CN109762833B - Leymus mutabilis phenylalanine ammonia lyase gene and application thereof - Google Patents

Abstract

The invention discloses a nucleic acid sequence of a gene of a changeful aegilops phelen alanine ammonia lyase and application thereof, wherein the nucleic acid sequence of the changeful aegilops phelen phenylalanine ammonia lyase gene is shown as SEQ ID NO. 1. The gene of the mutable aegilops tauschii phenylalanine ammonia lyase codes the phenylalanine ammonia lyase, has high resistance to the heterodera avenae wollenweber, and has important reference and application values for breeding the wheat to resist the heterodera avenae wollenweber.

Description

Leymus mutabilis phenylalanine ammonia lyase gene and application thereof

Technical Field

The invention relates to the field of phenylalanine ammonia lyase, in particular to a nucleic acid sequence of a lance asiabell root phenylalanine ammonia lyase and application thereof.

Background

PAL (Phenylalanine Ammonia-Lyase) is the first enzyme in the Phenylalanine metabolic pathway and is also a key enzyme, catalyzing the conversion of L-Phenylalanine to trans-cinnamic acid. Trans-cinnamic acid is respectively converted into secondary metabolites such as anthocyanin, lignin, flavonoids, phytoalexin and the like through different downstream metabolic branches, and some substances are reported to play a role in plant disease resistance.

PALs in plants are isotype proteins encoded by a multigene family, which have their own expression characteristics and also function in the same way. PAL was first discovered and isolated and purified from barley seedlings by Conn and Koukol in 1961, and since then, the research on PAL was gradually developed, and with the improvement of the technology of isolation and purification methods, PAL proteins such as wheat, soybean, poplar, etc. have been successfully isolated and purified from other plants.

The expression and biological activity of PAL will change with the development change of organism and the stimulation of external environment. Salt stress activates the expression of the Lotus corniculatus PAL gene and leads to accumulation of phenolics. In tobacco, PAL expression is significantly up-regulated under the treatment conditions of NaCl, mannitol, low temperature, etc. When cucumber seedlings are treated at low temperature, the PAL enzyme activity is improved, the synthesis of phenylpropanoid compounds and the removal of peroxides caused by low temperature by intracellular antioxidase are promoted. In addition, PAL plays an important role in plant immune responses. After the tomato is infected by the potato cyst nematode, PAL gene expression in the tomato resistant variety is obviously up-regulated, and the tomato susceptible variety has no obvious change. After wheat is infected by gibberellic disease, the PAL gene expression and PAL enzyme are greatly increased. CapAL1 was induced when pepper leaves were infected with Xcv (Xanthomonas campestris pv. Vesicatoria). The CaPAL1 silenced pepper plants, which are susceptible to infection by virulent or non-virulent Xcv. While the CaPAL1 gene was overexpressed in Arabidopsis, the overexpressed plants showed resistance to Pseudomonas syringae pv. tomato and Hyaloperonospora arabidopsis. The soybean GmPAL2.1 gene is obviously up-regulated by the induction of Phytophthora sojae, and the resistance of soybean plants transformed with the GmPAL2.1 gene to Phytophthora sojae is obviously improved. PAL enzyme activity is obviously improved in transgenic soybean plants, activity is lower in GmPAL2.1 silent plants, and detection shows that in soybean plants over-expressing GmPAL2.1, the contents of daidzein (daidzein), wood flavone (genistein) and SA (salicylic acid) are obviously increased, and the increase of the substances and the GmPAL2.1 gene play a positive role in participating in soybean regulation and control on Phytophthora sojae resistance. Although the biological functions of PAL are continuously studied and reported, to date, it has not been reported whether PAL genes are involved in plant responses against heterodera avenae.

Aegilops variabilis (Aegilops variabilis) is a closely related species of wheat, has the characteristics of drought resistance, stripe rust resistance, insect resistance and the like, can generate fertile offspring when being subjected to distant hybridization with the wheat, and is an excellent resource for genetic improvement of the wheat. Aegilops variabilis has high resistance to heterodera gramineara (h.avenae, cereal cystnematodes, CCN) and meloidogyne incognita (meloidogynnaasi).

Disclosure of Invention

In order to solve the technical problems, the invention provides the aegilops variabilis phenylalanine ammonia-lyase gene and the application thereof, after gene silencing, resistance identification finds that the reduction of the expression of PAL gene can cause the number of root heterodera avenae wollen to be obviously increased; constructing a binary expression vector, and overexpressing the gene in wheat, wherein resistance identification results show that the resistance of PAL overexpressed wheat to heterodera avenae wollenweber is obviously improved; and the yield reduction caused by the heterodera avenae wollenweber is reduced under the condition of not influencing the vegetative growth of plants.

