CN113337523A - Application of CRN effector protein gene in inducing plant resistance - Google Patents

Application of CRN effector protein gene in inducing plant resistance Download PDF

Info

Publication number
CN113337523A
CN113337523A CN202110479615.7A CN202110479615A CN113337523A CN 113337523 A CN113337523 A CN 113337523A CN 202110479615 A CN202110479615 A CN 202110479615A CN 113337523 A CN113337523 A CN 113337523A
Authority
CN
China
Prior art keywords
leu
glu
val
arg
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110479615.7A
Other languages
Chinese (zh)
Other versions
CN113337523B (en
Inventor
窦道龙
杨坤
景茂峰
汪燚
张欢欣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN202110479615.7A priority Critical patent/CN113337523B/en
Publication of CN113337523A publication Critical patent/CN113337523A/en
Application granted granted Critical
Publication of CN113337523B publication Critical patent/CN113337523B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a CRN effector protein gene and application thereof in inducing plant resistance. The invention identifies five CRN effector protein genes CRN12, CRN13, CRN20, CRN23 and CRN19 from Pythium oligandrum and Pythium winding, wherein the CRN12, CRN13, CRN20, CRN23 and CRN19 genes respectively have nucleotide sequences shown in SEQ ID NO. 1-5 in sequence. The five CRN effector genes identified in the invention from Pythium oligandrum and Pythium winding (Pythium periprocum) can trigger HR ROS to induce plant to generate resistance.

