CN113337523B - Application of CRN effector protein gene in inducing plant resistance - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a CRN effector protein gene and application thereof in inducing plant resistance. The invention identifies five CRN effector protein genes CRN12, CRN13, CRN20, CRN23 and CRN19 from Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythiumperiplocum), wherein the CRN12, CRN13, CRN20, CRN23 and CRN19 genes respectively have nucleotide sequences shown in SEQ ID NO. 1-5 in sequence. Five CRN-type effector protein genes identified from Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythiumperiplocum) can trigger HR ROS to induce plants to generate resistance.

Description

Application of CRN effector protein gene in inducing plant resistance

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a CRN effector protein gene and application thereof in inducing plant resistance.

Background

During the long-term co-evolution of plants with pathogenic bacteria, pathogenic bacteria evolve a large number of weapons, such as effector proteins (effectors), that attack the host in order to better infect the plant. Pathogenic bacteria secrete these effector proteins into the plant body in order to promote better infection of the host plant, however, with co-evolution of the plant, some effector proteins are recognized by genes related to the regulation and disease resistance of the plant itself. Recognition of pathogens typically triggers a local resistance response, known as Hypersensitivity (HR), characterized by rapid cell death at the site of infection. This apparent HR response is also an important signal for stimulating plant immunity for studying plant interactions with pathogenic bacteria. Reactive oxygen species accumulation is also a key signal triggering plant immune responses and can also be used as a signal marker for triggering plant defensive responses. Inoculation of pathogenic bacteria using agrobacterium-mediated transient expression systems is the most straightforward method to assess whether genes are capable of inducing plant resistance.

Pythium oligandrum (Pythium oligandrum) ¹ and Pythium gracile (Pythium periplocum) ² are widely applied to plant root systems, induce plants to generate wide and long-term resistance to pathogenic bacteria by secreting a large number of elicitors in the process of contacting plants, and have strong heavy parasitism and antagonism on a plurality of pathogenic bacteria. At present, the international pythium oligandrum product takes oospores as an effective component, and related products based on pythium oligandrum immune induced resistance proteins have not been developed. We obtained by extensive screening five homologous genes derived from Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum), respectively, capable of triggering plant allergic reactions (HR) and Reactive Oxygen Species (ROS) accumulation. CRN family effector proteins generally have dual identities, one being able to induce plant disease resistance and the other being promoting pathogen infestation. 5 effectors capable of inducing plant disease resistance are screened from two kinds of preservative mold of Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum), and the method has great significance in developing transgenic disease resistance strategies and providing environment-friendly disease resistance strategies.

Disclosure of Invention

The invention aims to provide a CRN effector protein gene and application thereof in inducing plant resistance. The five CRN effector protein genes identified by the invention can be used as theoretical knowledge supplement for inducing plants to generate resistance and developing plant immunity induced resistance, and provide theoretical guidance for preventing and controlling crop diseases and insect pests.

The aim of the invention can be achieved by the following technical scheme:

The invention identifies five CRN effector protein genes CRN12, CRN13, CRN20, CRN23 and CRN19 from Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum), wherein the CRN12, CRN13, CRN20, CRN23 and CRN19 genes respectively have nucleotide sequences shown in SEQ ID NO. 1-5 in sequence. The proteins coded by the five CRN effector protein genes are five CRN effector proteins which sequentially and respectively have amino acid sequences shown as SEQ ID NO 6-10.

An expression cassette, a recombinant expression vector, a transgenic cell line or a transgenic recombinant bacterium containing the CRN effector protein gene.

Recombinant expression vectors PBIN-PLUS containing the above CRN-type effector protein gene CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN20, PBIN-PLUS CRN23 and PBIN-PLUS CRN19.

Recombinant expression vectors PBIN-PLUS of CRN effector protein genes CRN12, CRN13, CRN20, CRN23 and CRN19, CRN12, PBIN-PLUS, CRN13, PBIN-PLUS, CRN20, PBIN-PLUS, CRN23 and PBIN-PLUS, CRN19 were constructed. The plant expression vector PBIN-PLUS is taken as a starting vector, and CRN12, CRN13, CRN20, CRN23 and CRN19 genes are respectively inserted into KpnI and XbaI restriction sites of PBIN-PLUS to obtain the recombinant DNA.

The CRN effector protein gene and the expression vector thereof can excite plant immune response, provide a knowledge base for developing immune elicitor and provide theoretical guidance for preventing and controlling crop diseases and insect pests.

A plant immunity inducer contains the Pythium oligandrum CRN effector protein or fermentation broth of the Pythium oligandrum CRN effector protein.

The application of the CRN effector protein gene, the CRN effector protein or the expression cassette, the recombinant expression vector, the transgenic cell line or the transgenic recombinant bacteria in triggering the HR ROS to induce the plant to generate resistance.

The CRN effector protein gene, the CRN effector protein or the expression cassette, the recombinant expression vector, the transgenic cell line or the transgenic recombinant bacteria are applied to the development of plant immunity elicitor.

The CRN effector protein gene is applied to the cultivation of new varieties of disease-resistant crops.

A method for inducing plant resistance comprises introducing the CRN effector protein gene or the expression cassette, recombinant expression vector, transgenic cell line or transgenic recombinant bacteria into plant, triggering HR ROS to induce plant resistance.

A method for culturing the variety of disease-resistant crops includes such steps as introducing the CRN effector protein gene or its expression cassette, recombinant expression carrier, transgenic cell line or recombinant bacteria to plant, and screening to obtain positive transformed plant.

The invention has the beneficial effects that:

Five CRN-type effector protein genes are identified from Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum) and are inserted into an expression vector PBIN-PLUS. The vector is introduced into plants, can generate obvious HR ROS reaction and can excite plant immunity. The five CRN effector protein genes can be used as potential candidates for developing plant immunity elicitors and are theoretically supported by prevention and control of plant diseases. Meanwhile, the plant can be directly introduced into crops to prepare transgenic plants, and a novel transgenic disease-resistant strategy is provided.

Drawings

FIG. 1 is a graph of CRN19 triggering HR ROS-induced plant resistance.

Wherein A is that the transient expression of agrobacterium and injection of the present tobacco leaves induce an HR phenotype; b is that the agrobacterium transient expression injection of the tobacco leaves can induce active oxygen accumulation; c is that the transient expression of CRN19 gene by agrobacterium can improve the resistance of plants to phytophthora capsici; d is the spot area statistics of the agrobacterium-induced disease resistance phenotype.

FIG. 2 is a graph of CRN12/13 triggering HR ROS-induced plant resistance.

Wherein A is that the transient expression of agrobacterium and injection of the present tobacco leaves induce an HR phenotype; b is that the agrobacterium transient expression injection of the tobacco leaves can induce active oxygen accumulation; c is that the transient expression of CRN12 gene of agrobacterium can improve the resistance of plants to phytophthora capsici and the spot area statistics on tobacco; d is that the transient expression of CRN13 gene of agrobacterium can improve the resistance of plant to phytophthora capsici and the spot area statistics on tobacco.

FIG. 3 is a graph of CRN20 triggering HR ROS-induced plant resistance.

Wherein A is that the transient expression of agrobacterium and injection of the present tobacco leaves induce an HR phenotype; b is that the agrobacterium transient expression injection of the tobacco leaves can induce active oxygen accumulation; c is that the transient expression of CRN20 gene by agrobacterium can improve the resistance of plants to phytophthora capsici; d is the spot area statistics of the agrobacterium-induced disease resistance phenotype.

FIG. 4 is a graph of CRN23 triggering HR ROS-induced plant resistance.

Wherein A is that the transient expression of agrobacterium and injection of the present tobacco leaves induce an HR phenotype; b is that the agrobacterium transient expression injection of the tobacco leaves can induce active oxygen accumulation; c is that the transient expression CRN23 gene of the agrobacterium can improve the resistance of plants to phytophthora capsici on tobacco; d is the spot area statistics of the agrobacterium-induced disease resistance phenotype.

Detailed Description

The present invention will be described in detail with reference to specific examples. From the following description and examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

EXAMPLE 1 amplification and sequencing of five CRN genes

1. Experimental strains

The test strains Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum) are preserved in 10% V8 solid medium by the interaction laboratory of plant disease system plants of Nanjing university and phytophthora, and the preservation temperature is 10 ℃.

2. Preparation of test Nicotiana benthamiana seedlings

The Nicotiana benthamiana (Nicotiana benthamiana) was sown in plastic pots (d=10cm) containing vermiculite (2-4 mm) and grown in a greenhouse with 14h of light (intense light) and 10h of darkness. After two true leaves grow for 7 days, transplanting the true leaves to vermiculite black soil, wherein the mentioned volume ratio is 5:1 were grown in the culture soil for 30 days, leaves at the same 3,4,5 leaf positions were taken as the expression test genes, and then observation was continued for 7 days as to whether the leaf phenotype had obvious HR.

3. Extracting RNA of Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum) and obtaining cDNA of target gene

The mycelium of Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum) are collected, quickly frozen by liquid nitrogen and then placed into a mortar for cooling and grinding. And extracting and purifying Pythium ultimum total RNA by referring to a recommended method of a total RNA extraction and purification kit of the Tiangen company. Referring to the method provided by the RNA reverse transcription kit of the Norpran company, oligo (dT) is used as a primer for reverse transcription to synthesize cDN A. PCR amplification was performed using the above cDnA as a template and the corresponding upstream and downstream primers (primer sequences are shown in Table 1).