The invention discloses a gene of a changeful aegilops elengi phenylalanine ammonia lyase, which solves the technical problems and is characterized in that: the nucleic acid sequence of the aegilops variabilis phenylalanine ammonia lyase gene is shown in SEQ ID NO. 1.

The gene of the aegilops variabilis phenylalanine ammonia lyase (AeVPAL) is cloned for the first time, the nucleic acid sequence has uniqueness, the sequence has a phenylalanine lyase structural domain, and the gene is not homologous or similar to other aegilops variabilis insect-resistant genes.

The application of the aegilops variabilis phenylalanine ammonia-lyase gene is the application in wheat breeding or resistance to cereal cyst nematodes.

The amino acid sequence of the aegilops variabilis phenylalanine ammonia lyase is shown as SEQ ID NO. 2.

The amplification primer sequence of the full-length coding sequence of the AeVPAL:

PAL-1：ATGGCCACTAATGGCAACGAC；PAL-2：TTAGCAGATAGGCAGGGGCTC；

AeVPAL VIGS fragment amplification primer sequence:

OHL087:CTAGCTAGCTAGACAACGTGGAAACCTCGGT；

OHL088:CTAGCTAGCTAGAGTAAACTGTGCCCAGCTC。

the AeVPAL nucleic acid sequence of the invention has the full length of 2124bp, the sequence codes 707 amino acids and the protein 76.3 kDa.

The invention designs a primer based on the coding sequence of PAL in closely related species (barley, wheat and arthroncus wheat), and performs homologous cloning by taking cDNA of a No.1 material of the aegilops variabilis as a template to obtain a full-length sequence. Designing a gene silencing primer, connecting a silencing fragment into a VIGS (Virus-induced gene silencing) vector, and after gene silencing, carrying out resistance identification to discover that the reduction of the expression of PAL genes can cause the number of root heterodera avenae nematodes to be remarkably increased; a binary expression vector is constructed, the gene is over-expressed in wheat, and the resistance identification result shows that the resistance of the AeVPAL over-expressed wheat to the heterodera avenae wollenweber is obviously improved.

The gene of the easy-to-change aegilops tauschii phenylalanine ammonia lyase codes a phenylalanine ammonia lyase, has high ability of resisting the heterodera avenae wollenweber, and has important reference values for wheat breeding and improving the ability of resisting the heterodera avenae wollenweber of wheat.

Drawings

FIG. 1 is a graph showing the staining conditions and statistical results of root infection of heterodera avenae wollenweber in AeVPAL silent plants

(wherein, in the figure, A is a diagram of the situation of the cereal cyst nematode infected by the root of a control plant, B is a diagram of the situation of the cereal cyst nematode infected by the root of an AeVPAL silent plant, C is a diagram that the expression level of the AeVPAL in the root of the AeVPAL silent plant is obviously lower than that of the control plant, and D is a diagram that the number of CCN infected by the root of the AeVPAL silent plant is obviously higher than that of the control plant)

FIG. 2A VPAL overexpression of wheat root infected with Heterodera avenae number comparison

(wherein, in the figure, A is the electrophoresis result of the specific primer amplification of the transgenic wheat lines 15, 18 and the control wheat genome AeVPAL, B is a comparison graph of the expression quantity of the AeVPAL in the transgenic wheat lines 15, 18 and the control wheat, and C is a statistical comparison graph of the number of the root-infected cereal cyst nematodes in the transgenic wheat lines 15, 18 and the control wheat)

Detailed Description

The invention will be further illustrated with reference to specific embodiments:

wherein, the materials and reagents used are as follows:

plant material: aegilops variabilis No.1 (from laboratories of institute of Oncorhynchs of Chinese academy of sciences), Fielder wheat (gifted by crops of the farm academy of Shandong province).

The primer sequences used are shown in Table 1 below.

TABLE 1

Reagent: the total RNA extraction Trizol kit is purchased from TIANGEN company; DNA Marker, pEASY-T1 cloning Kit, pEASY-Blunt E1Expression Kit, QPCR mix are all products of the whole formula gold company; KOD Hi-Fi enzyme and reverse transcription kit are all products of TOYOBO company. In vitro RNA synthesis kits were purchased from Promega corporation. A direct PCR kit for plant leaves is Foregene company. The acid fuchsin is a Chinese medicine product. Restriction enzymes were purchased from NEB.

Example 1

The method comprises the following steps of (1) PAL full-length coding sequence amplification of the aegilops variabilis, total RNA extraction of plants and reverse transcription:

(1) soaking seeds of aegilops variabilis No.1 in water, placing in a refrigerator at 4 ℃ for 2 days, uniformly paving the seeds on continuously wetted filter paper, placing in a culture dish with the diameter of 5cm, and germinating at the room temperature of about 24 ℃ and in the illumination period environment of 16h/8 h.

