ttgatggtac caatcctgga 480

cagaatccat atgtcctttg tcgcttgttt aagaaacatg atgagagcct tgaagtttca 540

cactgtgatg aagcagagcc gactgcttcc actcctgtgg ctgcctatta ctccacagag 600

gaaatacaat ctgatctggc tgttgttgca ggatcgccgt cacaagttac agaagatgat 660

aagcatcagt caatgatccc tgcacactct gaggaagcaa tatccaatgt tgtaaccccg 720

gttgatcgcc gtactgatgg atatgatgct tgtgatgcac aaaatcaaat tgagttacca 780

actgcggagg agtttcaacc attgaacttt gatatatatt atgacccaag aagcgagcta 840

ctggatggca aattattctc ccctgtactt gcacatattc aaccagaatt tcattatcaa 900

gcaaacatcg aatcagatgg tcgatatggg cttcaatatg gtacaaatga gacaaacatg 960

tcagactttt tgaattcagt tgttaactgg gatcaagtac cctttgagga tcccaattgt 1020

caacagcaga gctacccctt gtttaatgtt aaggataaca tattaaacag cgacttagat 1080

tctgaacttg ccaatatgac atgtatgcaa gctggttatg cagagggggc aattgacgga 1140

aggattcctt tgttgataac ttcagaattt tgcagcacca ctggcatccc cgttgactgt 1200

gttggtgacg agcagaaaag caatgttggg ttatttcaaa acaattccca gagagctttt 1260

actgatgtta atatgggtca agtatacaat gtagttgatg attatgagca acaaagaatc 1320

tgtagtgcag ttgctagtgg caatactgga atcataagga ggcatcgtga ggtacgaaat 1380

gaacagctaa gcataaactc aacacaaggt actgcacaga ggagaattcg tttgtcaatg 1440

gctacacatg gctcaaataa gacggtgaaa agtgaaagtt gtgcacaaga agagctttat 1500

gcaaaaccag tcattgctgt gggggagaaa ggttcagaaa atcatgcttc tgatgaaagt 1560

gctactctta ctaatgatgg gaatgaactg cagaagacac ccgagtcaac cggcaaaaga 1620

aagatttctc aacaagttac aaaagcaggc tccaccttgg ggttgaaaga ccttttcttg 1680

ctcagaaggg tgcctcacat ttcaaaggct tcctcaaatc gcaccaagtg ctcttctgtt 1740

tttgtacttt ctgcctttgt aatggtctca ttagtggtct ttactgacat ttggggatat 1800

cttaaatttt aa 1812

<210>5

<211>373

<212>PRT

<213> Ben tobacco (Nicotiana benthamiana)