TABLE 1 primer sequences

name	sequence
		PyolCRN12-F	GAGCTGTACAAGGGTACCATGGTGTTCTCCGTCGAG
PypeCRN13-F	GAGCTGTACAAGGGTACCATGGTGTTCTCCGTCGAG
		PyolCRN20-F	GAGCTGTACAAGGGTACCATGTTTCCTGTGGACATT
PypeCRN23-F	GAGCTGTACAAGGGTACCATGGTGTTCCCCGTGAGG
		PypeCRN19-F	GAGCTGTACAAGGGTACCATGGGTGTGTACGGCGAA
PyolCRN12-R	GACTCTAGTTCATCTAGATCAGGTTTCGTTCGCGTA
		PypeCRN13-R	GACTCTAGTTCATCTAGATTAGGTTTCGTTCGCGTA
PyolCRN20-R	GACTCTAGTTCATCTAGATCACGATAACTCCACAGT
		PypeCRN23-R	GACTCTAGTTCATCTAGATTACGTGTAATAGCTGAA
PypeCRN19-R	GACTCTAGTTCATCTAGATTATGGTGATAGATTATA

The PCR reaction system is as follows: 2.5. Mu.L of 10 XPCR reaction buffer; 1.5. Mu.L of 1.5mM MgCl2;0.5 μL of 2.5mM dNTPs; 0.25. Mu.L Taq DNA polymerase (5.0U/. Mu.L); 0.5. Mu.L of primer; 0.5 μl template; sterile water was made up to 25 μl.

The reaction procedure is: pre-denaturation at 94℃for 5 min; denaturation at 94℃for 15s, annealing at 58℃for 15s, elongation at 72℃for 1:30min,35 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.

And (3) carrying out agarose gel electrophoresis and recovery on the PCR amplification products, and confirming that the sequence is correct by sequencing, wherein the obtained sequence is the nucleotide sequence of the 5 CRN genes. The CRN genes comprise CRN12, CRN13, CRN19, CRN20 and CRN23 from Pythium oligandrum (Pythium oligandrum) and Pythium gracile (Pythium periplocum), and the nucleotide sequences of the CRN12, CRN13, CRN19, CRN20 and CRN23 genes are shown in SEQ ID NO. 1-5 respectively. The amino acid sequences of the proteins coded by the five CRN genes are respectively shown in SEQ ID NO. 6-10 in sequence. Subsequent studies have found that it has a powerful function of inducing necrosis and active oxygen accumulation in plants.

EXAMPLE 2 construction of PBIN-PLUS: GFP, PBIN-PLUS: INF1, PBIN-PLUS: CRN12, PBIN-PLUS: CRN13, PBIN-PLUS: CRN19, PBIN-PLUS: CRN20 and PBIN-PLUS: CRN23 expression vectors

PBIN-PLUS (BIOVECTOR China plasmid vector Strain cell line Gene Collection) empty plasmid was digested with KpnI and XbaI. The desired fragments (CRN 12, CRN13, CRN20, CRN23 and CRN 19) were ligated to the vector using the homologous recombination enzymes of the Northey Zan company. PBIN-PLUS GFP, PBIN-PLUS INF1 vector is constructed by single enzyme cutting of PBIN-PLUS empty vector plasmid with SmaI and then connecting with corresponding gene fragment, and the construction method is a conventional method disclosed in the prior art.

The reaction system is as follows: 2. Mu.L of 10 XCE II reaction buffer; 2. Mu.L of the above PCR recovered product; 2. Mu.L of the digested empty vector; 1. Mu.L of homologous recombinase; sterile water was made up to 10 μl.

The reaction procedure is: the reaction was carried out at 37℃for 30min. The ligation product is transformed into E.coli DH5 alpha, transformants are screened on Kan resistant medium, and positive clone extraction plasmids are picked up for colony PCR identification. Sequencing the identified positive clone, and obtaining PBIN-PLUS:GFP、PBIN-PLUS:INF1⁴、PBIN-PLUS:CRN12、PBIN-PLUS:CRN13、PBIN-PLUS:CRN19、PBIN-PLUS:CRN20 and PBIN-PLUS CRN23 expression vectors correctly.

Example 3 transformation of Agrobacterium with expression vector and functional verification

1. Obtaining Agrobacterium competent cells

Culturing agrobacterium GV3101 strain on LB solid medium plate by streaking, and culturing for 18-20h at 28deg.C; placing the single colony in LB liquid medium (containing 100mg/L Rif), and shake culturing at 28deg.C for 18-20h; adding 100 times of bacterial liquid without antibiotics into the bacterial liquid, and carrying out shake culture on OD600 to 0.3-0.5 at the temperature of 28 ℃; centrifuging at 4000r/min for 5min at 4deg.C after cooling on ice, and discarding supernatant; adding 20mmol/L CaCl ₂ solution to suspend the precipitate, centrifuging at 4 ℃ for 5min at 4000r/min, and discarding the supernatant; adding 20mmol/L CaCl ₂ solution to suspend the bacterial precipitate again for standby.

2. PBIN-PLUS GFP, PBIN-PLUS INF1, PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN19, PBIN-PLUS CRN20 and PBIN-PLUS CRN23 expression vectors for the transformation of Agrobacterium

Transforming the expression vectors of PBIN-PLUS, GFP, PBIN-PLUS, INF1, PBIN-PLUS, CRN12, PBIN-PLUS, CRN13, PBIN-PLUS, CRN19, PBIN-PLUS, CRN20 and PBIN-PLUS, CRN23 into Agrobacterium cells by electrotransformation; the electric stun cup was rinsed three times with 70% alcohol and then completely air dried. 100ng of the expression vector was added to agro-competent cells and left on ice for 30min. Agrobacterium competent cells were transferred to the cuvette and shock transformed with a voltage of 2.5 kV. After completion of the electric shock, the Agrobacterium competent cells were added to 400. Mu.L of LB liquid medium and cultured with shaking at 28℃for 2 hours. mu.L of the bacterial liquid is sucked, uniformly smeared on a rifampicin solid LB culture medium plate containing 50mm kanamycin and 25mm, and inversely cultured for 48 hours at 28 ℃. And picking a single colony for colony PCR to obtain a positive clone.

3. Transient expression of PBIN-PLUS in Nicotiana benthamiana: GFP, PBIN-PLUS: INF1, PBIN-PLUS: CRN12, PBIN-PLUS: CRN13, PBIN-PLUS: CRN19, PBIN-PLUS: CRN20 and PBIN-PLUS: CRN23 protein

The positive clones were placed in LB liquid medium and shake-cultured at 28℃for 30h. The bacterial liquid was collected, centrifuged at 8000rpm for 2min and washed three times with 10mM MgCl2. Finally, the bacterial solution was diluted with 10mM MgCl2 to an OD600 of 0.3. Mixing the bacterial liquid with bacterial liquid 1 containing a silencing inhibitor P19: 1. All genes were injected separately on the leaf discs using a 1mL syringe, each at least 5 replicates, and the experiment was repeated three times, the results of which are shown in figures 1-4.

4. Detection of Nicotiana benthamiana disease resistance by transient expression PBIN-PLUS CRN12, PBIN-PLUS CRN13, PBIN-PLUS CRN19, PBIN-PLUS CRN20 and PBIN-PLUS CRN23 proteins

The leaves confirmed to express the protein were cut off and placed in a tray where filter paper was kept wet. Punching holes on the growth edges of the phytophthora capsici by using a 7mm puncher, and placing the punched fungus discs on the left and right sides of the leaf tobacco sheet in a downward and bilateral symmetry manner. The trays were placed in a 25℃incubator, dark, for 36h. The leaves were removed and then irradiated with a hand-held uv fluorometer. The darkened area is the infected area of phytophthora capsici. The area of the affected area was measured with a measuring tape, the leaf surface of the expressed PBIN-PLUS GFGP protein was used as a control, and the effect of the two proteins on resistance to Benshi smoke was compared. It was found that 5 CRN proteins from pythium oligandrum and pythium twine significantly improved the resistance of tobacco to phytophthora capsici (as shown in figures 1-4).

7. Reactive Oxygen Species (ROS) accumulation assay ³

After 36h injection of all the treated genes, staining with 1mg/ml DAB solution in the dark for 8h, decolorizing with 95% ethanol, and finally recording the phenotype by camera photographing, the experimental results are shown in FIGS. 1-4.

Reference to the literature

1.Benhamou,N.et al.Pythium oligandrum:an example of opportunistic success.Microbiology158,2679-2694,doi:10.1099/mic.0.061457-0(2012).

2.Paul,B.&Masih,I.ITS1 region of the nuclear ribosomal DNA of the mycoparasite Pythium periplocum,its taxonomy,and its comparison with related species.FEMS Microbiology Letters(2000).

3.Jambunathan,N.Determination and detection of reactive oxygen species(ROS),lipid peroxidation,and electrolyte leakage in plants.Methods Mol Biol 639,292-298,doi:10.1007/978-1-60761-702-0_18(2010).

4.Qi Li1,Gan Ai1,2,Danyu Shen1,Fen Zou1,Ji Wang1,Tian Bai1,Yanyu Chen1,Shutian Li1,Meixiang Zhang1,Maofeng Jing1 and Daolong Dou1,A Phytophthora capsici Effector Targets ACD11 Binding Partners that Regulate ROS-Mediated Defense Response in Arabidopsis.Mol Plant12,565-581(2019).