(2) Scissoring the seedling roots 20 days after the seeds are planted, grinding in liquid nitrogen, and extracting the total RNA according to the Trizol reagent scheme.

(3) cDNA reverse transcription synthesis by referring to TOYOBO reverse transcription reagent method

Amplification of the full-length coding sequence and silent fragment of the aegilops variabilis PAL:

and respectively amplifying the AeVPAL full-length coding sequence and the AeVPAL gene silencing fragment by using two pairs of different primers by using the reverse transcription product cDNA as a template, wherein a 1799-1990 section of the AeVPAL full-length sequence is amplified to silence the AeVPAL gene so as to reduce the expression level of the AeVPAL gene. Wherein the AeVPAL full-length coding sequence amplification primer sequence:

PAL-1：ATGGCCACTAATGGCAACGAC；PAL-2：TTAGCAGATAGGCAGGGGCTC。

AeVPAL gene silencing fragment amplification primer sequence:

OHL087:CTAGCTAGCTAGACAACGTGGAAACCTCGGT；

OHL088:CTAGCTAGCTAGAGTAAACTGTGCCCAGCTC。

the amplification reaction system is as follows:

PCR amplification program conditions are 94 ℃ for 2 min; 10s at 98 ℃, 30s at 55-62 ℃, 1min/kb at 68 ℃ and 38 cycles; finally, extension is carried out for 10min at 68 ℃.

Example 2

AeVPAL VIGS vector construction and VIGS (virus-induced gene silencing) vaccination:

(1) the BSMV-alpha, BSMV-beta and BSMV-gamma GFP plasmids are placed in a refrigerator at the temperature of-20 ℃ for later use.

(BSMV-alpha, BSMV-beta and BSMV-gamma: GFP plasmids are from the institute of genetic development of Chinese academy.)

(2) Enzyme digestion of target fragment and BSMV vector:

and (3) cutting a target fragment (a silent fragment with a cutting site) by enzyme, wherein the cutting site is an NheI site.

GFP plasmid:

the operation steps are as follows: after 5 hours of digestion at 37 ℃, the product was recovered by running the gel. The recovery step is the operation step in the agarose gel electrophoresis kit instruction. The enzyme digestion is a single enzyme digestion, which is the same as below. The digestion cuts the plasmid, linearizes it for subsequent ligation.

The recovery steps may be as follows:

the product was electrophoresed on a 1.5% agarose gel, and the band of interest was excised against a DNA Marker and transferred to a 2mL clean centrifuge tube. Add 600. mu.L of gel per 100mg of gel to recover Binding Buffer, and place in water bath at 60 ℃ for 15 minutes, shake and mix once every 2-3 minutes. The thawed gel was transferred to a recovery column and the recovery column was placed in a collection tube and centrifuged at 10,000rpm for 1 minute at room temperature. The recovery column was removed, the solution in the collection tube was decanted, the recovery column was replaced in the collection tube, 700. mu.L of Wash solution was added, centrifuged at 10,000rpm for 1 minute at room temperature, and the Wash was repeated once more. Putting the recovery column into another clean 1.5mL centrifuge tube, adding 30-50 μ L of precipitation Buffer on the recovery column membrane, standing for 2 minutes at room temperature, and centrifuging for 1 minute at 10,000 rpm.

(3) And (3) connecting a target fragment (a silencing fragment recovered by NheI enzyme digestion) with a BSMV vector:

connecting the silencing fragment recovered by NheI enzyme digestion with a BSMV-gamma: GFP vector (BSMV silencing vector) recovered by NheI enzyme digestion, wherein the reaction system is as follows:

the operation steps are that after standing for 2-3 hours in a metal bath at the temperature of 16 ℃, the ligation product is used for converting escherichia coli, and plasmid extraction is carried out after positive cloning is selected.

E, E.coli transformation: transfer 5. mu.L of ligation reaction solution into 200. mu.L of E.coli competent cells, mix well, avoid shaking, and place on ice for 30 minutes. Competent cells were heat shocked in a 42 ℃ water bath for 90 seconds, ice-bathed for 5 minutes, then 1mL of LB broth preheated at 37 ℃ was quickly added, and the centrifuge tube was horizontally placed on a 37 ℃ shaker and slowly shaken for 45 minutes. Centrifugation was carried out at 4,000rpm for 5 minutes at room temperature, leaving about 100. mu.L of supernatant, the cells were resuspended with a sterile pipette tip, and the bacterial suspension was smeared onto LB solid plates containing Ampr (100. mu.g/mL). In order to allow the bacterial solution to be sufficiently absorbed, the plate was placed for about 1 minute, covered, inverted, incubated at 37 ℃ and colony growth was observed after 12 to 16 hours.