Description

Application of CRN effector protein gene in inducing plant resistance
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a CRN effector protein gene and application thereof in inducing plant resistance.
Background
During the long-term co-evolution of plants and pathogens, pathogens have evolved a number of host-attacking weapons, such as effector proteins (effectors), in order to better infect the plant. Pathogenic bacteria secrete these effector proteins into plants in order to promote their better infestation of the host plant, however, accompanying the co-evolution of plants, some effector proteins are recognized by the genes involved in the regulation of disease resistance by the plants themselves. Recognition of pathogens often triggers a local resistance response, called Hypersensitivity (HR), characterized by rapid cell death at the site of infection. This apparent HR response is also an important signal for the development of plant immunity for the study of plant interactions with pathogenic bacteria. Active oxygen accumulation is also a key signal for triggering plant immune response, and can also be used as a signal marker for triggering plant defense response. Inoculation of pathogenic bacteria using an agrobacterium-mediated transient expression system is the most direct method to assess whether genes can induce plant resistance.
Pythium oligandrum1And Pythium periplocum)2The plant growth promoter is widely existed in a plant root system ecosystem, induces plants to generate wide and long-term resistance to pathogenic bacteria by secreting a large amount of elicitors in the contact process of the plants, and has strong parasitism and antagonism to a plurality of pathogenic bacteria. At present, the pythium oligandrum product internationally takes oospores as an effective component, and related products based on pythium oligandrum immune induced protein are not developed yet. We obtained five genes from a large selection, from which homologous genes derived from Pythium oligandrum and Pythium winding (Pythium periplocum), respectively, can trigger the Hypersensitive Response (HR) and the accumulation of Reactive Oxygen Species (ROS) in plants. The CRN family of effector proteins generally have dual identities, oneThe group is capable of inducing disease resistance in plants, and the group is capable of promoting pathogen infection. 5 effectors capable of inducing plant disease resistance are screened from two biocontrol Pythium oligandrum and Pythium periplocum, and the method has great significance for developing a transgenic disease-resistant strategy and providing an environment-friendly disease-resistant strategy.
Disclosure of Invention
The invention aims to provide a CRN effector protein gene and application thereof in inducing plant resistance. The five CRN effector protein genes identified by the invention can be used as theoretical knowledge supplement for inducing plants to generate resistance and developing plant immunity inducer, and provide theoretical guidance for preventing and controlling crop diseases and insect pests.
The purpose of the invention can be realized by the following technical scheme:
the invention identifies five CRN effector protein genes CRN12, CRN13, CRN20, CRN23 and CRN19 from Pythium oligandrum and Pythium fascicularis, wherein the CRN12, CRN13, CRN20, CRN23 and CRN19 genes respectively have nucleotide sequences shown in SEQ ID NO. 1-5 in sequence. The proteins coded by the five CRN effector protein genes are five CRN effector proteins which sequentially and respectively have amino acid sequences shown as SEQ ID NO 6-10.
An expression cassette, a recombinant expression vector, a transgenic cell line or a transgenic recombinant bacterium containing the CRN effector protein gene.
The recombinant expression vector containing the CRN effector protein gene comprises PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN20, PBIN-PLUS CRN23 and PBIN-PLUS CRN 19.
Constructing recombinant expression vectors PBIN-PLUS of CRN-like effector protein genes CRN12, CRN13, CRN20, CRN23 and CRN19, wherein the recombinant expression vectors PBIN-PLUS comprise CRN12, PBIN-PLUS comprise CRN13, PBIN-PLUS comprise CRN20, PBIN-PLUS comprise CRN23 and PBIN-PLUS comprise CRN 19. The plant expression vector PBIN-PLUS is taken as a starting vector, and genes CRN12, CRN13, CRN20, CRN23 and CRN19 are respectively inserted into Kpn I and Xba I enzyme cutting sites of the PBIN-PLUS to obtain the gene.
The CRN effector protein gene and the expression vector thereof can stimulate plant immune response, provide a knowledge base for developing immune elicitors and provide theoretical guidance for preventing and controlling crop diseases and insect pests.
A plant immunity inducer contains the pythium oligandrum CRN effector protein or the fermentation liquor of the pythium oligandrum CRN effector protein.
The CRN effector protein gene, the CRN effector protein or the expression cassette, the recombinant expression vector, the transgenic cell line or the transgenic recombinant bacterium are applied to triggering HR ROS to induce the plant to generate resistance.
The CRN effector protein gene, the CRN effector protein or the expression cassette, the recombinant expression vector, the transgenic cell line or the transgenic recombinant bacterium are applied to the development of plant immunity inducer.
The CRN effector protein gene is applied to the cultivation of new varieties of disease-resistant crops.
A method for inducing plant resistance is to introduce the CRN effector protein gene or the expression cassette, the recombinant expression vector, the transgenic cell line or the transgenic recombinant bacterium into a plant to trigger HR ROS to induce the plant to generate resistance.
A method for cultivating disease-resistant crop varieties is characterized in that CRN effector protein genes or expression cassettes, recombinant expression vectors, transgenic cell lines or transgenic recombinant bacteria are introduced into plants, and positive transformation plants are obtained through resistance screening to obtain disease-resistant crop varieties.
The invention has the beneficial effects that:
five CRN effector protein genes are identified from Pythium oligandrum and Pythium periplocum and inserted into an expression vector PBIN-PLUS. The vector is introduced into a plant, can generate obvious HR ROS reaction, and stimulates the immunity of the plant. The five CRN effector protein genes can be used as potential candidates for developing plant immunity inducer and are a theoretical support for preventing and controlling plant diseases. Meanwhile, the gene can also be directly introduced into crops to prepare transgenic plants, and a novel transgenic disease-resistant strategy is provided.
Drawings
FIG. 1 is CRN19 triggering HR ROS to induce plant resistance.
Wherein A is HR phenotype induced by agrobacterium transient expression injection of the tobacco leaf slice; b, agrobacterium transient expression injection of the tobacco leaf slice can induce active oxygen accumulation; c is that the agrobacterium tumefaciens transient expression CRN19 gene can improve the resistance of the plant to phytophthora capsici on tobacco; d is the disease spot area statistics of agrobacterium induced disease resistance phenotype.
FIG. 2 is a graph showing that CRN12/13 triggers HR ROS to induce plant resistance.
Wherein A is HR phenotype induced by agrobacterium transient expression injection of the tobacco leaf slice; b, agrobacterium transient expression injection of the tobacco leaf slice can induce active oxygen accumulation; c is that agrobacterium tumefaciens transient expression CRN12 gene can improve the resistance of the plant to phytophthora capsici and the statistics of lesion area on tobacco; d is the agrobacterium transient expression CRN13 gene which can improve the resistance of the plant to phytophthora capsici and the statistics of the lesion area on the tobacco.
FIG. 3 is a graph of CRN20 triggering HR ROS to induce plant resistance.
Wherein A is HR phenotype induced by agrobacterium transient expression injection of the tobacco leaf slice; b, agrobacterium transient expression injection of the tobacco leaf slice can induce active oxygen accumulation; c is that the agrobacterium tumefaciens transient expression CRN20 gene can improve the resistance of the plant to phytophthora capsici on tobacco; d is the disease spot area statistics of agrobacterium induced disease resistance phenotype.
FIG. 4 is a graph of CRN23 triggering HR ROS to induce plant resistance.
Wherein A is HR phenotype induced by agrobacterium transient expression injection of the tobacco leaf slice; b, agrobacterium transient expression injection of the tobacco leaf slice can induce active oxygen accumulation; c is that the agrobacterium tumefaciens transient expression CRN23 gene can improve the resistance of the plant to phytophthora capsici on tobacco; d is the disease spot area statistics of agrobacterium induced disease resistance phenotype.
Detailed Description
The present invention will be described in detail with reference to specific examples. From the following description and these examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.
Example 1 amplification and sequencing of five CRN-like genes
1. Experimental strains
The test strains Pythium oligandrum (Pythium oligandrum) and Pythium circinelloides (Pythium periplocum) are preserved in 10% V8 solid medium at 10 ℃ in a plant disease system plant and phytophthora interaction laboratory of Nanjing university of agriculture.
2. Preparation of test Nicotiana benthamiana seedlings