Sequence listing

CRN12 Gene

ATGGTGTTCTCCGTCGAGGTTGAGAGAAACGCAGACGTGGAAGCGCTGCAGGAGGCTATCTTTGTCAAGAAGCGATACAAAGAGCGCTATACATTCGATGCAAGCGCATTGACGCTGTACTTGGCGAAGAAGGACGGCGCATGGCTCAAGCATGATCACACTGTGAAGGCGTTCTTGCAAGGTGACATCGACACTGAGTACGAGGAGATGCTTTCGACGTGGAAGCTCAATAAGGAGGAGTTGTTTGGGGACTTCCAGCTCGGAGGAGAAGAGATTCACGTGCTGGTGGAGCTCCCAGAGCGCCAGTCTGCTGATCCTCAGCTGATCGAGCTTCAGGAATCACTTTTGCAGCATATCCTGATGGATGCTCCAACTTCGACGTCCGTGCGAAGCAATCATTTCAAGAAGAAGCTGTGTGCAACGTACAATTGCGACATGGGAAGTGGCCAGTTGCGCTGTATGCTACTGGACACAGCTCTTCCGTCGGAGTTGGTGATTGCGTCTCATTTGTTTCGCCGAAAAAACGAATTTATCTCTGAGAAGTTTATGGGATTCTCGGATATCGACGACGTGAGAAACGGTTTGCTGCTTTTCAAGCCGCTGGAGCATGCGCTCGACCATTTCCAGATCAGCTTTATTTACGACCCAAGCAGCAACGAGTTTCGTTTGAAGATTTTCGACCGATCCATGAGAAAACAGCGATTGCTTGGAAAATTAGACAAAACGCAGCGTGCGATACTTCTTCAAGGTCAGGTGTTGCCGAAAAACTGGAGATCGCGAGGTCGAAGACTTGCACCCGGGACAAACTATGACCTCCAGACGACTTTTGGTGATCTTGAAGGTCGGACACTTTGCTTTCGGGGTATCGAGCGTCCGTACAAGCGTTGTTTGAACTTGCAGGCCCGATTAGCCCGAAAACAAGCAATCAAGAAACAGTGGATCGAGCCAGAGGAAGATGACTTTCAAGACTTTTGGTCCGAAGGCATGTCGTTGGCAGAGAAGATGGAGTTTTACTACGCGAACGAAACCTGA

CRN13 Gene

ATGGTGTTCTCCGTCGAGGTTGAGAGAAACGCAGACGTGGAAGCGCTGCAGGAGGCTATCTTTGTCAAGAAGCGATACAAAGAGCGCTATACATTCGACGCAAGCGCATTGACGCTGTACTTGGCGAAGAAGGACGGCGCATGGCTCAAGCATGATCACACTGTGAAGGCGTTCTTGCAAGGTGACATCGACACTGAGTACGAGGAGATGCTTTCGACGTGGAAGCTCAATAAGGAGGAGTTGTTTGGGGACTTCCAGCTCGGAGGAGAAGAGATTCACGTGCTGGTGGAGCTCCCAGAGCGCCAGTCTGCTGATCCTCAGCTGATCGAGCTTCAGGAATCACTTTTGCATCATATCTTGATGGATGCTCCAACTTCGACGTCCGTGCGAAGCAATCATTTCAAGAAGAAGCTGTGTGCAACGTACAATTGCGACATGGGAAATGGCCAGTTGCGCTGTATGCTACTGGACACAGCTCTTCCGTCGGAGTTGGTGATTGCGTCTCATTTGTTTCGCCGAAAAAACGAATTTATCTCTGAGAAGTTTATGGGATTCTCGGACATCGACGATGTGAGAAACGGTTTGCTGCTTTTCAAGCCGCTGGAGCATGCGTTCGACCATTTCCAGATCAGCTTTATTTACGACCCAAGCAGCAACGAGTTTCGTTTGAAGATTTTCGACAGATCCATGAGAAAACAGCGATTGTTTGGAAAATTAGACAAAACGCAGCGTGCGATACTTCTTCAAGGTCAGGTGTTGCCGAGAAACTGGAGATCGCGAGGTCGAAGACTTGCACCCGGGACAAACTATGACCTCCAGACGACTTTTGGTGATCTTGAAGGTCGGACGCTTTGCTTTCGGGGTATCGAGCGTCCGTACAAGCGTTGTTTGAACTTGCAGGCCCGACTAGCCCGAAAACAAGCAATCAAGAAACTGTGGATCGAGCCAGAGAAAGATGACTTTCAAGACTTTTGGTCCGAAGGCATGTCGTTGGCAGAGAAGATGGAGTTTTACTACGCGAACGAAACCTAA

CRN20 Gene

ATGTTTCCTGTGGACATTGATGAGAGTCTGACGGTTGGGGACTTGAAGGAAGTGATCCGGGGGAAGAAGCCGCGCAAGATCACGTGCGATGCCGATGAGTTGGAGTTGTACTTGGCCAAGAGGGGCGACGCGTGGCTGACAGAAAACGAGGTCAGAGGGATAAGTGACACCAATGGCCTCAAGTATCTGGGTGCTGCGCGAGCGGAACTCGACGTAGTTGGCCTTTCGGAGGAAGATCTGCGATTCGAAATCGACAAACACCGAGTTGCAGCAGGATATGGCCCTGTAAATGTGTTGGTGGTGGTCCCGTCAAATGGAACGAGCATGTCTGTGGTGGGGACGAACATTGAAAAGTTCAGGACTCCACTTCAGTTCTCCACTGCGGAACACGAAGGTGGCGTTCCTTCAACATTCAGGACCTATCGATCAGCCACTGTTCACGCATTTTTCAGGCTGCTGTTTCCTCCGGGCGGGAACTTTCTCCCATTAATATTCGTCCGTGCACCACCGTTATCCGGAAAGTCTGCCATGTTCGACCTACTCTACAATCACATTGTGCTCTCCCAGCCGGATGCGCTTGTTGCGCGGGTGTCTGCGAATTTTATGCCTGAGTCGACCACATTCTGTCAATACTTCAGCTCAACCTATGGCTGCGATTTTAAAGCATTCTGCAAGCTCGACTACGAGAAAGTGGTATTGATTGATGAGGCTCAAGTGACGTACGATGATGATCTACTTTGGCTGGGTTACCTGAAGAATACGTTGGAGGGGAAAGTCCACGGCCTACGATTTGTTCTCTTCTCGTCATACGGCAGTTTTGACATTTACCGGGAGGATGTACGTCCTGGGACTCCTATTCTCGTCCCGCCGGGAAATACTTTTGGATTGAATGCGGCGCCATCGAAGCCTGGCTTGCAACTCACGCGCGTAGAACTGGACGAAATGATTCACGGAAGCATCGGAGCAGCGGTGGGTGATCTCATTTGGATTCTGTGCTCTGGACATATCGGGATTGCTCGAGCAATACTCAGGTTTTTGCATGGCAAGTTTGGATCAAAGAAAGCATCCATTGCTCCTGAAGATCTGGAAGCAGAACTTCGTTCAGTCCGCTTGCTACGATACATCCGCGACAGTTATCGTGGCATACCGACGCTTGATGCTTTTCAGCGAGTGATCCAGGGTCGGCAATTGGCTGACGAGTCGAAGTTGAAGATGAGTGAAGTGATGAGTAGTGTTGCTTCGGGCAAGATTGTGCTTGCATCTGATGGGGAGCGATCTCCTAGAAGTCGTCTTGCAGTGGAATTACTTACCCGATTCGGTTTCCTCTACGAGGATTACAACAAGCAACTCCAGTTCGCATCGAATATGCATCTGAAGATTTGGCTGCATTCAAATCGATCGGATCCAATCGGACATATGGTCTCCAACATCTCGCATGACGAATTCTTGGTTGCTTGTATAACGAGAATGCGTAGTTCGCAACTTCAGCATTTTGCGACTGGAAACACCAGCAACACGTTGGTTGCTCGAGAGCGCCAAATCCAAATGGAGCTGTACAACGCCACCACTTCATGTTTACCGCGGGACGTGCTAGTTACTCCAGAATGGCGCACGAGTGATGAGATAGGCTTCGTTGACCTGGTTATTCAAGGCGGAGATATCCTCTGGTTCTGGGAGCTGCTTGTGAATGGAGACGATGCTGTTAGCCATTCGAAGCGATTCAAAACAGGTGGCAAGTACTATGGAAGCCTTACGAGCCATTCTCGATACGTACTCATTGACTTCCGTCAGAACAAAGGCGTTCGAGAGCAGAAGCTTGGTTTTTTGTACGTGTCCTTTGTGGATTCTTACTCTAAGGCGAAGATCTTTGGGCTTCATAGGGACGAGATCACTGTGGAGTTATCGTGA