<400>5

Met Leu Pro Ala Lys Ser Val Ile Gln Ser Asp Asn Glu Trp Phe Phe

1 5 10 15

Phe Ser Pro Arg Gly Arg Lys Tyr Pro Asn Gly Ser Gln Ser Lys Arg

20 25 30

Ala Thr Glu Ser Gly Tyr Trp Lys Ala Thr Gly Lys Glu Arg Asn Val

35 40 45

Lys Ser Gly Ser Asn Leu Ile Gly Thr Lys Arg Thr Leu Val Phe His

50 55 60

Thr Gly Arg Ala Pro Lys Gly Gln Arg Thr His Trp Ile Met His Glu

65 70 75 80

Tyr Cys Met Ser Gly Asn Thr Asn Tyr Gln Lys Pro Ser Pro Gly Leu

85 90 95

Asp Arg Phe Arg Asn Ser Ile Met Leu Pro Leu Pro His Ser Gly Asp

100 105110

Phe Tyr Tyr Val Thr Thr Phe Arg Thr Leu Glu Ile Phe Ile Ala His

115 120 125

Ile Asp Ser Met Val Val Cys Arg Leu Arg Lys Asn Ser Glu Phe His

130 135 140

Leu Asn Gly Thr Pro Arg Asn Gln Arg Asn Gln Leu Ser Ala Thr Ala

145 150 155 160

Thr Ala Thr Ala Gln Ser Gly Ala Gly Gln Leu Gly Ser Leu Glu Leu

165 170 175

Val Thr Val Gly Gly Cys Cys Cys Ser Lys Glu Gly Ser Ser Ser Phe

180 185 190

Tyr Ser His Ser Val Glu Gln Met Asp Ser Gly Ser Glu Ser Asp Lys

195 200 205

Pro Thr Lys Glu Phe Ser Gln His Asp Ser Ser Gly His Phe Lys Asp

210 215 220

Cys Asp Gly Glu Glu Asp Trp Phe Ala Asp Ile Met Lys Asp Asp Ile

225 230 235 240

Ile Lys Leu Asp Asp Ser Ser Leu Asn Asp Gln Pro Ile Ser Met Val

245 250 255

Pro Ser Arg Pro Glu Ser Ser Ile Ser Thr His Glu Ala Arg Ala Ala

260 265 270

Met Ser Gly Val Ala Pro Phe Gln Gly Thr Ala Asn Arg Arg Leu Arg

275 280 285

Leu Val Arg Glu Lys Val Val Val Cys Pro Val Lys Gly Ser Arg Arg

290 295 300

Tyr Glu Ala Thr Lys Lys Asn Lys Met Gly Val Ser Thr Ser Ser Ser

305 310 315 320

Gly Arg Trp Leu Arg Asn Met Phe Ser Val Lys Thr Met Lys Gln Tyr

325 330 335

Val Met Pro Ile Phe Leu Val Ala Phe Ile Leu Leu Val Met Leu Leu

340 345 350

Ser Met Leu Gly Val Ser Gln Gln Val Lys Trp Leu Arg Cys Val Phe

355 360 365

Val Leu Thr Ser Ser

370

<210>6

<211>418

<212>PRT

<213> Ben tobacco (Nicotiana benthamiana)