Nicotiana benthamiana (Nicotiana benthamiana) is sown in a plastic flowerpot (d is 10cm) filled with vermiculite (2-4mm), and is placed in a greenhouse with the light intensity of 14 h/10 h dark. The plant is grown for 7 days, after two true leaves grow, the plant is transplanted to vermiculite black soil with the volume ratio of 5: 1 for 30 days, taking the same leaf blade with 3, 4 and 5 leaf positions as an expression experiment gene, and continuously observing whether the leaf blade phenotype has obvious HR or not for 7 days.
3. Extracting Pythium oligandrum (Pythium oligandrum) and Pythium irregulare (Pythium perplocum) RNA, and obtaining cDNA of target gene
Collecting Pythium oligandrum (Pythium oligandrum) and Pythium irregulare (Pythium perplocum) mycelia, quickly freezing with liquid nitrogen, placing into mortar, cooling, and grinding. And extracting and purifying the pythium ultimum total RNA according to a method recommended by a total RNA extraction and purification kit of Tiangen company. Referring to the method provided by the RNA reverse transcription kit of Novozam, oligo (dT) is used as a primer for reverse transcription synthesis of the cD NA. PCR was performed using the above-described cD N A as a template and the corresponding upstream and downstream primers (see Table 1 for primer sequences).
TABLE 1 primer sequences
name sequence
PyolCRN12-F GAGCTGTACAAGGGTACCATGGTGTTCTCCGTCGAG
PypeCRN13-F GAGCTGTACAAGGGTACCATGGTGTTCTCCGTCGAG
PyolCRN20-F GAGCTGTACAAGGGTACCATGTTTCCTGTGGACATT
PypeCRN23-F GAGCTGTACAAGGGTACCATGGTGTTCCCCGTGAGG
PypeCRN19-F GAGCTGTACAAGGGTACCATGGGTGTGTACGGCGAA
PyolCRN12-R GACTCTAGTTCATCTAGATCAGGTTTCGTTCGCGTA
PypeCRN13-R GACTCTAGTTCATCTAGATTAGGTTTCGTTCGCGTA
PyolCRN20-R GACTCTAGTTCATCTAGATCACGATAACTCCACAGT
PypeCRN23-R GACTCTAGTTCATCTAGATTACGTGTAATAGCTGAA
PypeCRN19-R GACTCTAGTTCATCTAGATTATGGTGATAGATTATA
The PCR reaction system is as follows: 2.5. mu.L of 10 XPCR reaction buffer; 1.5 μ L of 1.5mM MgCl 2; 0.5. mu.L of 2.5mM dNTPs; 0.25. mu.L Taq DNA polymerase (5.0U/. mu.L); 0.5. mu.L of primer; 0.5 μ L template; make up to 25. mu.L with sterile water.
The reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 1:30min, and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.
And (3) carrying out agarose gel electrophoresis and recovery on the PCR amplification product, and obtaining a sequence which is the nucleotide sequence of the 5 CRN genes after sequencing and no error. The CRN genes comprise CRN12, CRN13, CRN19, CRN20 and CRN23 from Pythium oligandrum (Pythium oligandrum) and Pythium fasciculum (Pythium perplocum), wherein the nucleotide sequences of the CRN12, CRN13, CRN19, CRN20 and CRN23 genes are respectively shown as SEQ ID NO. 1-5 in sequence. The amino acid sequences of the proteins coded by the five CRN genes are sequentially and respectively shown in SEQ ID NO. 6-10. Subsequent research finds that the plant growth regulator has strong functions of inducing plants to generate necrosis and active oxygen accumulation.
Example 2 construction of expression vectors for PBIN-PLUS GFP, PBIN-PLUS INF1, PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN19, PBIN-PLUS CRN20 and PBIN-PLUS CRN23
The empty vector plasmid of PBIN-PLUS (BIOVECTOR China plasmid vector strain cell line Gene Collection) was digested with Kpn I and Xba I. The target fragments (CRN12, CRN13, CRN20, CRN23 and CRN19) were ligated to the vector using homologous recombinase of Novozam. The PBIN-PLUS GFP and PBIN-PLUS INF1 vectors are constructed by connecting SmaI single enzyme digestion PBIN-PLUS empty vector plasmids with corresponding gene segments, and the construction method is a conventional method disclosed by the prior art.
The reaction system is as follows: 2 μ L of 10 × CE II reaction buffer; mu.L of the PCR product; 2 mu L of the empty vector after enzyme digestion; 1 μ L of homologous recombinase; make up to 10. mu.L sterile water.
The reaction procedure is as follows: the reaction was carried out at 37 ℃ for 30 min. And transforming the ligation product into escherichia coli DH5 alpha, screening transformants on a Kan resistance culture medium, and selecting positive clones to extract plasmids for colony PCR identification. Sequencing the identified positive clones, if correctThe PBIN-PLUS GFP and PBIN-PLUS INF1 were obtained4Expression vectors of PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN19, PBIN-PLUS CRN20 and PBIN-PLUS CRN 23.
EXAMPLE 3 transformation of Agrobacterium with expression vector and functional verification
1. Obtaining agrobacterium-infected cells
Carrying out streak culture on agrobacterium GV3101 strain on an LB solid culture medium plate, and carrying out inverted culture for 18-20h at the temperature of 28 ℃; placing the single colony in LB liquid culture medium (containing 100mg/L Rif), and performing shaking culture at 28 ℃ for 18-20 h; adding 100 times of the volume of the antibiotic-free bacterial liquid into the bacterial liquid, and performing shaking culture at 28 ℃ to obtain OD600 of 0.3-0.5; cooling on ice, centrifuging at 4000r/min at 4 deg.C for 5min, and removing supernatant; adding 20mmol/L CaCl2Suspending the precipitate with the solution, centrifuging at 4000r/min at 4 deg.C for 5min, and removing the supernatant; adding 20mmol/L CaCl2The solution again suspended the pellet for further use.
2. GFP in PBIN-PLUS, INF1 in PBIN-PLUS, CRN12 in PBIN-PLUS, CRN13 in PBIN-PLUS, CRN19 in PBIN-PLUS, CRN20 in PBIN-PLUS and CRN23 in PBIN-PLUS expression vectors
Transforming Agrobacterium cells with expression vectors of PBIN-PLUS: GFP, PBIN-PLUS: INF1, PBIN-PLUS: CRN12, PBIN-PLUS: CRN13, PBIN-PLUS: CRN19, PBIN-PLUS: CRN20 and PBIN-PLUS: CRN23 by electrotransformation; the cuvette was rinsed three times with 70% alcohol and then completely air dried. 100ng of the expression vector was added to the Agrobacterium-infected state and left on ice for 30 min. The agrobacterium-infected cells are transferred to an electric shock cup, and electric shock transformation is carried out by using the voltage of 2.5 kV. After the electric shock is finished, the agrobacterium competent cells are added into 400 mu L of LB liquid culture medium and are cultured for 2h under shaking at the temperature of 28 ℃. 20 mu L of the bacterial liquid is sucked and evenly smeared on a solid LB culture medium plate containing 50mm kanamycin and 25mm rifampicin, and inverted culture is carried out for 48h at the temperature of 28 ℃. And selecting a single colony for colony PCR to obtain a positive clone.
3. Transient expression of the proteins PBIN-PLUS GFP, PBIN-PLUS INF1, PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN19, PBIN-PLUS CRN20 and PBIN-PLUS CRN23 in Nicotiana benthamiana
The positive clones are placed in an LB liquid culture medium and shake-cultured for 30h at 28 ℃. The bacterial suspension was collected, centrifuged at 8000rpm for 2min, and washed three times with 10mM MgCl 2. Finally, the inoculum was diluted with 10mM MgCl2 to an OD600 of 0.3. Bacterial suspension and bacterial suspension 1 containing suppressor for silencing P19: 1 and mixing. All genes are respectively injected on the tobacco leaf slices by using a 1mL injector, each gene is repeated for at least 5 times, and the experiment is repeated for three times, and the results are shown in figures 1-4.
4. Detection of resistance to Swiss tobacco by transient expression of proteins PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN19, PBIN-PLUS CRN20 and PBIN-PLUS CRN23
The leaf sections for which the expression of the protein was confirmed were cut and placed in a tray with a filter paper kept moist. Punching holes on the growth edge of a flat plate of phytophthora capsici by using a 7mm puncher, and placing the punched bacterium plates on the left side and the right side of the tobacco leaves of the Benzilian eudipleura in a left-right symmetrical mode. The trays were placed in an incubator at 25 ℃ in the dark for 36 h. The leaf was removed and then irradiated with a hand-held uv-luminometer. The darker area is the infected area of phytophthora capsici. Measuring the area of the infected area by using a measuring ruler, taking the leaf surface expressing the PBIN-PLUS GFGP protein as a control, and comparing the influence of the two proteins on the resistance of the Nicotiana benthamiana. It was found that 5 CRN proteins from Pythium oligandrum and Pythium tanguticum significantly increased the resistance of Nicotiana benthamiana to Phytophthora capsici (as shown in FIGS. 1-4).
7. Reactive Oxygen Species (ROS) accumulation assay3
After all the treatment genes are injected for 36h, 1mg/ml DAB solution is used for staining for 8h in the dark, then 95% ethanol is used for decoloring, and finally a camera is used for photographing to record the phenotype, wherein the experimental result is shown in figures 1-4.
Reference to the literature
1.Benhamou,N.et al.Pythium oligandrum:an example of opportunistic success.Microbiology158,2679-2694,doi:10.1099/mic.0.061457-0(2012).
2.Paul,B.&Masih,I.ITS1 region of the nuclear ribosomal DNA of the mycoparasite Pythium periplocum,its taxonomy,and its comparison with related species.FEMS Microbiology Letters(2000).
3.Jambunathan,N.Determination and detection of reactive oxygen species(ROS),lipid peroxidation,and electrolyte leakage in plants.Methods Mol Biol 639,292-298,doi:10.1007/978-1-60761-702-0_18(2010).
4.Qi Li1,Gan Ai1,2,Danyu Shen1,Fen Zou1,Ji Wang1,Tian Bai1,Yanyu Chen1,Shutian Li1,Meixiang Zhang1,Maofeng Jing1 and Daolong Dou1,A Phytophthora capsici Effector Targets ACD11 Binding Partners that Regulate ROS-Mediated Defense Response in Arabidopsis.Mol Plant12,565-581(2019).
Sequence listing
CRN12 gene