CRN23 Gene

ATGGTGTTCCCCGTGAGGATCGCACGTGATGCTAGAGTGAGCGCACTGCAGAAGGCTATCTTTGACGAGAAACGATACAGAGAGCGCTACACCTTTGACGCAAGCGCATTGACGCTGTACTTGGCGCGGAAGAAGGAAGGTGACGAAAGCAAGTGGCTGACGGATGACGACAATTTGGATGCTATCTTGGGAGGAGATGTCGACAAGCAGTTCGTGAAAATGCGATCGTTGTGGATTCTCAGCGAAGATTACCTTGGCGCGAATTTTCAGCCTGGGCGCAAAGAGATCCACGTGCTGGTGGAACTCCCAGAAGGTGCGGCCGGTGAGAAATCGGAAATGGCACAAATGATGAAGGAAATGTACGAGCATATTGTGCATCCTGTGCAGACTAAGCGCAAATACGTCCATTCCGAGATGAACTCAAGCAAGGGAATCGCGCTTCTGAAAGACCTGAATATTCGAGTGAAGGACGCGGACTCGGTTCCATTCTCTACTGAAGATCCAACTCCGGTTGAACCATTCACATGGGAAAGTGTTTGTAATGAACATGGCCAACTCATTGTGCTTACCGAGGAGCAGCAACGAGAACGATATCGTAGATACGTGGAAGACAACATTGGCGATGTGCTCGCGGAGAAGAGGCTTTGCGTGCTCGGTGTGGAAAAAGGCAAGAATATTCTCACTGCTGACGTCCCTGGTCACGACATTGAACTTGCTGGACGGACGGATATGCTCATACTGAGGGATGTCACAAAGCAGTTCCCGGACCATTTGGAGATGTTGGATGAAGTGAAGATGCTTATCGAAGTGAAGAGGAACGTAAAAGGAGGCTCTGTTTTCCAGGCGTTGTCGGAACTGATTGCGCTAGATGTTCTTGTCGATGACCCAGTGATGGCACTGCTGACCGACTTGACTGGCCGTTGGCAGTTCTTCTGGGTCTCCGAGAAGAGCGACAACCATGTCATCATCCGAACAGTGATTATATCTGATCCAAGCGCGGCGTTTGCCGTGATCAGGACGCTACTTGCACAGTCGCCAAATGGTGATGCAGATATCACACTTCCATGTTTTGGAGAACCCGTGAAACGACGCAAGTTGGCTCAATTGCTGCCGTCTATTGGTGAAGGAGGTGAAAGCGGCGGCATACGTGAGGCTATCGAACGGTACTATGATATCGCAAGCGTGCTGGGTCCCGACATTGACATGGCACGTTCTGTGGCTCACCAACTTGTCCGAACGATTCCCACGTTCAGCTATTACACGTAA

CRN19 Gene

ATGGGTGTGTACGGCGAAGGGAGTGTCTTCTCGGTCGAGATCCAGCGCAATGCAGATGTGGAGGCGCTGCAGAAGAAGATCGCAAGTACATACAGAGTCGTGAGCAACCGCGTTGAGGTTTACCCTGCCACCCTGACGCTGTACTTGGCGCGGAAAGAGGGTGGCCCGTGGTTGGCGGATGACCACCATGTGAAGAATTTTTTGCAAGGTGGCATCAACACTGAGTACGAGGAGATGCGTCCGTCGTGGCATCTCGACGAAGACTACTTTGGAGCGGACTTTCAGCCTGGACGCAAAGAGATTCACGTGCTGGTGCAAGTGCCGGAAGTGCTGGAAACTGCGGTAGCCAATAAGAAGCAGCGCCTGGAGTGGCGGTCGACCCGATGGGGATCACACGCTTATGACCCGAACTCACAATACTTCCTGCTGGAGAAAGAGGATGTGGACGAGTCCGGACTTCCACCCGTTCGCTTGATGCTCTACTGCAGACCCGCATTCCACCGCCAATTCGAGTTCTTGCGCGATGAAGTGTTGAACGAAGGTCATTTGGGCTGGATTCTCGGCCCACCTGGAACGGGAAAGTCAACCACAGCCATGGCTTTCGCGTCGACTCTGGACAGAAGTGAATGGATCGTGACGTGGATCCACGTGGGGAAATTCATGTCTTGGCGATGCGTGCGCCTCATCGGCGAAGACCGGAGAAGTCGAATTCTTGATATCTCGGACGTGGATGAAGTGTTGATGGTTGACGATACGAGGCATCACGTAGTGCTCGTTGACGGGTGGACTGCTGCAGACGAGTTTATTGAGCTGACACGCAAGTGCGTCGAATGGTTCCTTGTCGGTACAAAGGTGAAGCGGCGGCTCGCATTTGTTTGTTCAGTTGCTGCTCGTGGGAAGTTCCAAGAAGACATGGAGATTCTGACTCGTGCAAGAGAGTTCCGCGTGTGGTCATGGACTCTGGATGAGTACCTCAATGCGATCAAGGATGACGAGGTGTTCCAGAGTGTCTCGCAATGTCTGGATGCCCCTGCAGTGTTGCCGGACGAAGAGATGTCTCGCGCGGCAATGGTTGAGTCCAAGTATTACTACGCAGGTGGTTCCTGTCGTTATATGTTTCACTTCCGCACTGTGACCGTGGCGACGAAGTTGAGTGATGCCGTGGATTCATTAAACGATGCCGCAATTGTTGCCACGAGTGGTCAGCGTTCATCTTCAAGCATCAACCGTCTGTTTGGGATGTTCCAGCGACCTCACGACGTGGGTGCGGTGTCGCCTGTGATCAGTCAGTATGCTGCGACGCTGATTGCCATCAGATGCGGTCCAGAGGCTATCAAGAAGTTCATATCGACGCATCGAGACAATTCAAACCCAGCATTGGATGGATGGATGTTGGAGATGGTGTTCTTCGCAAGTCTTCGAAACGGCGGTCTCGCTCTCGTCGATGCGGCAGGGAACACAGTTGACACGTGGGGTCAATCAGTTGTTGTGATCGCGGATGGAATACCTGCGCTTTCTTCTGCTCACCCCGTTTGGATCAAGCCAGAAAAATGGAACCAAGGCGGATATGACGCTATTATGGTGTGCAAGCGTACTCAGCACGTGCGTTTGGTGCAAGTGACGAGTGCCCACAAGCATTCTTTCCGCATCGATTATTTTTACGGATGGCTGAAGATGCTGTCGGAGTCGCCCGAAAGTTTTGAGGTGAAGACAATGGAGATTGTCTTCGTTGTCGAGCAAGACAAGCTGAGCACGTTCGACTTCTCGACTGTGAAGGGAGCCGGACTTCTCCGACCGTTTGGTTGGTCGAAGGGCAAGGAGACGGACTTAGTACGGCTGGTAGGGATTCGTGGGTTATATAATCTATCACCATAA

CRN12 protein

MVFSVEVERNADVEALQEAIFVKKRYKERYTFDASALTLYLAKKDGAWLKHDHTVKAFLQGDIDTEYEEMLSTWKLNKEELFGDFQLGGEEIHVLVELPERQSADPQLIELQESLLQHILMDAPTSTSVRSNHFKKKLCATYNCDMGSGQLRCMLLDTALPSELVIASHLFRRKNEFISEKFMGFSDIDDVRNGLLLFKPLEHALDHFQISFIYDPSSNEFRLKIFDRSMRKQRLLGKLDKTQRAILLQGQVLPKNWRSRGRRLAPGTNYDLQTTFGDLEGRTLCFRGIERPYKRCLNLQARLARKQAIKKQWIEPEEDDFQDFWSEGMSLAEKMEFYYANET*

CRN13 protein

MVFSVEVERNADVEALQEAIFVKKRYKERYTFDASALTLYLAKKDGAWLKHDHTVKAFLQGDIDTEYEEMLSTWKLNKEELFGDFQLGGEEIHVLVELPERQSADPQLIELQESLLHHILMDAPTSTSVRSNHFKKKLCATYNCDMGNGQLRCMLLDTALPSELVIASHLFRRKNEFISEKFMGFSDIDDVRNGLLLFKPLEHAFDHFQISFIYDPSSNEFRLKIFDRSMRKQRLFGKLDKTQRAILLQGQVLPRNWRSRGRRLAPGTNYDLQTTFGDLEGRTLCFRGIERPYKRCLNLQARLARKQAIKKLWIEPEKDDFQDFWSEGMSLAEKMEFYYANET*

CRN20 protein

MFPVDIDESLTVGDLKEVIRGKKPRKITCDADELELYLAKRGDAWLTENEVRGISDTNGLKYLGAARAELDVVGLSEEDLRFEIDKHRVAAGYGPVNVLVVVPSNGTSMSVVGTNIEKFRTPLQFSTAEHEGGVPSTFRTYRSATVHAFFRLLFPPGGNFLPLIFVRAPPLSGKSAMFDLLYNHIVLSQPDALVARVSANFMPESTTFCQYFSSTYGCDFKAFCKLDYEKVVLIDEAQVTYDDDLLWLGYLKNTLEGKVHGLRFVLFSSYGSFDIYREDVRPGTPILVPPGNTFGLNAAPSKPGLQLTRVELDEMIHGSIGAAVGDLIWILCSGHIGIARAILRFLHGKFGSKKASIAPEDLEAELRSVRLLRYIRDSYRGIPTLDAFQRVIQGRQLADESKLKMSEVMSSVASGKIVLASDGERSPRSRLAVELLTRFGFLYEDYNKQLQFASNMHLKIWLHSNRSDPIGHMVSNISHDEFLVACITRMRSSQLQHFATGNTSNTLVARERQIQMELYNATTSCLPRDVLVTPEWRTSDEIGFVDLVIQGGDILWFWELLVNGDDAVSHSKRFKTGGKYYGSLTSHSRYVLIDFRQNKGVREQKLGFLYVSFVDSYSKAKIFGLHRDEITVELS*