<400>6

Met Glu Asp Val Ser Gly Ser Thr Asp Glu Lys Lys Gly Arg Glu Ile

1 5 10 15

Val Glu Arg Ser Glu Asn Asn Gly Asn Asp Asp Lys Asn Val Glu Ile

20 2530

Ser Val Ala Thr Ala Ser Thr Met Phe Pro Gly Phe Arg Phe Cys Pro

35 40 45

Thr Asp Glu Glu Leu Ile Ser Tyr Tyr Leu Lys Lys Lys Val Glu Gly

50 55 60

Ser Asp Arg Cys Val Glu Val Ile Ser Glu Val Glu Ile Trp Lys His

65 70 75 80

Glu Pro Trp Asp Leu Pro Asp Lys Ser Ile Val Gln Ser Asp Asn Glu

85 90 95

Trp Phe Phe Phe Ser Pro Arg Gly Arg Lys Tyr Pro Asn Gly Ser Gln

100 105 110

Ser Lys Arg Ala Thr Glu Ser Gly Tyr Trp Lys Ala Thr Gly Lys Lys

115 120 125

Arg Asn Val Lys Ser Gly Ser Asn Met Ile Gly Thr Lys Arg Thr Leu

130 135 140

Val Phe His Thr Gly Arg Ala Pro Lys Gly Gln Arg Thr Gln Trp Ile

145 150 155 160

Met His Glu Tyr Cys Met Thr Gly Asn Ser Tyr Tyr Gln Asp Ser Val

165 170 175

Val Val Cys Arg Leu Arg Lys Asn Asn Glu Phe His Leu Asn Asp Thr

180 185 190

His Glu Asn Arg Arg Asn His Leu Gly Asn Asp Cys Ala Thr Ala Leu

195 200 205

Ser Gly Ala Gly Lys Leu Asn Ser Leu Glu Leu Ile Asn Gly Gly Asp

210 215 220

Cys Cys Ser Lys Glu Gly Ser Ser Ser Phe Ser Ser His Ser Val Glu

225 230 235 240

Lys Ile Glu Ser Gly Ser Asp Ser Asp Lys Leu Thr Lys Glu Leu Pro

245 250 255

Gln Gln Gln Ser Ser Ser Gln Trp Lys Asp Cys Asp Glu Glu Asp Cys

260 265 270

Phe Ala Asp Ile Met Lys Asp Asp Ile Val Lys Leu Asp Asp Ser Ser

275 280 285

Tyr Lys Ala Arg Tyr Asn Val Leu Pro Ile Ala Asn Arg Lys Leu Glu

290 295 300

Ser Ser Thr Asn Ser Ser Thr Gln Glu Phe Gln Asp Val Met Ser His

305 310 315 320

Arg Leu Pro Phe Gln Gly Thr Ala Asn Arg Arg Leu Arg Leu Gln Thr

325 330 335

Glu Ile Val Pro Arg Arg Val Gly Arg Tyr Glu Ala Asn Lys Lys Asn

340 345 350

Gly His Ala Val Asp Ala Ser Arg His Leu Arg Asn Asn Ile Ile Pro

355 360 365

Val Arg Arg Ile Lys Gln Trp Ser Ile Pro Leu Leu Leu Val Ser Leu

370 375 380

Ala Leu Leu Val Ile Phe Leu Cys Met Phe Gly Ile Pro His Leu Lys

385 390 395 400

Trp Leu Arg His Leu Leu Val Ile Thr Pro Ala Glu Val Asp Thr Arg

405 410 415

Pro Ala

<210>7

<211>560

<212>PRT

<213> Soybean (Glycine max)