ATGGTGTTCTCCGTCGAGGTTGAGAGAAACGCAGACGTGGAAGCGCTGCAGGAGGCTATCTTTGTCAAGAAGCGATACAAAGAGCGCTATACATTCGATGCAAGCGCATTGACGCTGTACTTGGCGAAGAAGGACGGCGCATGGCTCAAGCATGATCACACTGTGAAGGCGTTCTTGCAAGGTGACATCGACACTGAGTACGAGGAGATGCTTTCGACGTGGAAGCTCAATAAGGAGGAGTTGTTTGGGGACTTCCAGCTCGGAGGAGAAGAGATTCACGTGCTGGTGGAGCTCCCAGAGCGCCAGTCTGCTGATCCTCAGCTGATCGAGCTTCAGGAATCACTTTTGCAGCATATCCTGATGGATGCTCCAACTTCGACGTCCGTGCGAAGCAATCATTTCAAGAAGAAGCTGTGTGCAACGTACAATTGCGACATGGGAAGTGGCCAGTTGCGCTGTATGCTACTGGACACAGCTCTTCCGTCGGAGTTGGTGATTGCGTCTCATTTGTTTCGCCGAAAAAACGAATTTATCTCTGAGAAGTTTATGGGATTCTCGGATATCGACGACGTGAGAAACGGTTTGCTGCTTTTCAAGCCGCTGGAGCATGCGCTCGACCATTTCCAGATCAGCTTTATTTACGACCCAAGCAGCAACGAGTTTCGTTTGAAGATTTTCGACCGATCCATGAGAAAACAGCGATTGCTTGGAAAATTAGACAAAACGCAGCGTGCGATACTTCTTCAAGGTCAGGTGTTGCCGAAAAACTGGAGATCGCGAGGTCGAAGACTTGCACCCGGGACAAACTATGACCTCCAGACGACTTTTGGTGATCTTGAAGGTCGGACACTTTGCTTTCGGGGTATCGAGCGTCCGTACAAGCGTTGTTTGAACTTGCAGGCCCGATTAGCCCGAAAACAAGCAATCAAGAAACAGTGGATCGAGCCAGAGGAAGATGACTTTCAAGACTTTTGGTCCGAAGGCATGTCGTTGGCAGAGAAGATGGAGTTTTACTACGCGAACGAAACCTGA
CRN13 gene
ATGGTGTTCTCCGTCGAGGTTGAGAGAAACGCAGACGTGGAAGCGCTGCAGGAGGCTATCTTTGTCAAGAAGCGATACAAAGAGCGCTATACATTCGACGCAAGCGCATTGACGCTGTACTTGGCGAAGAAGGACGGCGCATGGCTCAAGCATGATCACACTGTGAAGGCGTTCTTGCAAGGTGACATCGACACTGAGTACGAGGAGATGCTTTCGACGTGGAAGCTCAATAAGGAGGAGTTGTTTGGGGACTTCCAGCTCGGAGGAGAAGAGATTCACGTGCTGGTGGAGCTCCCAGAGCGCCAGTCTGCTGATCCTCAGCTGATCGAGCTTCAGGAATCACTTTTGCATCATATCTTGATGGATGCTCCAACTTCGACGTCCGTGCGAAGCAATCATTTCAAGAAGAAGCTGTGTGCAACGTACAATTGCGACATGGGAAATGGCCAGTTGCGCTGTATGCTACTGGACACAGCTCTTCCGTCGGAGTTGGTGATTGCGTCTCATTTGTTTCGCCGAAAAAACGAATTTATCTCTGAGAAGTTTATGGGATTCTCGGACATCGACGATGTGAGAAACGGTTTGCTGCTTTTCAAGCCGCTGGAGCATGCGTTCGACCATTTCCAGATCAGCTTTATTTACGACCCAAGCAGCAACGAGTTTCGTTTGAAGATTTTCGACAGATCCATGAGAAAACAGCGATTGTTTGGAAAATTAGACAAAACGCAGCGTGCGATACTTCTTCAAGGTCAGGTGTTGCCGAGAAACTGGAGATCGCGAGGTCGAAGACTTGCACCCGGGACAAACTATGACCTCCAGACGACTTTTGGTGATCTTGAAGGTCGGACGCTTTGCTTTCGGGGTATCGAGCGTCCGTACAAGCGTTGTTTGAACTTGCAGGCCCGACTAGCCCGAAAACAAGCAATCAAGAAACTGTGGATCGAGCCAGAGAAAGATGACTTTCAAGACTTTTGGTCCGAAGGCATGTCGTTGGCAGAGAAGATGGAGTTTTACTACGCGAACGAAACCTAA
CRN20 gene
ATGTTTCCTGTGGACATTGATGAGAGTCTGACGGTTGGGGACTTGAAGGAAGTGATCCGGGGGAAGAAGCCGCGCAAGATCACGTGCGATGCCGATGAGTTGGAGTTGTACTTGGCCAAGAGGGGCGACGCGTGGCTGACAGAAAACGAGGTCAGAGGGATAAGTGACACCAATGGCCTCAAGTATCTGGGTGCTGCGCGAGCGGAACTCGACGTAGTTGGCCTTTCGGAGGAAGATCTGCGATTCGAAATCGACAAACACCGAGTTGCAGCAGGATATGGCCCTGTAAATGTGTTGGTGGTGGTCCCGTCAAATGGAACGAGCATGTCTGTGGTGGGGACGAACATTGAAAAGTTCAGGACTCCACTTCAGTTCTCCACTGCGGAACACGAAGGTGGCGTTCCTTCAACATTCAGGACCTATCGATCAGCCACTGTTCACGCATTTTTCAGGCTGCTGTTTCCTCCGGGCGGGAACTTTCTCCCATTAATATTCGTCCGTGCACCACCGTTATCCGGAAAGTCTGCCATGTTCGACCTACTCTACAATCACATTGTGCTCTCCCAGCCGGATGCGCTTGTTGCGCGGGTGTCTGCGAATTTTATGCCTGAGTCGACCACATTCTGTCAATACTTCAGCTCAACCTATGGCTGCGATTTTAAAGCATTCTGCAAGCTCGACTACGAGAAAGTGGTATTGATTGATGAGGCTCAAGTGACGTACGATGATGATCTACTTTGGCTGGGTTACCTGAAGAATACGTTGGAGGGGAAAGTCCACGGCCTACGATTTGTTCTCTTCTCGTCATACGGCAGTTTTGACATTTACCGGGAGGATGTACGTCCTGGGACTCCTATTCTCGTCCCGCCGGGAAATACTTTTGGATTGAATGCGGCGCCATCGAAGCCTGGCTTGCAACTCACGCGCGTAGAACTGGACGAAATGATTCACGGAAGCATCGGAGCAGCGGTGGGTGATCTCATTTGGATTCTGTGCTCTGGACATATCGGGATTGCTCGAGCAATACTCAGGTTTTTGCATGGCAAGTTTGGATCAAAGAAAGCATCCATTGCTCCTGAAGATCTGGAAGCAGAACTTCGTTCAGTCCGCTTGCTACGATACATCCGCGACAGTTATCGTGGCATACCGACGCTTGATGCTTTTCAGCGAGTGATCCAGGGTCGGCAATTGGCTGACGAGTCGAAGTTGAAGATGAGTGAAGTGATGAGTAGTGTTGCTTCGGGCAAGATTGTGCTTGCATCTGATGGGGAGCGATCTCCTAGAAGTCGTCTTGCAGTGGAATTACTTACCCGATTCGGTTTCCTCTACGAGGATTACAACAAGCAACTCCAGTTCGCATCGAATATGCATCTGAAGATTTGGCTGCATTCAAATCGATCGGATCCAATCGGACATATGGTCTCCAACATCTCGCATGACGAATTCTTGGTTGCTTGTATAACGAGAATGCGTAGTTCGCAACTTCAGCATTTTGCGACTGGAAACACCAGCAACACGTTGGTTGCTCGAGAGCGCCAAATCCAAATGGAGCTGTACAACGCCACCACTTCATGTTTACCGCGGGACGTGCTAGTTACTCCAGAATGGCGCACGAGTGATGAGATAGGCTTCGTTGACCTGGTTATTCAAGGCGGAGATATCCTCTGGTTCTGGGAGCTGCTTGTGAATGGAGACGATGCTGTTAGCCATTCGAAGCGATTCAAAACAGGTGGCAAGTACTATGGAAGCCTTACGAGCCATTCTCGATACGTACTCATTGACTTCCGTCAGAACAAAGGCGTTCGAGAGCAGAAGCTTGGTTTTTTGTACGTGTCCTTTGTGGATTCTTACTCTAAGGCGAAGATCTTTGGGCTTCATAGGGACGAGATCACTGTGGAGTTATCGTGA
CRN23 gene
ATGGTGTTCCCCGTGAGGATCGCACGTGATGCTAGAGTGAGCGCACTGCAGAAGGCTATCTTTGACGAGAAACGATACAGAGAGCGCTACACCTTTGACGCAAGCGCATTGACGCTGTACTTGGCGCGGAAGAAGGAAGGTGACGAAAGCAAGTGGCTGACGGATGACGACAATTTGGATGCTATCTTGGGAGGAGATGTCGACAAGCAGTTCGTGAAAATGCGATCGTTGTGGATTCTCAGCGAAGATTACCTTGGCGCGAATTTTCAGCCTGGGCGCAAAGAGATCCACGTGCTGGTGGAACTCCCAGAAGGTGCGGCCGGTGAGAAATCGGAAATGGCACAAATGATGAAGGAAATGTACGAGCATATTGTGCATCCTGTGCAGACTAAGCGCAAATACGTCCATTCCGAGATGAACTCAAGCAAGGGAATCGCGCTTCTGAAAGACCTGAATATTCGAGTGAAGGACGCGGACTCGGTTCCATTCTCTACTGAAGATCCAACTCCGGTTGAACCATTCACATGGGAAAGTGTTTGTAATGAACATGGCCAACTCATTGTGCTTACCGAGGAGCAGCAACGAGAACGATATCGTAGATACGTGGAAGACAACATTGGCGATGTGCTCGCGGAGAAGAGGCTTTGCGTGCTCGGTGTGGAAAAAGGCAAGAATATTCTCACTGCTGACGTCCCTGGTCACGACATTGAACTTGCTGGACGGACGGATATGCTCATACTGAGGGATGTCACAAAGCAGTTCCCGGACCATTTGGAGATGTTGGATGAAGTGAAGATGCTTATCGAAGTGAAGAGGAACGTAAAAGGAGGCTCTGTTTTCCAGGCGTTGTCGGAACTGATTGCGCTAGATGTTCTTGTCGATGACCCAGTGATGGCACTGCTGACCGACTTGACTGGCCGTTGGCAGTTCTTCTGGGTCTCCGAGAAGAGCGACAACCATGTCATCATCCGAACAGTGATTATATCTGATCCAAGCGCGGCGTTTGCCGTGATCAGGACGCTACTTGCACAGTCGCCAAATGGTGATGCAGATATCACACTTCCATGTTTTGGAGAACCCGTGAAACGACGCAAGTTGGCTCAATTGCTGCCGTCTATTGGTGAAGGAGGTGAAAGCGGCGGCATACGTGAGGCTATCGAACGGTACTATGATATCGCAAGCGTGCTGGGTCCCGACATTGACATGGCACGTTCTGTGGCTCACCAACTTGTCCGAACGATTCCCACGTTCAGCTATTACACGTAA
CRN19 gene
ATGGGTGTGTACGGCGAAGGGAGTGTCTTCTCGGTCGAGATCCAGCGCAATGCAGATGTGGAGGCGCTGCAGAAGAAGATCGCAAGTACATACAGAGTCGTGAGCAACCGCGTTGAGGTTTACCCTGCCACCCTGACGCTGTACTTGGCGCGGAAAGAGGGTGGCCCGTGGTTGGCGGATGACCACCATGTGAAGAATTTTTTGCAAGGTGGCATCAACACTGAGTACGAGGAGATGCGTCCGTCGTGGCATCTCGACGAAGACTACTTTGGAGCGGACTTTCAGCCTGGACGCAAAGAGATTCACGTGCTGGTGCAAGTGCCGGAAGTGCTGGAAACTGCGGTAGCCAATAAGAAGCAGCGCCTGGAGTGGCGGTCGACCCGATGGGGATCACACGCTTATGACCCGAACTCACAATACTTCCTGCTGGAGAAAGAGGATGTGGACGAGTCCGGACTTCCACCCGTTCGCTTGATGCTCTACTGCAGACCCGCATTCCACCGCCAATTCGAGTTCTTGCGCGATGAAGTGTTGAACGAAGGTCATTTGGGCTGGATTCTCGGCCCACCTGGAACGGGAAAGTCAACCACAGCCATGGCTTTCGCGTCGACTCTGGACAGAAGTGAATGGATCGTGACGTGGATCCACGTGGGGAAATTCATGTCTTGGCGATGCGTGCGCCTCATCGGCGAAGACCGGAGAAGTCGAATTCTTGATATCTCGGACGTGGATGAAGTGTTGATGGTTGACGATACGAGGCATCACGTAGTGCTCGTTGACGGGTGGACTGCTGCAGACGAGTTTATTGAGCTGACACGCAAGTGCGTCGAATGGTTCCTTGTCGGTACAAAGGTGAAGCGGCGGCTCGCATTTGTTTGTTCAGTTGCTGCTCGTGGGAAGTTCCAAGAAGACATGGAGATTCTGACTCGTGCAAGAGAGTTCCGCGTGTGGTCATGGACTCTGGATGAGTACCTCAATGCGATCAAGGATGACGAGGTGTTCCAGAGTGTCTCGCAATGTCTGGATGCCCCTGCAGTGTTGCCGGACGAAGAGATGTCTCGCGCGGCAATGGTTGAGTCCAAGTATTACTACGCAGGTGGTTCCTGTCGTTATATGTTTCACTTCCGCACTGTGACCGTGGCGACGAAGTTGAGTGATGCCGTGGATTCATTAAACGATGCCGCAATTGTTGCCACGAGTGGTCAGCGTTCATCTTCAAGCATCAACCGTCTGTTTGGGATGTTCCAGCGACCTCACGACGTGGGTGCGGTGTCGCCTGTGATCAGTCAGTATGCTGCGACGCTGATTGCCATCAGATGCGGTCCAGAGGCTATCAAGAAGTTCATATCGACGCATCGAGACAATTCAAACCCAGCATTGGATGGATGGATGTTGGAGATGGTGTTCTTCGCAAGTCTTCGAAACGGCGGTCTCGCTCTCGTCGATGCGGCAGGGAACACAGTTGACACGTGGGGTCAATCAGTTGTTGTGATCGCGGATGGAATACCTGCGCTTTCTTCTGCTCACCCCGTTTGGATCAAGCCAGAAAAATGGAACCAAGGCGGATATGACGCTATTATGGTGTGCAAGCGTACTCAGCACGTGCGTTTGGTGCAAGTGACGAGTGCCCACAAGCATTCTTTCCGCATCGATTATTTTTACGGATGGCTGAAGATGCTGTCGGAGTCGCCCGAAAGTTTTGAGGTGAAGACAATGGAGATTGTCTTCGTTGTCGAGCAAGACAAGCTGAGCACGTTCGACTTCTCGACTGTGAAGGGAGCCGGACTTCTCCGACCGTTTGGTTGGTCGAAGGGCAAGGAGACGGACTTAGTACGGCTGGTAGGGATTCGTGGGTTATATAATCTATCACCATAA
CRN12 protein
MVFSVEVERNADVEALQEAIFVKKRYKERYTFDASALTLYLAKKDGAWLKHDHTVKAFLQGDIDTEYEEMLSTWKLNKEELFGDFQLGGEEIHVLVELPERQSADPQLIELQESLLQHILMDAPTSTSVRSNHFKKKLCATYNCDMGSGQLRCMLLDTALPSELVIASHLFRRKNEFISEKFMGFSDIDDVRNGLLLFKPLEHALDHFQISFIYDPSSNEFRLKIFDRSMRKQRLLGKLDKTQRAILLQGQVLPKNWRSRGRRLAPGTNYDLQTTFGDLEGRTLCFRGIERPYKRCLNLQARLARKQAIKKQWIEPEEDDFQDFWSEGMSLAEKMEFYYANET*
CRN13 protein
MVFSVEVERNADVEALQEAIFVKKRYKERYTFDASALTLYLAKKDGAWLKHDHTVKAFLQGDIDTEYEEMLSTWKLNKEELFGDFQLGGEEIHVLVELPERQSADPQLIELQESLLHHILMDAPTSTSVRSNHFKKKLCATYNCDMGNGQLRCMLLDTALPSELVIASHLFRRKNEFISEKFMGFSDIDDVRNGLLLFKPLEHAFDHFQISFIYDPSSNEFRLKIFDRSMRKQRLFGKLDKTQRAILLQGQVLPRNWRSRGRRLAPGTNYDLQTTFGDLEGRTLCFRGIERPYKRCLNLQARLARKQAIKKLWIEPEKDDFQDFWSEGMSLAEKMEFYYANET*
CRN20 protein
MFPVDIDESLTVGDLKEVIRGKKPRKITCDADELELYLAKRGDAWLTENEVRGISDTNGLKYLGAARAELDVVGLSEEDLRFEIDKHRVAAGYGPVNVLVVVPSNGTSMSVVGTNIEKFRTPLQFSTAEHEGGVPSTFRTYRSATVHAFFRLLFPPGGNFLPLIFVRAPPLSGKSAMFDLLYNHIVLSQPDALVARVSANFMPESTTFCQYFSSTYGCDFKAFCKLDYEKVVLIDEAQVTYDDDLLWLGYLKNTLEGKVHGLRFVLFSSYGSFDIYREDVRPGTPILVPPGNTFGLNAAPSKPGLQLTRVELDEMIHGSIGAAVGDLIWILCSGHIGIARAILRFLHGKFGSKKASIAPEDLEAELRSVRLLRYIRDSYRGIPTLDAFQRVIQGRQLADESKLKMSEVMSSVASGKIVLASDGERSPRSRLAVELLTRFGFLYEDYNKQLQFASNMHLKIWLHSNRSDPIGHMVSNISHDEFLVACITRMRSSQLQHFATGNTSNTLVARERQIQMELYNATTSCLPRDVLVTPEWRTSDEIGFVDLVIQGGDILWFWELLVNGDDAVSHSKRFKTGGKYYGSLTSHSRYVLIDFRQNKGVREQKLGFLYVSFVDSYSKAKIFGLHRDEITVELS*
CRN23 protein
MVFPVRIARDARVSALQKAIFDEKRYRERYTFDASALTLYLARKKEGDESKWLTDDDNLDAILGGDVDKQFVKMRSLWILSEDYLGANFQPGRKEIHVLVELPEGAAGEKSEMAQMMKEMYEHIVHPVQTKRKYVHSEMNSSKGIALLKDLNIRVKDADSVPFSTEDPTPVEPFTWESVCNEHGQLIVLTEEQQRERYRRYVEDNIGDVLAEKRLCVLGVEKGKNILTADVPGHDIELAGRTDMLILRDVTKQFPDHLEMLDEVKMLIEVKRNVKGGSVFQALSELIALDVLVDDPVMALLTDLTGRWQFFWVSEKSDNHVIIRTVIISDPSAAFAVIRTLLAQSPNGDADITLPCFGEPVKRRKLAQLLPSIGEGGESGGIREAIERYYDIASVLGPDIDMARSVAHQLVRTIPTFSYYT*
CRN19 protein
MGVYGEGSVFSVEIQRNADVEALQKKIASTYRVVSNRVEVYPATLTLYLARKEGGPWLADDHHVKNFLQGGINTEYEEMRPSWHLDEDYFGADFQPGRKEIHVLVQVPEVLETAVANKKQRLEWRSTRWGSHAYDPNSQYFLLEKEDVDESGLPPVRLMLYCRPAFHRQFEFLRDEVLNEGHLGWILGPPGTGKSTTAMAFASTLDRSEWIVTWIHVGKFMSWRCVRLIGEDRRSRILDISDVDEVLMVDDTRHHVVLVDGWTAADEFIELTRKCVEWFLVGTKVKRRLAFVCSVAARGKFQEDMEILTRAREFRVWSWTLDEYLNAIKDDEVFQSVSQCLDAPAVLPDEEMSRAAMVESKYYYAGGSCRYMFHFRTVTVATKLSDAVDSLNDAAIVATSGQRSSSSINRLFGMFQRPHDVGAVSPVISQYAATLIAIRCGPEAIKKFISTHRDNSNPALDGWMLEMVFFASLRNGGLALVDAAGNTVDTWGQSVVVIADGIPALSSAHPVWIKPEKWNQGGYDAIMVCKRTQHVRLVQVTSAHKHSFRIDYFYGWLKMLSESPESFEVKTMEIVFVVEQDKLSTFDFSTVKGAGLLRPFGWSKGKETDLVRLVGIRGLYNLSP*
Sequence listing
<110> Nanjing university of agriculture
Application of <120> CRN effector protein gene in inducing plant resistance
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1032
<212> DNA
<213> Pythium oligandrum (Pythium oligandrum)
<400> 1
atggtgttct ccgtcgaggt tgagagaaac gcagacgtgg aagcgctgca ggaggctatc 60
tttgtcaaga agcgatacaa agagcgctat acattcgatg caagcgcatt gacgctgtac 120
ttggcgaaga aggacggcgc atggctcaag catgatcaca ctgtgaaggc gttcttgcaa 180
ggtgacatcg acactgagta cgaggagatg ctttcgacgt ggaagctcaa taaggaggag 240
ttgtttgggg acttccagct cggaggagaa gagattcacg tgctggtgga gctcccagag 300
cgccagtctg ctgatcctca gctgatcgag cttcaggaat cacttttgca gcatatcctg 360
atggatgctc caacttcgac gtccgtgcga agcaatcatt tcaagaagaa gctgtgtgca 420