CRN23 protein

MVFPVRIARDARVSALQKAIFDEKRYRERYTFDASALTLYLARKKEGDESKWLTDDDNLDAILGGDVDKQFVKMRSLWILSEDYLGANFQPGRKEIHVLVELPEGAAGEKSEMAQMMKEMYEHIVHPVQTKRKYVHSEMNSSKGIALLKDLNIRVKDADSVPFSTEDPTPVEPFTWESVCNEHGQLIVLTEEQQRERYRRYVEDNIGDVLAEKRLCVLGVEKGKNILTADVPGHDIELAGRTDMLILRDVTKQFPDHLEMLDEVKMLIEVKRNVKGGSVFQALSELIALDVLVDDPVMALLTDLTGRWQFFWVSEKSDNHVIIRTVIISDPSAAFAVIRTLLAQSPNGDADITLPCFGEPVKRRKLAQLLPSIGEGGESGGIREAIERYYDIASVLGPDIDMARSVAHQLVRTIPTFSYYT*

CRN19 protein

MGVYGEGSVFSVEIQRNADVEALQKKIASTYRVVSNRVEVYPATLTLYLARKEGGPWLADDHHVKNFLQGGINTEYEEMRPSWHLDEDYFGADFQPGRKEIHVLVQVPEVLETAVANKKQRLEWRSTRWGSHAYDPNSQYFLLEKEDVDESGLPPVRLMLYCRPAFHRQFEFLRDEVLNEGHLGWILGPPGTGKSTTAMAFASTLDRSEWIVTWIHVGKFMSWRCVRLIGEDRRSRILDISDVDEVLMVDDTRHHVVLVDGWTAADEFIELTRKCVEWFLVGTKVKRRLAFVCSVAARGKFQEDMEILTRAREFRVWSWTLDEYLNAIKDDEVFQSVSQCLDAPAVLPDEEMSRAAMVESKYYYAGGSCRYMFHFRTVTVATKLSDAVDSLNDAAIVATSGQRSSSSINRLFGMFQRPHDVGAVSPVISQYAATLIAIRCGPEAIKKFISTHRDNSNPALDGWMLEMVFFASLRNGGLALVDAAGNTVDTWGQSVVVIADGIPALSSAHPVWIKPEKWNQGGYDAIMVCKRTQHVRLVQVTSAHKHSFRIDYFYGWLKMLSESPESFEVKTMEIVFVVEQDKLSTFDFSTVKGAGLLRPFGWSKGKETDLVRLVGIRGLYNLSP*

Sequence listing

<110> Nanjing agricultural university

<120> Use of CRN-type effector protein gene for inducing plant resistance

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1032

<212> DNA

<213> Pythium oligandrum (Pythium oligandrum)

<400> 1

atggtgttct ccgtcgaggt tgagagaaac gcagacgtgg aagcgctgca ggaggctatc 60

tttgtcaaga agcgatacaa agagcgctat acattcgatg caagcgcatt gacgctgtac 120

ttggcgaaga aggacggcgc atggctcaag catgatcaca ctgtgaaggc gttcttgcaa 180

ggtgacatcg acactgagta cgaggagatg ctttcgacgt ggaagctcaa taaggaggag 240

ttgtttgggg acttccagct cggaggagaa gagattcacg tgctggtgga gctcccagag 300

cgccagtctg ctgatcctca gctgatcgag cttcaggaat cacttttgca gcatatcctg 360

atggatgctc caacttcgac gtccgtgcga agcaatcatt tcaagaagaa gctgtgtgca 420

acgtacaatt gcgacatggg aagtggccag ttgcgctgta tgctactgga cacagctctt 480

ccgtcggagt tggtgattgc gtctcatttg tttcgccgaa aaaacgaatt tatctctgag 540

aagtttatgg gattctcgga tatcgacgac gtgagaaacg gtttgctgct tttcaagccg 600

ctggagcatg cgctcgacca tttccagatc agctttattt acgacccaag cagcaacgag 660

tttcgtttga agattttcga ccgatccatg agaaaacagc gattgcttgg aaaattagac 720

aaaacgcagc gtgcgatact tcttcaaggt caggtgttgc cgaaaaactg gagatcgcga 780

ggtcgaagac ttgcacccgg gacaaactat gacctccaga cgacttttgg tgatcttgaa 840

ggtcggacac tttgctttcg gggtatcgag cgtccgtaca agcgttgttt gaacttgcag 900

gcccgattag cccgaaaaca agcaatcaag aaacagtgga tcgagccaga ggaagatgac 960

tttcaagact tttggtccga aggcatgtcg ttggcagaga agatggagtt ttactacgcg 1020

aacgaaacct ga 1032

<210> 2

<211> 1032

<212> DNA

<213> Pythium gracile (Pythium periplocum)

<400> 2

atggtgttct ccgtcgaggt tgagagaaac gcagacgtgg aagcgctgca ggaggctatc 60

tttgtcaaga agcgatacaa agagcgctat acattcgacg caagcgcatt gacgctgtac 120

ttggcgaaga aggacggcgc atggctcaag catgatcaca ctgtgaaggc gttcttgcaa 180

ggtgacatcg acactgagta cgaggagatg ctttcgacgt ggaagctcaa taaggaggag 240

ttgtttgggg acttccagct cggaggagaa gagattcacg tgctggtgga gctcccagag 300

cgccagtctg ctgatcctca gctgatcgag cttcaggaat cacttttgca tcatatcttg 360

atggatgctc caacttcgac gtccgtgcga agcaatcatt tcaagaagaa gctgtgtgca 420

acgtacaatt gcgacatggg aaatggccag ttgcgctgta tgctactgga cacagctctt 480

ccgtcggagt tggtgattgc gtctcatttg tttcgccgaa aaaacgaatt tatctctgag 540

aagtttatgg gattctcgga catcgacgat gtgagaaacg gtttgctgct tttcaagccg 600

ctggagcatg cgttcgacca tttccagatc agctttattt acgacccaag cagcaacgag 660

tttcgtttga agattttcga cagatccatg agaaaacagc gattgtttgg aaaattagac 720

aaaacgcagc gtgcgatact tcttcaaggt caggtgttgc cgagaaactg gagatcgcga 780

ggtcgaagac ttgcacccgg gacaaactat gacctccaga cgacttttgg tgatcttgaa 840

ggtcggacgc tttgctttcg gggtatcgag cgtccgtaca agcgttgttt gaacttgcag 900

gcccgactag cccgaaaaca agcaatcaag aaactgtgga tcgagccaga gaaagatgac 960

tttcaagact tttggtccga aggcatgtcg ttggcagaga agatggagtt ttactacgcg 1020

aacgaaacct aa 1032

<210> 3

<211> 1908

<212> DNA

<213> Pythium oligandrum (Pythium oligandrum)

<400> 3

atgtttcctg tggacattga tgagagtctg acggttgggg acttgaagga agtgatccgg 60

gggaagaagc cgcgcaagat cacgtgcgat gccgatgagt tggagttgta cttggccaag 120

aggggcgacg cgtggctgac agaaaacgag gtcagaggga taagtgacac caatggcctc 180

aagtatctgg gtgctgcgcg agcggaactc gacgtagttg gcctttcgga ggaagatctg 240

cgattcgaaa tcgacaaaca ccgagttgca gcaggatatg gccctgtaaa tgtgttggtg 300

gtggtcccgt caaatggaac gagcatgtct gtggtgggga cgaacattga aaagttcagg 360

actccacttc agttctccac tgcggaacac gaaggtggcg ttccttcaac attcaggacc 420

tatcgatcag ccactgttca cgcatttttc aggctgctgt ttcctccggg cgggaacttt 480

ctcccattaa tattcgtccg tgcaccaccg ttatccggaa agtctgccat gttcgaccta 540

ctctacaatc acattgtgct ctcccagccg gatgcgcttg ttgcgcgggt gtctgcgaat 600

tttatgcctg agtcgaccac attctgtcaa tacttcagct caacctatgg ctgcgatttt 660

aaagcattct gcaagctcga ctacgagaaa gtggtattga ttgatgaggc tcaagtgacg 720

tacgatgatg atctactttg gctgggttac ctgaagaata cgttggaggg gaaagtccac 780

ggcctacgat ttgttctctt ctcgtcatac ggcagttttg acatttaccg ggaggatgta 840

cgtcctggga ctcctattct cgtcccgccg ggaaatactt ttggattgaa tgcggcgcca 900

tcgaagcctg gcttgcaact cacgcgcgta gaactggacg aaatgattca cggaagcatc 960

ggagcagcgg tgggtgatct catttggatt ctgtgctctg gacatatcgg gattgctcga 1020

gcaatactca ggtttttgca tggcaagttt ggatcaaaga aagcatccat tgctcctgaa 1080

gatctggaag cagaacttcg ttcagtccgc ttgctacgat acatccgcga cagttatcgt 1140

ggcataccga cgcttgatgc ttttcagcga gtgatccagg gtcggcaatt ggctgacgag 1200

tcgaagttga agatgagtga agtgatgagt agtgttgctt cgggcaagat tgtgcttgca 1260

tctgatgggg agcgatctcc tagaagtcgt cttgcagtgg aattacttac ccgattcggt 1320

ttcctctacg aggattacaa caagcaactc cagttcgcat cgaatatgca tctgaagatt 1380

tggctgcatt caaatcgatc ggatccaatc ggacatatgg tctccaacat ctcgcatgac 1440

gaattcttgg ttgcttgtat aacgagaatg cgtagttcgc aacttcagca ttttgcgact 1500

ggaaacacca gcaacacgtt ggttgctcga gagcgccaaa tccaaatgga gctgtacaac 1560

gccaccactt catgtttacc gcgggacgtg ctagttactc cagaatggcg cacgagtgat 1620

gagataggct tcgttgacct ggttattcaa ggcggagata tcctctggtt ctgggagctg 1680

cttgtgaatg gagacgatgc tgttagccat tcgaagcgat tcaaaacagg tggcaagtac 1740

tatggaagcc ttacgagcca ttctcgatac gtactcattg acttccgtca gaacaaaggc 1800

gttcgagagc agaagcttgg ttttttgtac gtgtcctttg tggattctta ctctaaggcg 1860

aagatctttg ggcttcatag ggacgagatc actgtggagt tatcgtga 1908

<210> 4

<211> 1266

<212> DNA

<213> Pythium gracile (Pythium periplocum)