<400>7

Met Gly Glu Ala Ser Gly Ala Gly Ser Ala Asp Cys Phe Ser Gln Met

1 5 10 15

Met Ser Ser Met Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu

20 25 30

Val Met Tyr Tyr Leu Lys Arg Lys Ile Cys Gly Lys Arg Leu Lys Leu

35 40 45

Asp Val Ile Arg Glu Thr Asp Val Tyr Lys Trp Asp Pro Glu Asp Leu

50 55 60

Pro Gly Gln Ser Ile Leu Lys Thr GlyAsp Arg Gln Trp Phe Phe Phe

65 70 75 80

Cys His Arg Asp Arg Lys Tyr Pro Asn Gly Gly Arg Ser Asn Arg Ala

85 90 95

Thr Arg Arg Gly Tyr Trp Lys Ala Thr Gly Lys Asp Arg Asn Val Ile

100 105 110

Cys Asn Ser Arg Ser Val Gly Val Lys Lys Thr Leu Val Phe Tyr Ala

115 120 125

Gly Arg Ala Pro Ser Gly Glu Arg Thr Asp Trp Val Met His Glu Tyr

130 135 140

Thr Leu Asp Glu Glu Glu Leu Lys Arg Cys Leu Gly Val Lys Asp Tyr

145 150 155 160

Tyr Ala Leu Tyr Lys Val Tyr Lys Lys Ser Gly Pro Gly Pro Lys Asn

165 170 175

Gly Glu Gln Tyr Gly Ala Pro Phe Asn Glu Glu Gln Trp Ala Asp Asp

180 185 190

Asp Ile Val Asp Phe Asn Ile Asn Ser Ala Asp Gln Glu Ala Pro Asn

195 200 205

Asp Val Asp Asn Gly Asn Val Leu Gln Pro Leu Leu Asp Asp Glu Ile

210 215 220

Asp Asn Ile Ile Arg Gly Ile Leu Asp Asp Glu Leu Val Leu Asp Gln

225 230 235 240

Gln His Val Asn Gly Tyr Pro Asp Phe Pro Gln Val Val Ser Glu Glu

245 250 255

Thr Gln Ser Thr Val Val Asp Gln Phe Ser Glu Ala Val Met Phe Pro

260 265 270

Glu Pro Val Arg Ile Thr Gln Pro Ser Asn Gln Phe Phe Asp Ala Gln

275 280 285

Pro Ser Phe Asp Phe Asn Gln Pro Val Thr Ser His Leu His Val Ser

290 295 300

Glu Ala Ser Glu Val Thr Ser Ala Ser Ser Ile Lys Ala Lys Glu Leu

305 310 315 320

Asp Phe Asn Glu Asp Gly Phe Leu Glu Ile Asn Asp Leu Ile Asp Thr

325 330 335

Glu Pro Ile Leu Ala Asn Met Glu Asn Pro Val Glu Tyr Gln Gln Phe

340 345 350

Glu Asp Gly Leu Ser Glu Leu Asp Leu Phe Gln Asp Ala Gln Met Phe

355 360 365

Leu Arg Asp Leu Gly Pro Ile Ile His Glu Thr Asp Ser His Ala Tyr

370 375 380

Thr Asn Ala Phe Val Ser Ser Asn Ile Glu Ser Gln Ser Tyr Gln Leu

385 390 395 400

Leu Pro Asn Pro Glu Asp Ala Asn Gln Thr Val Gly Glu Phe Trp Met

405 410 415

His Gly Glu Arg Asn Thr Pro Ser Ala Ser Glu Gly Phe Val Asp Ser

420 425 430

Phe Ser Leu Ser Ser Pro Gly Val Val Tyr Glu Ser Val Gly Phe Pro

435 440 445

Thr Glu Gly Asn Asn Asn Gln Ser Ser Thr Val Glu Asp Val Ala Thr

450 455 460

Ser Ser Phe Ser Ser Ala Leu Trp Ala Phe Val Glu Ser Ile Pro Thr

465 470 475 480

Thr Pro Ala Ser Ala Ala Glu Ser Ala Leu Val Asn Arg Ala Leu Asn

485 490 495

Arg Met Ser Ser Phe Ser Arg Leu Lys Ile Lys His Thr Asn Ile Ala

500 505 510

Ala Ala Gly Lys Asp Thr Ala Thr Met Lys Arg Ala Gly Arg Lys Gly

515 520 525

Leu Pro Phe Leu Phe Phe Pro Ile Ile Ile Ala Leu Cys Ala Phe Cys

530 535 540

Trp Val Phe Val Gly Asn Leu Arg Leu Leu Gly Arg Cys Val Ser Pro

545 550 555 560

<210>8

<211>604

<212>PRT

<213> Soybean (Glycine max)