acgtacaatt gcgacatggg aagtggccag ttgcgctgta tgctactgga cacagctctt 480
ccgtcggagt tggtgattgc gtctcatttg tttcgccgaa aaaacgaatt tatctctgag 540
aagtttatgg gattctcgga tatcgacgac gtgagaaacg gtttgctgct tttcaagccg 600
ctggagcatg cgctcgacca tttccagatc agctttattt acgacccaag cagcaacgag 660
tttcgtttga agattttcga ccgatccatg agaaaacagc gattgcttgg aaaattagac 720
aaaacgcagc gtgcgatact tcttcaaggt caggtgttgc cgaaaaactg gagatcgcga 780
ggtcgaagac ttgcacccgg gacaaactat gacctccaga cgacttttgg tgatcttgaa 840
ggtcggacac tttgctttcg gggtatcgag cgtccgtaca agcgttgttt gaacttgcag 900
gcccgattag cccgaaaaca agcaatcaag aaacagtgga tcgagccaga ggaagatgac 960
tttcaagact tttggtccga aggcatgtcg ttggcagaga agatggagtt ttactacgcg 1020
aacgaaacct ga 1032
<210> 2
<211> 1032
<212> DNA
<213> Pythium periplocum winding machine
<400> 2
atggtgttct ccgtcgaggt tgagagaaac gcagacgtgg aagcgctgca ggaggctatc 60
tttgtcaaga agcgatacaa agagcgctat acattcgacg caagcgcatt gacgctgtac 120
ttggcgaaga aggacggcgc atggctcaag catgatcaca ctgtgaaggc gttcttgcaa 180
ggtgacatcg acactgagta cgaggagatg ctttcgacgt ggaagctcaa taaggaggag 240
ttgtttgggg acttccagct cggaggagaa gagattcacg tgctggtgga gctcccagag 300
cgccagtctg ctgatcctca gctgatcgag cttcaggaat cacttttgca tcatatcttg 360
atggatgctc caacttcgac gtccgtgcga agcaatcatt tcaagaagaa gctgtgtgca 420
acgtacaatt gcgacatggg aaatggccag ttgcgctgta tgctactgga cacagctctt 480
ccgtcggagt tggtgattgc gtctcatttg tttcgccgaa aaaacgaatt tatctctgag 540
aagtttatgg gattctcgga catcgacgat gtgagaaacg gtttgctgct tttcaagccg 600
ctggagcatg cgttcgacca tttccagatc agctttattt acgacccaag cagcaacgag 660
tttcgtttga agattttcga cagatccatg agaaaacagc gattgtttgg aaaattagac 720
aaaacgcagc gtgcgatact tcttcaaggt caggtgttgc cgagaaactg gagatcgcga 780
ggtcgaagac ttgcacccgg gacaaactat gacctccaga cgacttttgg tgatcttgaa 840
ggtcggacgc tttgctttcg gggtatcgag cgtccgtaca agcgttgttt gaacttgcag 900
gcccgactag cccgaaaaca agcaatcaag aaactgtgga tcgagccaga gaaagatgac 960
tttcaagact tttggtccga aggcatgtcg ttggcagaga agatggagtt ttactacgcg 1020
aacgaaacct aa 1032
<210> 3
<211> 1908
<212> DNA
<213> Pythium oligandrum (Pythium oligandrum)
<400> 3
atgtttcctg tggacattga tgagagtctg acggttgggg acttgaagga agtgatccgg 60
gggaagaagc cgcgcaagat cacgtgcgat gccgatgagt tggagttgta cttggccaag 120
aggggcgacg cgtggctgac agaaaacgag gtcagaggga taagtgacac caatggcctc 180
aagtatctgg gtgctgcgcg agcggaactc gacgtagttg gcctttcgga ggaagatctg 240
cgattcgaaa tcgacaaaca ccgagttgca gcaggatatg gccctgtaaa tgtgttggtg 300
gtggtcccgt caaatggaac gagcatgtct gtggtgggga cgaacattga aaagttcagg 360
actccacttc agttctccac tgcggaacac gaaggtggcg ttccttcaac attcaggacc 420
tatcgatcag ccactgttca cgcatttttc aggctgctgt ttcctccggg cgggaacttt 480
ctcccattaa tattcgtccg tgcaccaccg ttatccggaa agtctgccat gttcgaccta 540
ctctacaatc acattgtgct ctcccagccg gatgcgcttg ttgcgcgggt gtctgcgaat 600
tttatgcctg agtcgaccac attctgtcaa tacttcagct caacctatgg ctgcgatttt 660
aaagcattct gcaagctcga ctacgagaaa gtggtattga ttgatgaggc tcaagtgacg 720
tacgatgatg atctactttg gctgggttac ctgaagaata cgttggaggg gaaagtccac 780
ggcctacgat ttgttctctt ctcgtcatac ggcagttttg acatttaccg ggaggatgta 840
cgtcctggga ctcctattct cgtcccgccg ggaaatactt ttggattgaa tgcggcgcca 900
tcgaagcctg gcttgcaact cacgcgcgta gaactggacg aaatgattca cggaagcatc 960
ggagcagcgg tgggtgatct catttggatt ctgtgctctg gacatatcgg gattgctcga 1020
gcaatactca ggtttttgca tggcaagttt ggatcaaaga aagcatccat tgctcctgaa 1080
gatctggaag cagaacttcg ttcagtccgc ttgctacgat acatccgcga cagttatcgt 1140
ggcataccga cgcttgatgc ttttcagcga gtgatccagg gtcggcaatt ggctgacgag 1200
tcgaagttga agatgagtga agtgatgagt agtgttgctt cgggcaagat tgtgcttgca 1260
tctgatgggg agcgatctcc tagaagtcgt cttgcagtgg aattacttac ccgattcggt 1320
ttcctctacg aggattacaa caagcaactc cagttcgcat cgaatatgca tctgaagatt 1380
tggctgcatt caaatcgatc ggatccaatc ggacatatgg tctccaacat ctcgcatgac 1440
gaattcttgg ttgcttgtat aacgagaatg cgtagttcgc aacttcagca ttttgcgact 1500
ggaaacacca gcaacacgtt ggttgctcga gagcgccaaa tccaaatgga gctgtacaac 1560
gccaccactt catgtttacc gcgggacgtg ctagttactc cagaatggcg cacgagtgat 1620
gagataggct tcgttgacct ggttattcaa ggcggagata tcctctggtt ctgggagctg 1680
cttgtgaatg gagacgatgc tgttagccat tcgaagcgat tcaaaacagg tggcaagtac 1740
tatggaagcc ttacgagcca ttctcgatac gtactcattg acttccgtca gaacaaaggc 1800
gttcgagagc agaagcttgg ttttttgtac gtgtcctttg tggattctta ctctaaggcg 1860
aagatctttg ggcttcatag ggacgagatc actgtggagt tatcgtga 1908
<210> 4
<211> 1266
<212> DNA
<213> Pythium periplocum winding machine
<400> 4
atggtgttcc ccgtgaggat cgcacgtgat gctagagtga gcgcactgca gaaggctatc 60
tttgacgaga aacgatacag agagcgctac acctttgacg caagcgcatt gacgctgtac 120
ttggcgcgga agaaggaagg tgacgaaagc aagtggctga cggatgacga caatttggat 180
gctatcttgg gaggagatgt cgacaagcag ttcgtgaaaa tgcgatcgtt gtggattctc 240
agcgaagatt accttggcgc gaattttcag cctgggcgca aagagatcca cgtgctggtg 300
gaactcccag aaggtgcggc cggtgagaaa tcggaaatgg cacaaatgat gaaggaaatg 360
tacgagcata ttgtgcatcc tgtgcagact aagcgcaaat acgtccattc cgagatgaac 420
tcaagcaagg gaatcgcgct tctgaaagac ctgaatattc gagtgaagga cgcggactcg 480
gttccattct ctactgaaga tccaactccg gttgaaccat tcacatggga aagtgtttgt 540
aatgaacatg gccaactcat tgtgcttacc gaggagcagc aacgagaacg atatcgtaga 600
tacgtggaag acaacattgg cgatgtgctc gcggagaaga ggctttgcgt gctcggtgtg 660
gaaaaaggca agaatattct cactgctgac gtccctggtc acgacattga acttgctgga 720
cggacggata tgctcatact gagggatgtc acaaagcagt tcccggacca tttggagatg 780
ttggatgaag tgaagatgct tatcgaagtg aagaggaacg taaaaggagg ctctgttttc 840
caggcgttgt cggaactgat tgcgctagat gttcttgtcg atgacccagt gatggcactg 900
ctgaccgact tgactggccg ttggcagttc ttctgggtct ccgagaagag cgacaaccat 960
gtcatcatcc gaacagtgat tatatctgat ccaagcgcgg cgtttgccgt gatcaggacg 1020
ctacttgcac agtcgccaaa tggtgatgca gatatcacac ttccatgttt tggagaaccc 1080
gtgaaacgac gcaagttggc tcaattgctg ccgtctattg gtgaaggagg tgaaagcggc 1140
ggcatacgtg aggctatcga acggtactat gatatcgcaa gcgtgctggg tcccgacatt 1200
gacatggcac gttctgtggc tcaccaactt gtccgaacga ttcccacgtt cagctattac 1260
acgtaa 1266
<210> 5
<211> 1875
<212> DNA
<213> Pythium periplocum winding machine
<400> 5
atgggtgtgt acggcgaagg gagtgtcttc tcggtcgaga tccagcgcaa tgcagatgtg 60
gaggcgctgc agaagaagat cgcaagtaca tacagagtcg tgagcaaccg cgttgaggtt 120
taccctgcca ccctgacgct gtacttggcg cggaaagagg gtggcccgtg gttggcggat 180
gaccaccatg tgaagaattt tttgcaaggt ggcatcaaca ctgagtacga ggagatgcgt 240
ccgtcgtggc atctcgacga agactacttt ggagcggact ttcagcctgg acgcaaagag 300
attcacgtgc tggtgcaagt gccggaagtg ctggaaactg cggtagccaa taagaagcag 360
cgcctggagt ggcggtcgac ccgatgggga tcacacgctt atgacccgaa ctcacaatac 420
ttcctgctgg agaaagagga tgtggacgag tccggacttc cacccgttcg cttgatgctc 480
tactgcagac ccgcattcca ccgccaattc gagttcttgc gcgatgaagt gttgaacgaa 540
ggtcatttgg gctggattct cggcccacct ggaacgggaa agtcaaccac agccatggct 600
ttcgcgtcga ctctggacag aagtgaatgg atcgtgacgt ggatccacgt ggggaaattc 660
atgtcttggc gatgcgtgcg cctcatcggc gaagaccgga gaagtcgaat tcttgatatc 720
tcggacgtgg atgaagtgtt gatggttgac gatacgaggc atcacgtagt gctcgttgac 780
gggtggactg ctgcagacga gtttattgag ctgacacgca agtgcgtcga atggttcctt 840
gtcggtacaa aggtgaagcg gcggctcgca tttgtttgtt cagttgctgc tcgtgggaag 900
ttccaagaag acatggagat tctgactcgt gcaagagagt tccgcgtgtg gtcatggact 960
ctggatgagt acctcaatgc gatcaaggat gacgaggtgt tccagagtgt ctcgcaatgt 1020
ctggatgccc ctgcagtgtt gccggacgaa gagatgtctc gcgcggcaat ggttgagtcc 1080
aagtattact acgcaggtgg ttcctgtcgt tatatgtttc acttccgcac tgtgaccgtg 1140
gcgacgaagt tgagtgatgc cgtggattca ttaaacgatg ccgcaattgt tgccacgagt 1200
ggtcagcgtt catcttcaag catcaaccgt ctgtttggga tgttccagcg acctcacgac 1260
gtgggtgcgg tgtcgcctgt gatcagtcag tatgctgcga cgctgattgc catcagatgc 1320
ggtccagagg ctatcaagaa gttcatatcg acgcatcgag acaattcaaa cccagcattg 1380
gatggatgga tgttggagat ggtgttcttc gcaagtcttc gaaacggcgg tctcgctctc 1440
gtcgatgcgg cagggaacac agttgacacg tggggtcaat cagttgttgt gatcgcggat 1500
ggaatacctg cgctttcttc tgctcacccc gtttggatca agccagaaaa atggaaccaa 1560
ggcggatatg acgctattat ggtgtgcaag cgtactcagc acgtgcgttt ggtgcaagtg 1620
acgagtgccc acaagcattc tttccgcatc gattattttt acggatggct gaagatgctg 1680
tcggagtcgc ccgaaagttt tgaggtgaag acaatggaga ttgtcttcgt tgtcgagcaa 1740
gacaagctga gcacgttcga cttctcgact gtgaagggag ccggacttct ccgaccgttt 1800
ggttggtcga agggcaagga gacggactta gtacggctgg tagggattcg tgggttatat 1860
aatctatcac cataa 1875
<210> 6
<211> 343
<212> PRT
<213> Pythium oligandrum (Pythium oligandrum)
<400> 6
Met Val Phe Ser Val Glu Val Glu Arg Asn Ala Asp Val Glu Ala Leu
1 5 10 15
Gln Glu Ala Ile Phe Val Lys Lys Arg Tyr Lys Glu Arg Tyr Thr Phe
20 25 30
Asp Ala Ser Ala Leu Thr Leu Tyr Leu Ala Lys Lys Asp Gly Ala Trp
35 40 45
Leu Lys His Asp His Thr Val Lys Ala Phe Leu Gln Gly Asp Ile Asp
50 55 60
Thr Glu Tyr Glu Glu Met Leu Ser Thr Trp Lys Leu Asn Lys Glu Glu
65 70 75 80
Leu Phe Gly Asp Phe Gln Leu Gly Gly Glu Glu Ile His Val Leu Val
85 90 95
Glu Leu Pro Glu Arg Gln Ser Ala Asp Pro Gln Leu Ile Glu Leu Gln
100 105 110
Glu Ser Leu Leu Gln His Ile Leu Met Asp Ala Pro Thr Ser Thr Ser
115 120 125
Val Arg Ser Asn His Phe Lys Lys Lys Leu Cys Ala Thr Tyr Asn Cys
130 135 140
Asp Met Gly Ser Gly Gln Leu Arg Cys Met Leu Leu Asp Thr Ala Leu
145 150 155 160
Pro Ser Glu Leu Val Ile Ala Ser His Leu Phe Arg Arg Lys Asn Glu
165 170 175
Phe Ile Ser Glu Lys Phe Met Gly Phe Ser Asp Ile Asp Asp Val Arg
180 185 190
Asn Gly Leu Leu Leu Phe Lys Pro Leu Glu His Ala Leu Asp His Phe
195 200 205
Gln Ile Ser Phe Ile Tyr Asp Pro Ser Ser Asn Glu Phe Arg Leu Lys
210 215 220
Ile Phe Asp Arg Ser Met Arg Lys Gln Arg Leu Leu Gly Lys Leu Asp
225 230 235 240
Lys Thr Gln Arg Ala Ile Leu Leu Gln Gly Gln Val Leu Pro Lys Asn
245 250 255
Trp Arg Ser Arg Gly Arg Arg Leu Ala Pro Gly Thr Asn Tyr Asp Leu
260 265 270
Gln Thr Thr Phe Gly Asp Leu Glu Gly Arg Thr Leu Cys Phe Arg Gly
275 280 285
Ile Glu Arg Pro Tyr Lys Arg Cys Leu Asn Leu Gln Ala Arg Leu Ala
290 295 300
Arg Lys Gln Ala Ile Lys Lys Gln Trp Ile Glu Pro Glu Glu Asp Asp
305 310 315 320
Phe Gln Asp Phe Trp Ser Glu Gly Met Ser Leu Ala Glu Lys Met Glu
325 330 335
Phe Tyr Tyr Ala Asn Glu Thr
340
<210> 7
<211> 343