<400> 4

atggtgttcc ccgtgaggat cgcacgtgat gctagagtga gcgcactgca gaaggctatc 60

tttgacgaga aacgatacag agagcgctac acctttgacg caagcgcatt gacgctgtac 120

ttggcgcgga agaaggaagg tgacgaaagc aagtggctga cggatgacga caatttggat 180

gctatcttgg gaggagatgt cgacaagcag ttcgtgaaaa tgcgatcgtt gtggattctc 240

agcgaagatt accttggcgc gaattttcag cctgggcgca aagagatcca cgtgctggtg 300

gaactcccag aaggtgcggc cggtgagaaa tcggaaatgg cacaaatgat gaaggaaatg 360

tacgagcata ttgtgcatcc tgtgcagact aagcgcaaat acgtccattc cgagatgaac 420

tcaagcaagg gaatcgcgct tctgaaagac ctgaatattc gagtgaagga cgcggactcg 480

gttccattct ctactgaaga tccaactccg gttgaaccat tcacatggga aagtgtttgt 540

aatgaacatg gccaactcat tgtgcttacc gaggagcagc aacgagaacg atatcgtaga 600

tacgtggaag acaacattgg cgatgtgctc gcggagaaga ggctttgcgt gctcggtgtg 660

gaaaaaggca agaatattct cactgctgac gtccctggtc acgacattga acttgctgga 720

cggacggata tgctcatact gagggatgtc acaaagcagt tcccggacca tttggagatg 780

ttggatgaag tgaagatgct tatcgaagtg aagaggaacg taaaaggagg ctctgttttc 840

caggcgttgt cggaactgat tgcgctagat gttcttgtcg atgacccagt gatggcactg 900

ctgaccgact tgactggccg ttggcagttc ttctgggtct ccgagaagag cgacaaccat 960

gtcatcatcc gaacagtgat tatatctgat ccaagcgcgg cgtttgccgt gatcaggacg 1020

ctacttgcac agtcgccaaa tggtgatgca gatatcacac ttccatgttt tggagaaccc 1080

gtgaaacgac gcaagttggc tcaattgctg ccgtctattg gtgaaggagg tgaaagcggc 1140

ggcatacgtg aggctatcga acggtactat gatatcgcaa gcgtgctggg tcccgacatt 1200

gacatggcac gttctgtggc tcaccaactt gtccgaacga ttcccacgtt cagctattac 1260

acgtaa 1266

<210> 5

<211> 1875

<212> DNA

<213> Pythium gracile (Pythium periplocum)

<400> 5

atgggtgtgt acggcgaagg gagtgtcttc tcggtcgaga tccagcgcaa tgcagatgtg 60

gaggcgctgc agaagaagat cgcaagtaca tacagagtcg tgagcaaccg cgttgaggtt 120

taccctgcca ccctgacgct gtacttggcg cggaaagagg gtggcccgtg gttggcggat 180

gaccaccatg tgaagaattt tttgcaaggt ggcatcaaca ctgagtacga ggagatgcgt 240

ccgtcgtggc atctcgacga agactacttt ggagcggact ttcagcctgg acgcaaagag 300

attcacgtgc tggtgcaagt gccggaagtg ctggaaactg cggtagccaa taagaagcag 360

cgcctggagt ggcggtcgac ccgatgggga tcacacgctt atgacccgaa ctcacaatac 420

ttcctgctgg agaaagagga tgtggacgag tccggacttc cacccgttcg cttgatgctc 480

tactgcagac ccgcattcca ccgccaattc gagttcttgc gcgatgaagt gttgaacgaa 540

ggtcatttgg gctggattct cggcccacct ggaacgggaa agtcaaccac agccatggct 600

ttcgcgtcga ctctggacag aagtgaatgg atcgtgacgt ggatccacgt ggggaaattc 660

atgtcttggc gatgcgtgcg cctcatcggc gaagaccgga gaagtcgaat tcttgatatc 720

tcggacgtgg atgaagtgtt gatggttgac gatacgaggc atcacgtagt gctcgttgac 780

gggtggactg ctgcagacga gtttattgag ctgacacgca agtgcgtcga atggttcctt 840

gtcggtacaa aggtgaagcg gcggctcgca tttgtttgtt cagttgctgc tcgtgggaag 900

ttccaagaag acatggagat tctgactcgt gcaagagagt tccgcgtgtg gtcatggact 960

ctggatgagt acctcaatgc gatcaaggat gacgaggtgt tccagagtgt ctcgcaatgt 1020

ctggatgccc ctgcagtgtt gccggacgaa gagatgtctc gcgcggcaat ggttgagtcc 1080

aagtattact acgcaggtgg ttcctgtcgt tatatgtttc acttccgcac tgtgaccgtg 1140

gcgacgaagt tgagtgatgc cgtggattca ttaaacgatg ccgcaattgt tgccacgagt 1200

ggtcagcgtt catcttcaag catcaaccgt ctgtttggga tgttccagcg acctcacgac 1260

gtgggtgcgg tgtcgcctgt gatcagtcag tatgctgcga cgctgattgc catcagatgc 1320

ggtccagagg ctatcaagaa gttcatatcg acgcatcgag acaattcaaa cccagcattg 1380

gatggatgga tgttggagat ggtgttcttc gcaagtcttc gaaacggcgg tctcgctctc 1440

gtcgatgcgg cagggaacac agttgacacg tggggtcaat cagttgttgt gatcgcggat 1500

ggaatacctg cgctttcttc tgctcacccc gtttggatca agccagaaaa atggaaccaa 1560

ggcggatatg acgctattat ggtgtgcaag cgtactcagc acgtgcgttt ggtgcaagtg 1620

acgagtgccc acaagcattc tttccgcatc gattattttt acggatggct gaagatgctg 1680

tcggagtcgc ccgaaagttt tgaggtgaag acaatggaga ttgtcttcgt tgtcgagcaa 1740

gacaagctga gcacgttcga cttctcgact gtgaagggag ccggacttct ccgaccgttt 1800

ggttggtcga agggcaagga gacggactta gtacggctgg tagggattcg tgggttatat 1860

aatctatcac cataa 1875

<210> 6

<211> 343

<212> PRT

<213> Pythium oligandrum (Pythium oligandrum)

<400> 6

Met Val Phe Ser Val Glu Val Glu Arg Asn Ala Asp Val Glu Ala Leu

1 5 10 15

Gln Glu Ala Ile Phe Val Lys Lys Arg Tyr Lys Glu Arg Tyr Thr Phe

20 25 30

Asp Ala Ser Ala Leu Thr Leu Tyr Leu Ala Lys Lys Asp Gly Ala Trp

35 40 45

Leu Lys His Asp His Thr Val Lys Ala Phe Leu Gln Gly Asp Ile Asp

50 55 60

Thr Glu Tyr Glu Glu Met Leu Ser Thr Trp Lys Leu Asn Lys Glu Glu

65 70 75 80

Leu Phe Gly Asp Phe Gln Leu Gly Gly Glu Glu Ile His Val Leu Val

85 90 95

Glu Leu Pro Glu Arg Gln Ser Ala Asp Pro Gln Leu Ile Glu Leu Gln

100 105 110

Glu Ser Leu Leu Gln His Ile Leu Met Asp Ala Pro Thr Ser Thr Ser

115 120 125

Val Arg Ser Asn His Phe Lys Lys Lys Leu Cys Ala Thr Tyr Asn Cys

130 135 140

Asp Met Gly Ser Gly Gln Leu Arg Cys Met Leu Leu Asp Thr Ala Leu

145 150 155 160

Pro Ser Glu Leu Val Ile Ala Ser His Leu Phe Arg Arg Lys Asn Glu

165 170 175

Phe Ile Ser Glu Lys Phe Met Gly Phe Ser Asp Ile Asp Asp Val Arg

180 185 190

Asn Gly Leu Leu Leu Phe Lys Pro Leu Glu His Ala Leu Asp His Phe

195 200 205

Gln Ile Ser Phe Ile Tyr Asp Pro Ser Ser Asn Glu Phe Arg Leu Lys

210 215 220

Ile Phe Asp Arg Ser Met Arg Lys Gln Arg Leu Leu Gly Lys Leu Asp

225 230 235 240

Lys Thr Gln Arg Ala Ile Leu Leu Gln Gly Gln Val Leu Pro Lys Asn

245 250 255

Trp Arg Ser Arg Gly Arg Arg Leu Ala Pro Gly Thr Asn Tyr Asp Leu

260 265 270

Gln Thr Thr Phe Gly Asp Leu Glu Gly Arg Thr Leu Cys Phe Arg Gly

275 280 285

Ile Glu Arg Pro Tyr Lys Arg Cys Leu Asn Leu Gln Ala Arg Leu Ala

290 295 300

Arg Lys Gln Ala Ile Lys Lys Gln Trp Ile Glu Pro Glu Glu Asp Asp

305 310 315 320

Phe Gln Asp Phe Trp Ser Glu Gly Met Ser Leu Ala Glu Lys Met Glu

325 330 335

Phe Tyr Tyr Ala Asn Glu Thr

340

<210> 7

<211> 343

<212> PRT

<213> Pythium gracile (Pythium periplocum)