<400>8

Met Gly Ser Val Asp Cys Tyr Pro Ser Arg Val Asp Asp Ala Ala Val

1 5 10 15

Val Ser Leu Asp Ser Leu Pro Leu Gly Phe Arg Phe Arg Pro Thr Asp

20 25 30

Glu Glu Leu Val Asn Tyr Tyr Leu Arg Gln Lys Ile Asn Gly Asn Gly

35 40 45

Arg Glu Val Trp Val Ile Arg Glu Ile Asp Val Cys Lys Trp Glu Pro

50 55 60

Trp Asp Met Pro Gly Leu Ser Val Val Gln Thr Lys Asp Pro Glu Trp

65 70 75 80

Phe Phe Phe Cys Pro Gln Asp Arg Lys Tyr Pro Asn Gly His Arg Leu

85 90 95

Asn Arg Ala Thr Asn Asn Gly Tyr Trp Lys Ala Thr Gly Lys Asp Arg

100 105 110

Lys Ile Lys Ser Gly Thr Ile Leu Ile Gly Met Lys Lys Thr Leu Val

115 120 125

Phe Tyr Thr Gly Arg Ala Pro Lys Gly Asn Arg Thr Asn Trp Val Met

130 135 140

His Glu Tyr Arg Pro Thr Leu Lys Glu Leu Asp Gly Thr Asn Pro Gly

145 150 155 160

Gln Asn Pro Tyr Val Leu Cys Arg Leu Phe Lys Lys His Asp Glu Ser

165 170 175

Leu Glu Val Ser His Cys Asp Glu Ala Glu Pro Thr Ala Ser Thr Pro

180 185 190

Val Ala Ala Tyr Tyr Ser Thr Glu Glu Ile Gln Ser Asp Leu Ala Val

195 200 205

Val Ala Gly Ser Pro Ser Gln Val Thr Glu Asp Asp Lys His Gln Ser

210 215 220

Met Ile Pro Ala His Ser Glu Glu Ala Ile Ser Asn Val Val Thr Pro

225 230 235 240

Val Asp Arg Cys Thr Asp Gly Tyr Asp Ala Cys Asp Ala Gln Asn Gln

245 250 255

Ile Glu Leu Pro Thr Ala Glu Glu Phe Gln Pro Leu Asn Phe Asp Ile

260 265 270

Tyr Tyr Asp Asp Pro Arg Ser Glu Leu Leu Asp Gly Lys Leu Phe Ser

275 280 285

Pro Val Leu Ala His Ile Gln Pro Glu Phe His Tyr Gln Ala Asn Ile

290 295 300

Glu Ser Asp Gly Arg Tyr Gly Leu Gln Tyr Gly Thr Asn Glu Thr Asn

305 310 315 320

Met Ser Asp Phe Leu Asn Ser Val Val Asn Trp Asp Gln Val Pro Phe

325 330 335

Glu Asp Pro Asn Cys Gln Gln Gln Ser Tyr Pro Leu Phe Asn Val Lys

340 345 350

Asp Asn Ile Leu Asn Ser Asp Leu Asp Ser Glu Leu Ala Asn Met Thr

355 360 365

Cys Met Gln Ala Gly Tyr Ala Glu Gly Ala Ile Asp Gly Arg Ile Pro

370 375 380

Leu Leu Ile Thr Ser Glu Phe Cys Ser Thr Thr Gly Ile Pro Val Asp

385 390 395 400

Cys Val Gly Asp Glu Gln Lys Ser Asn Val Gly Leu Phe Gln Asn Asn

405 410 415

Ser Gln Arg Ala Phe Thr Asp Val Asn Met Gly Gln Val Tyr Asn Val

420 425 430

Val Asp Asp Tyr Glu Gln Gln Arg Ile Cys Ser Ala Val Ala Ser Gly

435 440 445

Asn Thr Gly Ile Ile Arg Arg His Arg Glu Val Arg Asn Glu Gln Leu

450 455 460

Ser Ile Asn Ser Thr Gln Gly Thr Ala Gln Arg Arg Ile Arg Leu Ser

465 470 475 480

Met Ala Thr His Gly Ser Asn Lys Thr Val Lys Ser Glu Ser Cys Ala

485 490 495

Gln Glu Glu Leu Tyr Ala Lys Pro Val Ile Ala Val Gly Glu Lys Gly

500 505 510

Ser Glu Asn His Ala Ser Asp Glu Ser Ala Thr Leu Thr Asn Asp Gly

515 520 525

Asn Glu Leu Gln Lys Thr Pro Glu Ser Thr Gly Lys Arg Lys Ile Ser

530 535 540

Gln Gln Val Thr Lys Ala Gly Ser Thr Leu Gly Leu Lys Asp Leu Phe

545 550 555 560

Leu Leu Arg Arg Val Pro His Ile Ser Lys Ala Ser Ser Asn Arg Thr

565 570 575

Lys Cys Ser Ser Val Phe Val Leu Ser Ala Phe Val Leu Val Ser Leu

580 585 590

Val Val Phe Thr Asp Ile Trp Gly Tyr Leu Lys Phe

595 600

<210>9

<211>20

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>9

atgttaccag caaagtccgt 20

<210>10

<211>21

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>10

cacaattata tgttgtaaca c 21

<210>11

<211>20

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>11

atggaagatg tatcaggttc 20

<210>12

<211>19

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>12

ctatgcaggt ctggtatca 19

<210>13

<211>20

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>13

atgggtgagg cttcaggagc 20

<210>14

<211>23

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>14

tcaaggagag acacatctcc cca 23

<210>15

<211>20

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>15

atgggttcgg tggactgtta 20

<210>16

<211>22

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>16

ttaaaattta agatatcccc aa 22

Claims

1. NAC transcription factorNAC089A gene which isNbNAC089-2SaidNbNAC089-2The nucleotide sequence of (A) is shown in SEQ ID NO. 2.

2. The protein encoded by the gene of claim 1, which has the amino acid sequence shown in SEQ ID No. 6.

3. Comprising the NAC transcription factor of claim 1NAC089An expression cassette for a gene.

4. Comprising the NAC transcription factor of claim 1NAC089Recombinant expression vectors for genes.

5. Comprising the NAC transcription factor of claim 1NAC089Transgenic recombinant bacteria of the gene.

6. The recombinant expression vector according to claim 4, wherein the recombinant expression vector is the recombinant expression vector of claim 1NbNAC089-2Insert pBinGFP₂SmaI cleavage sites of the vector.

7. The NAC transcription factor of claim 1NAC089The gene is applied to the construction of a phytophthora capsici resistant Nicotiana benthamiana variety.

8. Use of the recombinant expression vector of claim 4 or 6 for the construction of P.capsorum resistant Nicotiana benthamiana.

9. A method for constructing a tobacco of Nicotiana benthamiana resistant to Phytophthora capsici, characterized in that the gene of claim 1 or the recombinant expression vector of claim 4 is introduced into a tobacco plant of Nicotiana benthamiana, and a positive transformed plant is obtained by resistance selection, thereby obtaining the tobacco of Nicotiana benthamiana resistant to Phytophthora capsici.