Plasmid extraction: extraction was performed according to the instructions of the Tiangen plasmid extraction kit.

(4) Carrying out linear digestion and recovery on BSMV (B-cell-associated virus) plasmids:

BSMV-alpha or BSMV-gamma (plasmid containing silencing fragment, i.e. after integration of AeVPAL silencing fragment with BSMV-gamma) 8. mu.L (500. mu.g/mL)

Mlu I 1μL

10×buffer 3μL

ddH ₂ O 18μL

The temperature is 37 ℃, and the time is 8 hours;

the enzyme was cleaved at 37 ℃ for 8 hours.

And finally, recovering the virus vector after the linearized enzyme digestion:

the method comprises the following steps of: chloroform: isoamyl alcohol (25: 24: 1) was extracted 1 time, an equal volume of isopropyl alcohol was added, the mixture was left at-20 ℃ for 1 hour, centrifuged at 4 ℃ for 10 minutes at 12,000g, the supernatant was carefully poured off, the precipitate was washed with 70% ethanol 1 time at 6,000 rpm, instantaneously centrifuged at room temperature, left until the ethanol was volatilized, and then RNase free water 30-50. mu.L was added to dissolve the precipitate, which was then stored at-20 ℃.

(5) Production and inoculation of total RNA of BSMV virus:

BSMV virus was produced using a Promega Ribomax RNA bulk kit (20. mu.L system).

The amplification temperature is 37 ℃, and the amplification time is 3 h.

Mixing of virus staining solution: the raw materials are mixed according to the following system.

Wherein, the formula of 2 XGKP buffer is as follows:

50mM glycine, 30mM dipotassium phosphate, pH9.2, 1% bentonite, 1% celite.

Selecting highland barley seedlings with basically consistent growth states, inoculating the virus staining solution to the base parts of heart leaves by using rubber gloves, inoculating 8 mu L of each seedling, slightly pinching the base parts of leaves by using the rubber gloves during inoculation to cause fine wounds to be beneficial to virus invasion, spraying a small amount of sterile water to the seedlings by using a sprayer to keep humidity after inoculation is finished, and sealing the inoculated seedlings by using a plastic film for 3 days.

The virus linearized plasmid alpha, beta, gamma-silent fragment has a single electrophoretic band.

Example 3

Construction of a binary vector of a Leymus mutabilis PAL gene No.1 and genetic transformation of wheat:

(1) construction of the AeVPAL overexpression vector:

the full-length coding sequence of AeVPAL was ligated into pLGY02 vector by crossover reaction and Agrobacterium EA105 was transformed and positive Agrobacterium was selected for subsequent transformation. The exchange reaction is carried out according to the instruction of an easy Geno rapid recombinant cloning kit of Tiangen company. The pLGY02 vector was derived from the farm institute of Oncorhynchus, Shandong province.

(2) Genetic transformation of wheat:

preparing agrobacterium suspension, namely shaking bacteria one day before the test, and culturing at 160r and 28 ℃; after the wheat spike is prepared, starting to prepare an agrobacterium tumefaciens suspension; 1ml of the bacterial solution was put into a 1.5ml centrifuge tube, and 1.4. mu.L of acetosyringone (0.1M) was added and mixed.

Infection: taking wheat ears pollinated for about 15 days, taking grains, and stripping embryos; adding prepared bacterial solution, infecting for 5min, placing on co-culture medium (MS culture medium, institute of agricultural and scientific institute of Shandong province), and dark culturing at 23 deg.C for 3 days.

And (3) rest: after co-culture, placing on a rest culture medium (MS culture medium) for dark culture for 5 days at 25 ℃;

screening 1: transferring the callus to screening medium 1(MS medium); the petri dish was sealed with a sealing film and incubated in the dark at 25.5 ℃ for 2 weeks.

Screening 2: transferring the cut callus to a screening culture medium 2(MS culture medium); the petri dish was sealed with a sealing film and incubated in the dark at 25.5 ℃ for 2 weeks.

Regeneration 1: after 2 weeks of callus cutting and screening, transferring the callus with resistance to a regeneration medium (MS medium);

the resistant calli generally have green buds or dots, or have beautiful beige globular structures. Pasty and brown callus did not transfer. The proliferated calli can be cut into smaller calli again. The patches from the same callus (one line) should be rewound onto the same line. Note the direction of the calli, e.g., green bud and green dot up. The dishes were sealed and placed in an incubator at 25 ℃ for 2 weeks with light (16 h).