<400> 7

Met Val Phe Ser Val Glu Val Glu Arg Asn Ala Asp Val Glu Ala Leu

1 5 10 15

Gln Glu Ala Ile Phe Val Lys Lys Arg Tyr Lys Glu Arg Tyr Thr Phe

20 25 30

Asp Ala Ser Ala Leu Thr Leu Tyr Leu Ala Lys Lys Asp Gly Ala Trp

35 40 45

Leu Lys His Asp His Thr Val Lys Ala Phe Leu Gln Gly Asp Ile Asp

50 55 60

Thr Glu Tyr Glu Glu Met Leu Ser Thr Trp Lys Leu Asn Lys Glu Glu

65 70 75 80

Leu Phe Gly Asp Phe Gln Leu Gly Gly Glu Glu Ile His Val Leu Val

85 90 95

Glu Leu Pro Glu Arg Gln Ser Ala Asp Pro Gln Leu Ile Glu Leu Gln

100 105 110

Glu Ser Leu Leu His His Ile Leu Met Asp Ala Pro Thr Ser Thr Ser

115 120 125

Val Arg Ser Asn His Phe Lys Lys Lys Leu Cys Ala Thr Tyr Asn Cys

130 135 140

Asp Met Gly Asn Gly Gln Leu Arg Cys Met Leu Leu Asp Thr Ala Leu

145 150 155 160

Pro Ser Glu Leu Val Ile Ala Ser His Leu Phe Arg Arg Lys Asn Glu

165 170 175

Phe Ile Ser Glu Lys Phe Met Gly Phe Ser Asp Ile Asp Asp Val Arg

180 185 190

Asn Gly Leu Leu Leu Phe Lys Pro Leu Glu His Ala Phe Asp His Phe

195 200 205

Gln Ile Ser Phe Ile Tyr Asp Pro Ser Ser Asn Glu Phe Arg Leu Lys

210 215 220

Ile Phe Asp Arg Ser Met Arg Lys Gln Arg Leu Phe Gly Lys Leu Asp

225 230 235 240

Lys Thr Gln Arg Ala Ile Leu Leu Gln Gly Gln Val Leu Pro Arg Asn

245 250 255

Trp Arg Ser Arg Gly Arg Arg Leu Ala Pro Gly Thr Asn Tyr Asp Leu

260 265 270

Gln Thr Thr Phe Gly Asp Leu Glu Gly Arg Thr Leu Cys Phe Arg Gly

275 280 285

Ile Glu Arg Pro Tyr Lys Arg Cys Leu Asn Leu Gln Ala Arg Leu Ala

290 295 300

Arg Lys Gln Ala Ile Lys Lys Leu Trp Ile Glu Pro Glu Lys Asp Asp

305 310 315 320

Phe Gln Asp Phe Trp Ser Glu Gly Met Ser Leu Ala Glu Lys Met Glu

325 330 335

Phe Tyr Tyr Ala Asn Glu Thr

340

<210> 8

<211> 635

<212> PRT

<213> Pythium oligandrum (Pythium oligandrum)

<400> 8

Met Phe Pro Val Asp Ile Asp Glu Ser Leu Thr Val Gly Asp Leu Lys

1 5 10 15

Glu Val Ile Arg Gly Lys Lys Pro Arg Lys Ile Thr Cys Asp Ala Asp

20 25 30

Glu Leu Glu Leu Tyr Leu Ala Lys Arg Gly Asp Ala Trp Leu Thr Glu

35 40 45

Asn Glu Val Arg Gly Ile Ser Asp Thr Asn Gly Leu Lys Tyr Leu Gly

50 55 60

Ala Ala Arg Ala Glu Leu Asp Val Val Gly Leu Ser Glu Glu Asp Leu

65 70 75 80

Arg Phe Glu Ile Asp Lys His Arg Val Ala Ala Gly Tyr Gly Pro Val

85 90 95

Asn Val Leu Val Val Val Pro Ser Asn Gly Thr Ser Met Ser Val Val

100 105 110

Gly Thr Asn Ile Glu Lys Phe Arg Thr Pro Leu Gln Phe Ser Thr Ala

115 120 125

Glu His Glu Gly Gly Val Pro Ser Thr Phe Arg Thr Tyr Arg Ser Ala

130 135 140

Thr Val His Ala Phe Phe Arg Leu Leu Phe Pro Pro Gly Gly Asn Phe

145 150 155 160

Leu Pro Leu Ile Phe Val Arg Ala Pro Pro Leu Ser Gly Lys Ser Ala

165 170 175

Met Phe Asp Leu Leu Tyr Asn His Ile Val Leu Ser Gln Pro Asp Ala

180 185 190

Leu Val Ala Arg Val Ser Ala Asn Phe Met Pro Glu Ser Thr Thr Phe

195 200 205

Cys Gln Tyr Phe Ser Ser Thr Tyr Gly Cys Asp Phe Lys Ala Phe Cys

210 215 220

Lys Leu Asp Tyr Glu Lys Val Val Leu Ile Asp Glu Ala Gln Val Thr

225 230 235 240

Tyr Asp Asp Asp Leu Leu Trp Leu Gly Tyr Leu Lys Asn Thr Leu Glu

245 250 255

Gly Lys Val His Gly Leu Arg Phe Val Leu Phe Ser Ser Tyr Gly Ser

260 265 270

Phe Asp Ile Tyr Arg Glu Asp Val Arg Pro Gly Thr Pro Ile Leu Val

275 280 285

Pro Pro Gly Asn Thr Phe Gly Leu Asn Ala Ala Pro Ser Lys Pro Gly

290 295 300

Leu Gln Leu Thr Arg Val Glu Leu Asp Glu Met Ile His Gly Ser Ile

305 310 315 320

Gly Ala Ala Val Gly Asp Leu Ile Trp Ile Leu Cys Ser Gly His Ile

325 330 335

Gly Ile Ala Arg Ala Ile Leu Arg Phe Leu His Gly Lys Phe Gly Ser

340 345 350

Lys Lys Ala Ser Ile Ala Pro Glu Asp Leu Glu Ala Glu Leu Arg Ser

355 360 365

Val Arg Leu Leu Arg Tyr Ile Arg Asp Ser Tyr Arg Gly Ile Pro Thr

370 375 380

Leu Asp Ala Phe Gln Arg Val Ile Gln Gly Arg Gln Leu Ala Asp Glu

385 390 395 400

Ser Lys Leu Lys Met Ser Glu Val Met Ser Ser Val Ala Ser Gly Lys

405 410 415

Ile Val Leu Ala Ser Asp Gly Glu Arg Ser Pro Arg Ser Arg Leu Ala

420 425 430

Val Glu Leu Leu Thr Arg Phe Gly Phe Leu Tyr Glu Asp Tyr Asn Lys

435 440 445

Gln Leu Gln Phe Ala Ser Asn Met His Leu Lys Ile Trp Leu His Ser

450 455 460

Asn Arg Ser Asp Pro Ile Gly His Met Val Ser Asn Ile Ser His Asp

465 470 475 480

Glu Phe Leu Val Ala Cys Ile Thr Arg Met Arg Ser Ser Gln Leu Gln

485 490 495

His Phe Ala Thr Gly Asn Thr Ser Asn Thr Leu Val Ala Arg Glu Arg

500 505 510

Gln Ile Gln Met Glu Leu Tyr Asn Ala Thr Thr Ser Cys Leu Pro Arg

515 520 525

Asp Val Leu Val Thr Pro Glu Trp Arg Thr Ser Asp Glu Ile Gly Phe

530 535 540

Val Asp Leu Val Ile Gln Gly Gly Asp Ile Leu Trp Phe Trp Glu Leu

545 550 555 560

Leu Val Asn Gly Asp Asp Ala Val Ser His Ser Lys Arg Phe Lys Thr

565 570 575

Gly Gly Lys Tyr Tyr Gly Ser Leu Thr Ser His Ser Arg Tyr Val Leu

580 585 590

Ile Asp Phe Arg Gln Asn Lys Gly Val Arg Glu Gln Lys Leu Gly Phe

595 600 605

Leu Tyr Val Ser Phe Val Asp Ser Tyr Ser Lys Ala Lys Ile Phe Gly

610 615 620

Leu His Arg Asp Glu Ile Thr Val Glu Leu Ser

625 630 635

<210> 9

<211> 421

<212> PRT

<213> Pythium gracile (Pythium periplocum)