<212> PRT
<213> Pythium periplocum winding machine
<400> 7
Met Val Phe Ser Val Glu Val Glu Arg Asn Ala Asp Val Glu Ala Leu
1 5 10 15
Gln Glu Ala Ile Phe Val Lys Lys Arg Tyr Lys Glu Arg Tyr Thr Phe
20 25 30
Asp Ala Ser Ala Leu Thr Leu Tyr Leu Ala Lys Lys Asp Gly Ala Trp
35 40 45
Leu Lys His Asp His Thr Val Lys Ala Phe Leu Gln Gly Asp Ile Asp
50 55 60
Thr Glu Tyr Glu Glu Met Leu Ser Thr Trp Lys Leu Asn Lys Glu Glu
65 70 75 80
Leu Phe Gly Asp Phe Gln Leu Gly Gly Glu Glu Ile His Val Leu Val
85 90 95
Glu Leu Pro Glu Arg Gln Ser Ala Asp Pro Gln Leu Ile Glu Leu Gln
100 105 110
Glu Ser Leu Leu His His Ile Leu Met Asp Ala Pro Thr Ser Thr Ser
115 120 125
Val Arg Ser Asn His Phe Lys Lys Lys Leu Cys Ala Thr Tyr Asn Cys
130 135 140
Asp Met Gly Asn Gly Gln Leu Arg Cys Met Leu Leu Asp Thr Ala Leu
145 150 155 160
Pro Ser Glu Leu Val Ile Ala Ser His Leu Phe Arg Arg Lys Asn Glu
165 170 175
Phe Ile Ser Glu Lys Phe Met Gly Phe Ser Asp Ile Asp Asp Val Arg
180 185 190
Asn Gly Leu Leu Leu Phe Lys Pro Leu Glu His Ala Phe Asp His Phe
195 200 205
Gln Ile Ser Phe Ile Tyr Asp Pro Ser Ser Asn Glu Phe Arg Leu Lys
210 215 220
Ile Phe Asp Arg Ser Met Arg Lys Gln Arg Leu Phe Gly Lys Leu Asp
225 230 235 240
Lys Thr Gln Arg Ala Ile Leu Leu Gln Gly Gln Val Leu Pro Arg Asn
245 250 255
Trp Arg Ser Arg Gly Arg Arg Leu Ala Pro Gly Thr Asn Tyr Asp Leu
260 265 270
Gln Thr Thr Phe Gly Asp Leu Glu Gly Arg Thr Leu Cys Phe Arg Gly
275 280 285
Ile Glu Arg Pro Tyr Lys Arg Cys Leu Asn Leu Gln Ala Arg Leu Ala
290 295 300
Arg Lys Gln Ala Ile Lys Lys Leu Trp Ile Glu Pro Glu Lys Asp Asp
305 310 315 320
Phe Gln Asp Phe Trp Ser Glu Gly Met Ser Leu Ala Glu Lys Met Glu
325 330 335
Phe Tyr Tyr Ala Asn Glu Thr
340
<210> 8
<211> 635
<212> PRT
<213> Pythium oligandrum (Pythium oligandrum)
<400> 8
Met Phe Pro Val Asp Ile Asp Glu Ser Leu Thr Val Gly Asp Leu Lys
1 5 10 15
Glu Val Ile Arg Gly Lys Lys Pro Arg Lys Ile Thr Cys Asp Ala Asp
20 25 30
Glu Leu Glu Leu Tyr Leu Ala Lys Arg Gly Asp Ala Trp Leu Thr Glu
35 40 45
Asn Glu Val Arg Gly Ile Ser Asp Thr Asn Gly Leu Lys Tyr Leu Gly
50 55 60
Ala Ala Arg Ala Glu Leu Asp Val Val Gly Leu Ser Glu Glu Asp Leu
65 70 75 80
Arg Phe Glu Ile Asp Lys His Arg Val Ala Ala Gly Tyr Gly Pro Val
85 90 95
Asn Val Leu Val Val Val Pro Ser Asn Gly Thr Ser Met Ser Val Val
100 105 110
Gly Thr Asn Ile Glu Lys Phe Arg Thr Pro Leu Gln Phe Ser Thr Ala
115 120 125
Glu His Glu Gly Gly Val Pro Ser Thr Phe Arg Thr Tyr Arg Ser Ala
130 135 140
Thr Val His Ala Phe Phe Arg Leu Leu Phe Pro Pro Gly Gly Asn Phe
145 150 155 160
Leu Pro Leu Ile Phe Val Arg Ala Pro Pro Leu Ser Gly Lys Ser Ala
165 170 175
Met Phe Asp Leu Leu Tyr Asn His Ile Val Leu Ser Gln Pro Asp Ala
180 185 190
Leu Val Ala Arg Val Ser Ala Asn Phe Met Pro Glu Ser Thr Thr Phe
195 200 205
Cys Gln Tyr Phe Ser Ser Thr Tyr Gly Cys Asp Phe Lys Ala Phe Cys
210 215 220
Lys Leu Asp Tyr Glu Lys Val Val Leu Ile Asp Glu Ala Gln Val Thr
225 230 235 240
Tyr Asp Asp Asp Leu Leu Trp Leu Gly Tyr Leu Lys Asn Thr Leu Glu
245 250 255
Gly Lys Val His Gly Leu Arg Phe Val Leu Phe Ser Ser Tyr Gly Ser
260 265 270
Phe Asp Ile Tyr Arg Glu Asp Val Arg Pro Gly Thr Pro Ile Leu Val
275 280 285
Pro Pro Gly Asn Thr Phe Gly Leu Asn Ala Ala Pro Ser Lys Pro Gly
290 295 300
Leu Gln Leu Thr Arg Val Glu Leu Asp Glu Met Ile His Gly Ser Ile
305 310 315 320
Gly Ala Ala Val Gly Asp Leu Ile Trp Ile Leu Cys Ser Gly His Ile
325 330 335
Gly Ile Ala Arg Ala Ile Leu Arg Phe Leu His Gly Lys Phe Gly Ser
340 345 350
Lys Lys Ala Ser Ile Ala Pro Glu Asp Leu Glu Ala Glu Leu Arg Ser
355 360 365
Val Arg Leu Leu Arg Tyr Ile Arg Asp Ser Tyr Arg Gly Ile Pro Thr
370 375 380
Leu Asp Ala Phe Gln Arg Val Ile Gln Gly Arg Gln Leu Ala Asp Glu
385 390 395 400
Ser Lys Leu Lys Met Ser Glu Val Met Ser Ser Val Ala Ser Gly Lys
405 410 415
Ile Val Leu Ala Ser Asp Gly Glu Arg Ser Pro Arg Ser Arg Leu Ala
420 425 430
Val Glu Leu Leu Thr Arg Phe Gly Phe Leu Tyr Glu Asp Tyr Asn Lys
435 440 445
Gln Leu Gln Phe Ala Ser Asn Met His Leu Lys Ile Trp Leu His Ser
450 455 460
Asn Arg Ser Asp Pro Ile Gly His Met Val Ser Asn Ile Ser His Asp
465 470 475 480
Glu Phe Leu Val Ala Cys Ile Thr Arg Met Arg Ser Ser Gln Leu Gln
485 490 495
His Phe Ala Thr Gly Asn Thr Ser Asn Thr Leu Val Ala Arg Glu Arg
500 505 510
Gln Ile Gln Met Glu Leu Tyr Asn Ala Thr Thr Ser Cys Leu Pro Arg
515 520 525
Asp Val Leu Val Thr Pro Glu Trp Arg Thr Ser Asp Glu Ile Gly Phe
530 535 540
Val Asp Leu Val Ile Gln Gly Gly Asp Ile Leu Trp Phe Trp Glu Leu
545 550 555 560
Leu Val Asn Gly Asp Asp Ala Val Ser His Ser Lys Arg Phe Lys Thr
565 570 575
Gly Gly Lys Tyr Tyr Gly Ser Leu Thr Ser His Ser Arg Tyr Val Leu
580 585 590
Ile Asp Phe Arg Gln Asn Lys Gly Val Arg Glu Gln Lys Leu Gly Phe
595 600 605
Leu Tyr Val Ser Phe Val Asp Ser Tyr Ser Lys Ala Lys Ile Phe Gly
610 615 620
Leu His Arg Asp Glu Ile Thr Val Glu Leu Ser
625 630 635
<210> 9
<211> 421
<212> PRT
<213> Pythium periplocum winding machine
<400> 9
Met Val Phe Pro Val Arg Ile Ala Arg Asp Ala Arg Val Ser Ala Leu
1 5 10 15
Gln Lys Ala Ile Phe Asp Glu Lys Arg Tyr Arg Glu Arg Tyr Thr Phe
20 25 30
Asp Ala Ser Ala Leu Thr Leu Tyr Leu Ala Arg Lys Lys Glu Gly Asp
35 40 45
Glu Ser Lys Trp Leu Thr Asp Asp Asp Asn Leu Asp Ala Ile Leu Gly
50 55 60
Gly Asp Val Asp Lys Gln Phe Val Lys Met Arg Ser Leu Trp Ile Leu
65 70 75 80
Ser Glu Asp Tyr Leu Gly Ala Asn Phe Gln Pro Gly Arg Lys Glu Ile
85 90 95
His Val Leu Val Glu Leu Pro Glu Gly Ala Ala Gly Glu Lys Ser Glu
100 105 110
Met Ala Gln Met Met Lys Glu Met Tyr Glu His Ile Val His Pro Val
115 120 125
Gln Thr Lys Arg Lys Tyr Val His Ser Glu Met Asn Ser Ser Lys Gly
130 135 140
Ile Ala Leu Leu Lys Asp Leu Asn Ile Arg Val Lys Asp Ala Asp Ser
145 150 155 160
Val Pro Phe Ser Thr Glu Asp Pro Thr Pro Val Glu Pro Phe Thr Trp
165 170 175
Glu Ser Val Cys Asn Glu His Gly Gln Leu Ile Val Leu Thr Glu Glu
180 185 190
Gln Gln Arg Glu Arg Tyr Arg Arg Tyr Val Glu Asp Asn Ile Gly Asp
195 200 205
Val Leu Ala Glu Lys Arg Leu Cys Val Leu Gly Val Glu Lys Gly Lys
210 215 220
Asn Ile Leu Thr Ala Asp Val Pro Gly His Asp Ile Glu Leu Ala Gly
225 230 235 240
Arg Thr Asp Met Leu Ile Leu Arg Asp Val Thr Lys Gln Phe Pro Asp
245 250 255
His Leu Glu Met Leu Asp Glu Val Lys Met Leu Ile Glu Val Lys Arg
260 265 270
Asn Val Lys Gly Gly Ser Val Phe Gln Ala Leu Ser Glu Leu Ile Ala
275 280 285
Leu Asp Val Leu Val Asp Asp Pro Val Met Ala Leu Leu Thr Asp Leu
290 295 300
Thr Gly Arg Trp Gln Phe Phe Trp Val Ser Glu Lys Ser Asp Asn His
305 310 315 320
Val Ile Ile Arg Thr Val Ile Ile Ser Asp Pro Ser Ala Ala Phe Ala
325 330 335
Val Ile Arg Thr Leu Leu Ala Gln Ser Pro Asn Gly Asp Ala Asp Ile
340 345 350
Thr Leu Pro Cys Phe Gly Glu Pro Val Lys Arg Arg Lys Leu Ala Gln
355 360 365
Leu Leu Pro Ser Ile Gly Glu Gly Gly Glu Ser Gly Gly Ile Arg Glu
370 375 380
Ala Ile Glu Arg Tyr Tyr Asp Ile Ala Ser Val Leu Gly Pro Asp Ile
385 390 395 400
Asp Met Ala Arg Ser Val Ala His Gln Leu Val Arg Thr Ile Pro Thr
405 410 415
Phe Ser Tyr Tyr Thr
420
<210> 10
<211> 624
<212> PRT
<213> Pythium periplocum winding machine
<400> 10
Met Gly Val Tyr Gly Glu Gly Ser Val Phe Ser Val Glu Ile Gln Arg
1 5 10 15
Asn Ala Asp Val Glu Ala Leu Gln Lys Lys Ile Ala Ser Thr Tyr Arg
20 25 30
Val Val Ser Asn Arg Val Glu Val Tyr Pro Ala Thr Leu Thr Leu Tyr
35 40 45
Leu Ala Arg Lys Glu Gly Gly Pro Trp Leu Ala Asp Asp His His Val
50 55 60
Lys Asn Phe Leu Gln Gly Gly Ile Asn Thr Glu Tyr Glu Glu Met Arg
65 70 75 80
Pro Ser Trp His Leu Asp Glu Asp Tyr Phe Gly Ala Asp Phe Gln Pro
85 90 95
Gly Arg Lys Glu Ile His Val Leu Val Gln Val Pro Glu Val Leu Glu
100 105 110
Thr Ala Val Ala Asn Lys Lys Gln Arg Leu Glu Trp Arg Ser Thr Arg
115 120 125
Trp Gly Ser His Ala Tyr Asp Pro Asn Ser Gln Tyr Phe Leu Leu Glu
130 135 140
Lys Glu Asp Val Asp Glu Ser Gly Leu Pro Pro Val Arg Leu Met Leu
145 150 155 160
Tyr Cys Arg Pro Ala Phe His Arg Gln Phe Glu Phe Leu Arg Asp Glu
165 170 175
Val Leu Asn Glu Gly His Leu Gly Trp Ile Leu Gly Pro Pro Gly Thr
180 185 190
Gly Lys Ser Thr Thr Ala Met Ala Phe Ala Ser Thr Leu Asp Arg Ser
195 200 205
Glu Trp Ile Val Thr Trp Ile His Val Gly Lys Phe Met Ser Trp Arg
210 215 220
Cys Val Arg Leu Ile Gly Glu Asp Arg Arg Ser Arg Ile Leu Asp Ile
225 230 235 240
Ser Asp Val Asp Glu Val Leu Met Val Asp Asp Thr Arg His His Val
245 250 255
Val Leu Val Asp Gly Trp Thr Ala Ala Asp Glu Phe Ile Glu Leu Thr
260 265 270
Arg Lys Cys Val Glu Trp Phe Leu Val Gly Thr Lys Val Lys Arg Arg
275 280 285
Leu Ala Phe Val Cys Ser Val Ala Ala Arg Gly Lys Phe Gln Glu Asp
290 295 300
Met Glu Ile Leu Thr Arg Ala Arg Glu Phe Arg Val Trp Ser Trp Thr
305 310 315 320
Leu Asp Glu Tyr Leu Asn Ala Ile Lys Asp Asp Glu Val Phe Gln Ser
325 330 335
Val Ser Gln Cys Leu Asp Ala Pro Ala Val Leu Pro Asp Glu Glu Met
340 345 350
Ser Arg Ala Ala Met Val Glu Ser Lys Tyr Tyr Tyr Ala Gly Gly Ser
355 360 365
Cys Arg Tyr Met Phe His Phe Arg Thr Val Thr Val Ala Thr Lys Leu
370 375 380
Ser Asp Ala Val Asp Ser Leu Asn Asp Ala Ala Ile Val Ala Thr Ser
385 390 395 400
Gly Gln Arg Ser Ser Ser Ser Ile Asn Arg Leu Phe Gly Met Phe Gln
405 410 415
Arg Pro His Asp Val Gly Ala Val Ser Pro Val Ile Ser Gln Tyr Ala
420 425 430
Ala Thr Leu Ile Ala Ile Arg Cys Gly Pro Glu Ala Ile Lys Lys Phe
435 440 445
Ile Ser Thr His Arg Asp Asn Ser Asn Pro Ala Leu Asp Gly Trp Met
450 455 460
Leu Glu Met Val Phe Phe Ala Ser Leu Arg Asn Gly Gly Leu Ala Leu
465 470 475 480
Val Asp Ala Ala Gly Asn Thr Val Asp Thr Trp Gly Gln Ser Val Val
485 490 495
Val Ile Ala Asp Gly Ile Pro Ala Leu Ser Ser Ala His Pro Val Trp
500 505 510
Ile Lys Pro Glu Lys Trp Asn Gln Gly Gly Tyr Asp Ala Ile Met Val
515 520 525
Cys Lys Arg Thr Gln His Val Arg Leu Val Gln Val Thr Ser Ala His
530 535 540
Lys His Ser Phe Arg Ile Asp Tyr Phe Tyr Gly Trp Leu Lys Met Leu
545 550 555 560
Ser Glu Ser Pro Glu Ser Phe Glu Val Lys Thr Met Glu Ile Val Phe
565 570 575
Val Val Glu Gln Asp Lys Leu Ser Thr Phe Asp Phe Ser Thr Val Lys
580 585 590
Gly Ala Gly Leu Leu Arg Pro Phe Gly Trp Ser Lys Gly Lys Glu Thr
595 600 605
Asp Leu Val Arg Leu Val Gly Ile Arg Gly Leu Tyr Asn Leu Ser Pro
610 615 620