And (3) regeneration 2: after 2 weeks of regeneration, healthy growing plantlets were transferred to new resistant regeneration pods. When the seedlings grow to a certain size, sampling detection can be carried out.

(3) Identification and pure line screening of transformed wheat plants:

screening and identifying the transgenic wheat by adopting a direct PCR method of plant leaves. Two pure lines, namely Line15 and Line18 transgenic positive pure Line wheat, are obtained through single plant seed collection and progeny identification.

The plant leaf direct PCR method uses a plant leaf direct PCR kit of the company foregene. The method comprises the following operation steps: cut 3-5mg leaf tissue (5-7 mm diameter) into 200. mu.l or 1.5ml centrifuge tubes. Add 50. mu.l Buffer P1 to ensure that the lysate completely submerges the leaf tissue. The centrifuge tube cap is covered, and the tube is placed in a PCR instrument or a metal bath and is cracked for 10min at 95 ℃. Add 50. mu.l Buffer P2 and mix by pipetting or vortexing. The obtained lysis mixture can be stored at 4 ℃ (within 5 days) or directly used as a template for PCR reaction. Preparing a lysate template, a specific primer and an amplification reaction mixed solution according to an instruction, and carrying out PCR amplification. 10. mu.l of the resulting PCR product was run through agarose gel electrophoresis and photographed.

Example 4

Identification of resistance to CCN (wheat cyst nematode):

simultaneously sowing and culturing the obtained pure Line transgenic wheat (Line15 and Line18 transgenic positive pure Line wheat) and non-transgenic wheat (control group), respectively transferring the seedlings into sterile soil when the seedlings grow to 2-leaf stage, inoculating 300 CCN J2/pot at fixed points at the root after 1 day, and covering soil in a 19 ℃ incubator for culture after inoculation. After 3 days of nematode inoculation, the roots of all the plants were washed, stained with acid fuchsin, and the number of stained CCN was counted and compared under an optical microscope.

And (3) dyeing process:

acid fuchsin stock solution: dissolving 3.5g of acid fuchsin in into 250ml of glacial acetic acid, fixing the volume of distilled water to 1L after the acid fuchsin is dissolved, and adding 1ml of the distilled water into 30-50ml of the distilled water for reuse.

Acid glycerol solution: 2-3 drops of 5M HCl are added dropwise to 20-30ml of pure glycerol.

Adding 50ml of distilled water and 10ml of 5.25% NaClO solution (final concentration is 1%) into a beaker, respectively putting the cleaned wheat roots into the beaker, wherein the NaClO solution is required to completely immerse the root tissues, slightly stirring the root tissues by using a glass rod, taking out the root tissues after 5min, slightly washing the root tissues by using running water for 1min, and then soaking the roots in the distilled water for 15 min.

Adding 1ml of acid fuchsin liquid storage into another beaker containing 30-50ml of distilled water, boiling in a microwave oven, respectively putting the prepared root tissues into the boiled fuchsin solution, then putting the beaker into the microwave oven, boiling for 30s with medium and high fire, slightly cooling, slightly rinsing the root tissues with running water, putting the beaker into a beaker containing acid glycerol solution, putting the beaker into boiling water, boiling for 30s to fade the roots, and soaking the boiled root tissues in glycerol for observation.

And (4) analyzing results:

silencing of the AeVPAL gene by VIGS results in a significant increase in the number of CCNs infected at the root.

Adopting a BSMV viral vector (AeVPAL VIGS vector) to silence an AeVPAL gene at the root of a Leymus variabilis No.1 (Ae. variabilis No.1) plant, and repeatedly smearing a glove on the base part of a second leaf to cause a wound so as to allow viruses to enter.

Selecting No.1 seedlings of aegilops variabilis in two-leaf one-heart period, inoculating BSMV virus for two weeks, selecting plants with leaves having BSMV infection phenotype, detecting the expression quantity of the root tissues AeVPAL of the No.1 aegilops variabilis (plants with BSMV infection phenotype) and a control plant (infected with virus without PAL silent segments) by using fluorescent quantitative PCR (polymerase chain reaction) with the AeVEF gene (electrophoresis factor-1) as an internal reference gene.

The fluorescent quantitative result shows that compared with the control group of plants, the expression of the AeVPAL gene is obviously reduced at the roots of the AeVPAL1-silenced plants, and the expression quantity is reduced by nearly 60%.

And (3) inoculating CCN J2 larvae on roots of the AeVPAL-silenced plants at fixed points, carrying out acid fuchsin staining on the roots of the plants after 3 days of inoculation, and observing and counting under an optical microscope.

Statistical analysis showed that the number of infected CCNs at the roots of AeVPAL1-silenced plants was significantly greater than the number of infected CCNs at the roots of control plants; the number of root-infested CCNs in the AeVPAL1-silenced plants was increased by more than 40% compared to the control. The above results indicate that silencing of the AeVPAL gene results in a reduction in the resistance of the plant to CCN, and that AeVPAL plays a positive regulatory role in the anti-CCN response of Ae. As in fig. 1.

The number of CCNs infected at AeVPAL overexpressing transgenic wheat roots is significantly reduced:

the AeVPAL gene is transferred into a wheat variety Fielder, and then specific primers (OHL129 and OHL604) are used for detecting and screening the transgenic plants. Propagated to T3 generations, and 2 AeVPAL transgenic wheat pure lines Line15 and Line18 have been screened. The Line15 and Line18 transgenic positive pure Line wheat and a control plant (non-transgenic plant) are germinated and planted together, when the wheat grows to 2-leaf stage, CCN J2 larvae are inoculated to the root of the plant at fixed points, after 3 days of inoculation, acid fuchsin is taken out for staining, and the number of the nematodes in the root tissue of the wheat is photographed by a microscope and counted.

The statistical analysis result shows that the root CCN nematode infection number of the plants of the AeVPAL transgenic pure Line wheat Line15 and Line18 is obviously lower than that of the plants of a control group. The results show that the AeVPAL transgenic wheat is significantly more resistant to CCN than the control wheat. As shown in fig. 2, AeVPAL transgenic wheat has high resistance to CCN, and is very effective and stable.

While the foregoing shows and describes the fundamental principles and principal features of the invention, together with the advantages thereof, the foregoing embodiments and description are illustrative only of the principles of the invention, and various changes and modifications can be made therein without departing from the spirit and scope of the invention, which will fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> institute of biological research of Cheng Council

<120> Leymus mutabilis phenylalanine ammonia lyase gene and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2124

<212> DNA

<213> Aegilops variabilis

<400> 1

atggccacta atggcaacga cggtttgtgc gtggccaagc cgcggagtgc tgacccgctc 60

aactggggga aggcggcgga ggagctgtcg gggagccatc ttgacgccgt caagcggatg 120

gtggaggagt accgcaggcc ggtggtagtt atggagggcg ccagcttgac catcgcccag 180

gtcgcggcgg tggccgccgc cgacggggcc agggtggagc tcgacgagtc cgcccgcggc 240

cgcgtcaagg agagcagcga ttgggtcatg agcagcatgg cgaatgggac tgacagctac 300

ggcgtcacca ccggcttcgg cgccacctcc catcggagga ccaaggaggg gggcgcgctg 360

cagagggagc tcatccggtt ccttaacgcc ggtgcgttcg gcaccggcag cgacggccac 420

gtgctgcccg cggccaccac gcgtgcggcg atgctcgtcc gcgtcaacac cctgctccaa 480

gggtactctg gcatccgctt tgagatcctc gagaccatcg ccacgctgct caacgccaac 540

gtgacaccat gcctgccgct ccgaggcact atcaccgctt ccggtgatct tgtcccgctc 600

tcctacatcg ccggacttgt caccggccgc ccaaatgccg tcgctgttgc tcctgatggc 660

acaaaagtta atgctgccga ggcatttaag atcgccggta tccaacacgg cttcttcgag 720

ctacagccca aggaaggcct tgctatggtt aatggaacgg cggtgggctc cgggctcgcg 780

tccattgttc tctttgaagc gaacatcctt ggtgtccttg ctgaagtttt atcagccgta 840

ttctgcgaag tgatgaacgg caagccagag tacaccgacc acctaacaca taagttgaag 900

caccaccccg gacagatcga ggctgcggcc atcatggagc acatcctaga ggggagctcc 960

tacatgatgc ttgcgaagaa acttggtgag ctcgacccat tgatgaagcc aaagcaagac 1020

agatatgctc tccgcacgtc accgcaatgg cttggtcctc aaattgaggt catccgtgca 1080

gcgacgaagt cgatcgagcg cgagatcaac tctgtcaatg acaacccact cattgacgta 1140

tctcgtggaa aggcaatcca tggtggcaac tttcaaggca cacccattgg cgtgtccatg 1200

gacaacacga ggcttgccat tgctgcgata ggcaagctca tgtttgccca gttctcagag 1260

ctagtgaacg acttctacaa caatggcttg ccctctaacc tctctggtgg tcgcaaccca 1320

agcctggact atggcttcaa gggtgctgag atcgccatgg cgtcatattg ctcggagctt 1380

caattcttgg gcaaccctgt gaccaaccat gtccagagcg cggagcaaca caaccaagac 1440

gttaactccc ttggattaat ctcgtcccgg aagaccgctg aggccattga cattctgaag 1500

ctcatgtcct ctacattttt ggttgcgctg tgccaagcca tcgacctgcg ccaccttgag 1560

gagaatgtca agaacgccgt caagaattgt gtcacaagag tggctaggaa gaccctgatc 1620

acaaatgaca tgggtggcct ccacaatgca cgtttctgtg agaaggacct gctccaaaca 1680

atcgaccgcg aggcggtgtt tgcatacgca gacgaccctt gcagcgccaa ctatcctctc 1740

atgaagaaga tgcgcgcggt gttggttgag catgccctgg ccaacggcga ggctgagcac 1800

aacgtggaaa cctcggtgtt tgccaaggtt gccaaattcg agcaggagct ctgtgcaaca 1860

ctacctcagg aggttgaggc tgctagaggt gcagtggaga atggcaccgc tgaagaacca 1920

aaccgtatcg tagactgccg gtcataccct ctataccggt tcgtgcgcga ggagctgggc 1980

acagtttact tgaccggaga gaagactcgg tcacctggcg aggaggtgga caaggtgttc 2040

gttgccatga accagggtaa gcacatcgat gctctgctgg agtgcctcca ggagtggaac 2100

ggcgagcccc tgcctatctg ctaa 2124

<210> 2

<211> 707

<212> PRT

<213> Aegilops variabilis

<400> 2

Met Ala Thr Asn Gly Asn Asp Gly Leu Cys Val Ala Lys Pro Arg Ser

1 5 10 15

Ala Asp Pro Leu Asn Trp Gly Lys Ala Ala Glu Glu Leu Ser Gly Ser

20 25 30

His Leu Asp Ala Val Lys Arg Met Val Glu Glu Tyr Arg Arg Pro Val

35 40 45

Val Val Met Glu Gly Ala Ser Leu Thr Ile Ala Gln Val Ala Ala Val

50 55 60

Ala Ala Ala Asp Gly Ala Arg Val Glu Leu Asp Glu Ser Ala Arg Gly

65 70 75 80

Arg Val Lys Glu Ser Ser Asp Trp Val Met Ser Ser Met Ala Asn Gly

85 90 95

Thr Asp Ser Tyr Gly Val Thr Thr Gly Phe Gly Ala Thr Ser His Arg

100 105 110

Arg Thr Lys Glu Gly Gly Ala Leu Gln Arg Glu Leu Ile Arg Phe Leu

115 120 125

Asn Ala Gly Ala Phe Gly Thr Gly Ser Asp Gly His Val Leu Pro Ala

130 135 140

Ala Thr Thr Arg Ala Ala Met Leu Val Arg Val Asn Thr Leu Leu Gln

145 150 155 160

Gly Tyr Ser Gly Ile Arg Phe Glu Ile Leu Glu Thr Ile Ala Thr Leu

165 170 175

Leu Asn Ala Asn Val Thr Pro Cys Leu Pro Leu Arg Gly Thr Ile Thr

180 185 190

Ala Ser Gly Asp Leu Val Pro Leu Ser Tyr Ile Ala Gly Leu Val Thr

195 200 205

Gly Arg Pro Asn Ala Val Ala Val Ala Pro Asp Gly Thr Lys Val Asn

210 215 220

Ala Ala Glu Ala Phe Lys Ile Ala Gly Ile Gln His Gly Phe Phe Glu