<400> 9

Met Val Phe Pro Val Arg Ile Ala Arg Asp Ala Arg Val Ser Ala Leu

1 5 10 15

Gln Lys Ala Ile Phe Asp Glu Lys Arg Tyr Arg Glu Arg Tyr Thr Phe

20 25 30

Asp Ala Ser Ala Leu Thr Leu Tyr Leu Ala Arg Lys Lys Glu Gly Asp

35 40 45

Glu Ser Lys Trp Leu Thr Asp Asp Asp Asn Leu Asp Ala Ile Leu Gly

50 55 60

Gly Asp Val Asp Lys Gln Phe Val Lys Met Arg Ser Leu Trp Ile Leu

65 70 75 80

Ser Glu Asp Tyr Leu Gly Ala Asn Phe Gln Pro Gly Arg Lys Glu Ile

85 90 95

His Val Leu Val Glu Leu Pro Glu Gly Ala Ala Gly Glu Lys Ser Glu

100 105 110

Met Ala Gln Met Met Lys Glu Met Tyr Glu His Ile Val His Pro Val

115 120 125

Gln Thr Lys Arg Lys Tyr Val His Ser Glu Met Asn Ser Ser Lys Gly

130 135 140

Ile Ala Leu Leu Lys Asp Leu Asn Ile Arg Val Lys Asp Ala Asp Ser

145 150 155 160

Val Pro Phe Ser Thr Glu Asp Pro Thr Pro Val Glu Pro Phe Thr Trp

165 170 175

Glu Ser Val Cys Asn Glu His Gly Gln Leu Ile Val Leu Thr Glu Glu

180 185 190

Gln Gln Arg Glu Arg Tyr Arg Arg Tyr Val Glu Asp Asn Ile Gly Asp

195 200 205

Val Leu Ala Glu Lys Arg Leu Cys Val Leu Gly Val Glu Lys Gly Lys

210 215 220

Asn Ile Leu Thr Ala Asp Val Pro Gly His Asp Ile Glu Leu Ala Gly

225 230 235 240

Arg Thr Asp Met Leu Ile Leu Arg Asp Val Thr Lys Gln Phe Pro Asp

245 250 255

His Leu Glu Met Leu Asp Glu Val Lys Met Leu Ile Glu Val Lys Arg

260 265 270

Asn Val Lys Gly Gly Ser Val Phe Gln Ala Leu Ser Glu Leu Ile Ala

275 280 285

Leu Asp Val Leu Val Asp Asp Pro Val Met Ala Leu Leu Thr Asp Leu

290 295 300

Thr Gly Arg Trp Gln Phe Phe Trp Val Ser Glu Lys Ser Asp Asn His

305 310 315 320

Val Ile Ile Arg Thr Val Ile Ile Ser Asp Pro Ser Ala Ala Phe Ala

325 330 335

Val Ile Arg Thr Leu Leu Ala Gln Ser Pro Asn Gly Asp Ala Asp Ile

340 345 350

Thr Leu Pro Cys Phe Gly Glu Pro Val Lys Arg Arg Lys Leu Ala Gln

355 360 365

Leu Leu Pro Ser Ile Gly Glu Gly Gly Glu Ser Gly Gly Ile Arg Glu

370 375 380

Ala Ile Glu Arg Tyr Tyr Asp Ile Ala Ser Val Leu Gly Pro Asp Ile

385 390 395 400

Asp Met Ala Arg Ser Val Ala His Gln Leu Val Arg Thr Ile Pro Thr

405 410 415

Phe Ser Tyr Tyr Thr

420

<210> 10

<211> 624

<212> PRT

<213> Pythium gracile (Pythium periplocum)

<400> 10

Met Gly Val Tyr Gly Glu Gly Ser Val Phe Ser Val Glu Ile Gln Arg

1 5 10 15

Asn Ala Asp Val Glu Ala Leu Gln Lys Lys Ile Ala Ser Thr Tyr Arg

20 25 30

Val Val Ser Asn Arg Val Glu Val Tyr Pro Ala Thr Leu Thr Leu Tyr

35 40 45

Leu Ala Arg Lys Glu Gly Gly Pro Trp Leu Ala Asp Asp His His Val

50 55 60

Lys Asn Phe Leu Gln Gly Gly Ile Asn Thr Glu Tyr Glu Glu Met Arg

65 70 75 80

Pro Ser Trp His Leu Asp Glu Asp Tyr Phe Gly Ala Asp Phe Gln Pro

85 90 95

Gly Arg Lys Glu Ile His Val Leu Val Gln Val Pro Glu Val Leu Glu

100 105 110

Thr Ala Val Ala Asn Lys Lys Gln Arg Leu Glu Trp Arg Ser Thr Arg

115 120 125

Trp Gly Ser His Ala Tyr Asp Pro Asn Ser Gln Tyr Phe Leu Leu Glu

130 135 140

Lys Glu Asp Val Asp Glu Ser Gly Leu Pro Pro Val Arg Leu Met Leu

145 150 155 160

Tyr Cys Arg Pro Ala Phe His Arg Gln Phe Glu Phe Leu Arg Asp Glu

165 170 175

Val Leu Asn Glu Gly His Leu Gly Trp Ile Leu Gly Pro Pro Gly Thr

180 185 190

Gly Lys Ser Thr Thr Ala Met Ala Phe Ala Ser Thr Leu Asp Arg Ser

195 200 205

Glu Trp Ile Val Thr Trp Ile His Val Gly Lys Phe Met Ser Trp Arg

210 215 220

Cys Val Arg Leu Ile Gly Glu Asp Arg Arg Ser Arg Ile Leu Asp Ile

225 230 235 240

Ser Asp Val Asp Glu Val Leu Met Val Asp Asp Thr Arg His His Val

245 250 255

Val Leu Val Asp Gly Trp Thr Ala Ala Asp Glu Phe Ile Glu Leu Thr

260 265 270

Arg Lys Cys Val Glu Trp Phe Leu Val Gly Thr Lys Val Lys Arg Arg

275 280 285

Leu Ala Phe Val Cys Ser Val Ala Ala Arg Gly Lys Phe Gln Glu Asp

290 295 300

Met Glu Ile Leu Thr Arg Ala Arg Glu Phe Arg Val Trp Ser Trp Thr

305 310 315 320

Leu Asp Glu Tyr Leu Asn Ala Ile Lys Asp Asp Glu Val Phe Gln Ser

325 330 335

Val Ser Gln Cys Leu Asp Ala Pro Ala Val Leu Pro Asp Glu Glu Met

340 345 350

Ser Arg Ala Ala Met Val Glu Ser Lys Tyr Tyr Tyr Ala Gly Gly Ser

355 360 365

Cys Arg Tyr Met Phe His Phe Arg Thr Val Thr Val Ala Thr Lys Leu

370 375 380

Ser Asp Ala Val Asp Ser Leu Asn Asp Ala Ala Ile Val Ala Thr Ser

385 390 395 400

Gly Gln Arg Ser Ser Ser Ser Ile Asn Arg Leu Phe Gly Met Phe Gln

405 410 415

Arg Pro His Asp Val Gly Ala Val Ser Pro Val Ile Ser Gln Tyr Ala

420 425 430

Ala Thr Leu Ile Ala Ile Arg Cys Gly Pro Glu Ala Ile Lys Lys Phe

435 440 445

Ile Ser Thr His Arg Asp Asn Ser Asn Pro Ala Leu Asp Gly Trp Met

450 455 460

Leu Glu Met Val Phe Phe Ala Ser Leu Arg Asn Gly Gly Leu Ala Leu

465 470 475 480

Val Asp Ala Ala Gly Asn Thr Val Asp Thr Trp Gly Gln Ser Val Val

485 490 495

Val Ile Ala Asp Gly Ile Pro Ala Leu Ser Ser Ala His Pro Val Trp

500 505 510

Ile Lys Pro Glu Lys Trp Asn Gln Gly Gly Tyr Asp Ala Ile Met Val

515 520 525

Cys Lys Arg Thr Gln His Val Arg Leu Val Gln Val Thr Ser Ala His

530 535 540

Lys His Ser Phe Arg Ile Asp Tyr Phe Tyr Gly Trp Leu Lys Met Leu

545 550 555 560

Ser Glu Ser Pro Glu Ser Phe Glu Val Lys Thr Met Glu Ile Val Phe

565 570 575

Val Val Glu Gln Asp Lys Leu Ser Thr Phe Asp Phe Ser Thr Val Lys

580 585 590

Gly Ala Gly Leu Leu Arg Pro Phe Gly Trp Ser Lys Gly Lys Glu Thr

595 600 605

Asp Leu Val Arg Leu Val Gly Ile Arg Gly Leu Tyr Asn Leu Ser Pro

610 615 620

Claims (5)

1. Application of CRN effector protein gene with nucleotide sequence shown in SEQ ID NO. 1, CRN effector protein with amino acid sequence shown in SEQ ID NO. 6 or expression cassette, recombinant expression vector or transgenic recombinant bacteria containing CRN effector protein gene with nucleotide sequence shown in SEQ ID NO. 1 in improving resistance of tobacco to phytophthora capsici.

2. Application of CRN effector protein gene with nucleotide sequence shown in SEQ ID NO. 1, CRN effector protein with amino acid sequence shown in SEQ ID NO. 6 or expression cassette containing CRN effector protein gene with nucleotide sequence shown in SEQ ID NO. 1, recombinant expression vector or transgenic recombinant bacteria in preparing plant immunity inducer for improving tobacco resistance to phytophthora capsici.

3. The application of CRN effector protein gene with nucleotide sequence shown as SEQ ID NO. 1 in culturing new tobacco variety with raised phytophthora capsici resistance.

4. A method for inducing the resistance of tobacco to phytophthora capsici is characterized in that a CRN effector protein gene with a nucleotide sequence shown as SEQ ID NO. 1 or an expression box, a recombinant expression vector or a transgenic recombinant bacterium containing the CRN effector protein gene with the nucleotide sequence shown as SEQ ID NO. 1 is introduced into plants to improve the resistance of tobacco to phytophthora capsici.

5. A method for cultivating tobacco varieties with improved resistance to phytophthora capsici is characterized in that CRN effector protein genes with nucleotide sequences shown as SEQ ID NO. 1 or expression cassettes, recombinant expression vectors or transgenic recombinant bacteria containing the CRN effector protein genes with the nucleotide sequences shown as SEQ ID NO. 1 are introduced into plants, and positive transformed plants are obtained through resistance screening, so that phytophthora capsici-resistant tobacco varieties are obtained.