Claims (10)

1. A CRN effector protein gene is at least one of CRN12, CRN13, CRN20, CRN23 and CRN19, and the CRN12, the CRN13, the CRN20, the CRN23 and the CRN19 respectively have nucleotide sequences shown in SEQ ID No. 1-5 in sequence.
2. The CRN effector protein encoded by the gene of claim 1, which has the amino acid sequences shown as SEQ ID NO 6-10 in sequence.
3. An expression cassette, a recombinant expression vector, a transgenic cell line or a transgenic recombinant bacterium containing the CRN effector protein gene of claim 1.
4. The recombinant expression vector according to claim 3, wherein the starting vector of the recombinant expression vector is the expression vector PBIN-PLUS.
5. A plant immunity inducer, which comprises the CRN-type effector protein of claim 2 or a fermentation broth of the CRN-type effector protein of claim 2.
6. Use of a CRN-like effector protein gene as defined in claim 1, a CRN-like effector protein as defined in claim 2 or an expression cassette, recombinant expression vector, transgenic cell line or transgenic recombinant bacterium as defined in claim 3 for triggering the development of resistance in a plant induced by HR ROS.
7. Use of the CRN-like effector protein gene of claim 1, the CRN-like effector protein of claim 2, or the expression cassette, recombinant expression vector, transgenic cell line, or transgenic recombinant bacterium of claim 3 for the development of a plant immunity-inducing agent.
8. The use of the CRN effector protein gene of claim 1 in breeding new varieties of disease-resistant crops.
9. A method for inducing plant resistance, characterized in that CRN effector protein gene of claim 1 or expression cassette, recombinant expression vector, transgenic cell line or transgenic recombinant bacterium of claim 3 is introduced into a plant to trigger HR ROS to induce the plant to generate resistance.
10. A method for cultivating disease-resistant crop varieties is characterized in that CRN effector protein genes as claimed in claim 1 or expression cassettes, recombinant expression vectors, transgenic cell lines or transgenic recombinant bacteria as claimed in claim 3 are introduced into plants, positive transformation plants are obtained through resistance screening, and disease-resistant crop varieties are obtained.
CN202110479615.7A 2021-04-30 2021-04-30 Application of CRN effector protein gene in inducing plant resistance Active CN113337523B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110479615.7A CN113337523B (en) 2021-04-30 2021-04-30 Application of CRN effector protein gene in inducing plant resistance