225 230 235 240

Leu Gln Pro Lys Glu Gly Leu Ala Met Val Asn Gly Thr Ala Val Gly

245 250 255

Ser Gly Leu Ala Ser Ile Val Leu Phe Glu Ala Asn Ile Leu Gly Val

260 265 270

Leu Ala Glu Val Leu Ser Ala Val Phe Cys Glu Val Met Asn Gly Lys

275 280 285

Pro Glu Tyr Thr Asp His Leu Thr His Lys Leu Lys His His Pro Gly

290 295 300

Gln Ile Glu Ala Ala Ala Ile Met Glu His Ile Leu Glu Gly Ser Ser

305 310 315 320

Tyr Met Met Leu Ala Lys Lys Leu Gly Glu Leu Asp Pro Leu Met Lys

325 330 335

Pro Lys Gln Asp Arg Tyr Ala Leu Arg Thr Ser Pro Gln Trp Leu Gly

340 345 350

Pro Gln Ile Glu Val Ile Arg Ala Ala Thr Lys Ser Ile Glu Arg Glu

355 360 365

Ile Asn Ser Val Asn Asp Asn Pro Leu Ile Asp Val Ser Arg Gly Lys

370 375 380

Ala Ile His Gly Gly Asn Phe Gln Gly Thr Pro Ile Gly Val Ser Met

385 390 395 400

Asp Asn Thr Arg Leu Ala Ile Ala Ala Ile Gly Lys Leu Met Phe Ala

405 410 415

Gln Phe Ser Glu Leu Val Asn Asp Phe Tyr Asn Asn Gly Leu Pro Ser

420 425 430

Asn Leu Ser Gly Gly Arg Asn Pro Ser Leu Asp Tyr Gly Phe Lys Gly

435 440 445

Ala Glu Ile Ala Met Ala Ser Tyr Cys Ser Glu Leu Gln Phe Leu Gly

450 455 460

Asn Pro Val Thr Asn His Val Gln Ser Ala Glu Gln His Asn Gln Asp

465 470 475 480

Val Asn Ser Leu Gly Leu Ile Ser Ser Arg Lys Thr Ala Glu Ala Ile

485 490 495

Asp Ile Leu Lys Leu Met Ser Ser Thr Phe Leu Val Ala Leu Cys Gln

500 505 510

Ala Ile Asp Leu Arg His Leu Glu Glu Asn Val Lys Asn Ala Val Lys

515 520 525

Asn Cys Val Thr Arg Val Ala Arg Lys Thr Leu Ile Thr Asn Asp Met

530 535 540

Gly Gly Leu His Asn Ala Arg Phe Cys Glu Lys Asp Leu Leu Gln Thr

545 550 555 560

Ile Asp Arg Glu Ala Val Phe Ala Tyr Ala Asp Asp Pro Cys Ser Ala

565 570 575

Asn Tyr Pro Leu Met Lys Lys Met Arg Ala Val Leu Val Glu His Ala

580 585 590

Leu Ala Asn Gly Glu Ala Glu His Asn Val Glu Thr Ser Val Phe Ala

595 600 605

Lys Val Ala Lys Phe Glu Gln Glu Leu Cys Ala Thr Leu Pro Gln Glu

610 615 620

Val Glu Ala Ala Arg Gly Ala Val Glu Asn Gly Thr Ala Glu Glu Pro

625 630 635 640

Asn Arg Ile Val Asp Cys Arg Ser Tyr Pro Leu Tyr Arg Phe Val Arg

645 650 655

Glu Glu Leu Gly Thr Val Tyr Leu Thr Gly Glu Lys Thr Arg Ser Pro

660 665 670

Gly Glu Glu Val Asp Lys Val Phe Val Ala Met Asn Gln Gly Lys His

675 680 685

Ile Asp Ala Leu Leu Glu Cys Leu Gln Glu Trp Asn Gly Glu Pro Leu

690 695 700

Pro Ile Cys

705

<210> 3

<211> 21

<212> DNA

<213> PAL-1

<400> 3

<210> 4

<211> 21

<212> DNA

<213> PAL-2

<400> 4

<210> 5

<211> 31

<212> DNA

<213> OHL087

<400> 5

<210> 6

<211> 31

<212> DNA

<213> OHL088

<400> 6

<210> 7

<211> 21

<212> DNA

<213> OHL135

<400> 7

<210> 8

<211> 24

<212> DNA

<213> OHL136

<400> 8

<210> 9

<211> 36

<212> DNA

<213> OHL099

<400> 9

tctagaggat ccccgatggc cactaatggc aacgac 36

<210> 10

<211> 36

<212> DNA

<213> OHL100

<400> 10

ttcgagctct ctagattagc agataggcag gggctc 36

<210> 11

<211> 22

<212> DNA

<213> OHL129

<400> 11

<210> 12

<211> 23

<212> DNA

<213> OHL604

<400> 12

actttatgct tccggctcgt atg 23

Claims (2)

1. The aegilops variabilis phenylalanine ammonia lyase gene is characterized in that: the nucleotide sequence of the aegilops variabilis phenylalanine ammonia lyase gene is shown as SEQ ID NO. 1;

the amplification primer sequence of the full-length coding sequence of the phenylalanine ammonia-lyase comprises the following steps:

PAL-1：ATGGCCACTAATGGCAACGAC；PAL-2：TTAGCAGATAGGCAGGGGCTC；

PAL VIGS fragment amplification primer sequence:

OHL087:CTAGCTAGCTAGACAACGTGGAAACCTCGGT；

OHL088:CTAGCTAGCTAGAGTAAACTGTGCCCAGCTC；

the amino acid sequence of the aegilops variabilis phenylalanine ammonia lyase is shown as SEQ ID NO. 2.

2. The use of the aegilops variabilis phenylalanine ammonia lyase gene according to claim 1, wherein: the gene is applied to breeding wheat resistant to heterodera avenae wollenweber.

Images