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110479615.7A CN113337523B (en) 2021-04-30 2021-04-30 Application of CRN effector protein gene in inducing plant resistance

Publications (2)

Publication Number Publication Date
CN113337523A true CN113337523A (en) 2021-09-03
CN113337523B CN113337523B (en) 2024-06-07

Family

ID=77469225

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110479615.7A Active CN113337523B (en) 2021-04-30 2021-04-30 Application of CRN effector protein gene in inducing plant resistance

Country Status (1)

Country Link
CN (1) CN113337523B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718402A (en) * 2019-09-20 2020-09-29 山东农业大学 Phytophthora capsici effector protein and coding gene and application thereof
CN112575006A (en) * 2020-12-25 2021-03-30 南京农业大学 Elicitin gene for inducing HR and active oxygen accumulation in biocontrol pythium and expression vector and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718402A (en) * 2019-09-20 2020-09-29 山东农业大学 Phytophthora capsici effector protein and coding gene and application thereof
CN112575006A (en) * 2020-12-25 2021-03-30 南京农业大学 Elicitin gene for inducing HR and active oxygen accumulation in biocontrol pythium and expression vector and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GAULIN，E.: "GenBank：TMW67258.1", GENBANK *

Also Published As

Publication number Publication date
CN113337523B (en) 2024-06-07

Similar Documents

Publication Publication Date Title
CN114989272B (en) Phytophthora camphorata effector protein SCR97226 and application thereof
CN108948161B (en) Application of four plant NAC transcription factor NAC089 genes in soybean and Nicotiana benthamiana and expression vector thereof
CN110592100B (en) Cassava CAMTA gene and construction and disease-resistant application of suppression expression vector thereof
CN116024234B (en) Poplar aschersonia aleyrodis effector protein SmCSEP3 and application thereof
CN112575006B (en) Elicitin gene for inducing HR and active oxygen accumulation in biocontrol pythium and expression vector and application thereof
CN101845445A (en) Cre recombinase recombination gene and Cre/loxP-mediated transgenosis safe plant expression vector
CN112538490B (en) NLP gene for inducing necrosis and active oxygen accumulation in preservative mold, and expression vector and application thereof
CN110283238B (en) Rice disease-resistant protein RWR1 and application thereof
CN116083445A (en) CrBZR1 gene and application thereof
CN115927351A (en) Application of brown planthopper salivary protein gene NlDNAJB9 in inducing plant to generate resistance
CN113337523B (en) Application of CRN effector protein gene in inducing plant resistance
CN112538489B (en) Elicitin gene for inducing plant resistance by pythium biocontrol, expression vector and application thereof
CN112646008B (en) Elicitin gene for inducing HR in pythium ultimum and application of expression vector thereof
CN109504680B (en) Salt stress inducible promoter, primer, expression vector and application thereof
CN112442494B (en) Two TK1 receptor kinase genes in arabidopsis thaliana and soybean and application thereof
CN111363019B (en) Application of SiMYB56 protein and coding gene thereof in regulation and control of low nitrogen tolerance of plants
CN116622725B (en) Hybrid tulip tree LhMFT2 gene and application
CN111454987B (en) Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance
CN113151293B (en) Stress-resistant gene line AcDwEm and application thereof in improving salt resistance, drought resistance and high temperature resistance of crops
CN109355300B (en) Application of coptis SDAR transcription factor in improving drought resistance of plants
CN110835367B (en) Pear flowering regulating transcription factor PbrSPL15 and application thereof
CN109678940B (en) Protein BhDnaJ6, and coding gene and application thereof
CN100436582C (en) Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application
CN118388611A (en) Cedar rot fungi CRN effector protein and application thereof
CN116120418A (en) LoWRKY22 gene for regulating and controlling stress resistance of lily and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant