CN106047906B - A kind of gene and its application for improving disease resistance of plant - Google Patents

Abstract

The present invention discloses a kind of gene for improving disease resistance of plant and its application,The geneLeAct1A kind of gamatine transferase is encoded, the DNA sequence dna with the SEQ ID NO.1 in sequence table, or with the DNA sequence dna that can hybridize with SEQ ID NO.1 under high high stringency conditions, or the DNA sequence dna of coding and SEQ ID NO.1 same amino acid sequence in sequence table.The genetic transformation is imported into recipient plant genome, gamatine transferase is expressed, the disease resistance of recipient plant can be improved.Applied to agricultural biotechnologies breeding to improve crop disease-resistant character, and breeding cycle can be greatly shortened, improve breeding efficiency.

Description

A kind of gene and its application for improving disease resistance of plant

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of gene and its application for improving disease resistance of plant.

Background technique

Tomato yellow leaf curl (Tomato yellow leaf curl disease, TYLCD) is one in tomato production The destructive disease of kind extremely difficult prevention and treatment, the disease first discovery in one band of the Israel Jordan River, after in the outburst of large area all over the world, In recent years China harm get worse (Antignus&Cohen, 1994；Boulton, 2003；Gorgeous plum of state etc., 2009).The disease Caused by geminivirus infection, China especially with tomato yellow leaf curl virus (Tomato yellow leaf curl virus, TYLCV it) endangers most very (Li Jiawei etc., 2016).Lack TYLCV resistant gene in tomato cultivation germ plasm resource, identifies at present Resistant gene Ty-1-Ty-5 derives from Wild related germplasm.Wherein Ty-2 is significantly stronger than Ty-1/ to the inhibiting effect of virus replication Ty-3, while additive effect (Li Jiawei etc., 2016) also is not present between 3 genes.By molecular mark, can incite somebody to action Ty-1, Ty-2, Ty-3 and Ty-4 are applied to cultivate tomato disease-resistant variety, but this method breeding cycle is long, it usually needs 8- 10 years, and be difficult to take out Linkage drag during transformation, influence breeding efficiency.

The pathogen of verticillium wilt is verticillium dahliae (Verticillium dahliae Kleb), and the Microsclerotia of formation exists Survival is up to 10 years or more in soil；Its host range is extensive, can infect 660 various plants, including tomato, eggplant, potato, The Important Agriculturals such as cucumber, cotton, tobacco, capsicum industrial crops (Wilhelm et al, 1955；Fradin et al,2006；Slowly It is bright, 2015).The bacterium causes the control of disease to be great difficult problem in agricultural production.Such as cotton verticillium wilt is commonly called as cotton " cancer Disease " has a high risks to Cotton Production, annual underproduction 10-15%, be the first major disease of cotton (simple osmanthus is good etc., 2003； Fradin et al,2006；Zhang Baolong etc., 2012).Seriously regional disease incidence is up to 80% or more in China, and onset area reaches Ten thousand hectares of 222-266, up to more than 10 hundred million yuan of annual loss (simple osmanthus good etc., 2007).So far it there is no effectively preventing method.

Pathogen is secondary metabolism destructive, that plant is generated in vivo by long-term evolution utilization to the infringement of plant The invasion (Tian Wenzhong etc., 1998) of object defence pathogen.Hydroxycinnamic acid amides compound (HCAAs) is a kind of extremely important Plant Secondary Metabolites, participate in the development and degeneration-resistant process (Mary M.D.et al, 2015) of plant.Recently in arabidopsis In be isolated to HCAAs, mainly be made of p- coumaric acyl gamatine (CouAgm) and other HCAAs products, including Asafoetide acyl agmatine (FerAgm), p- tonka-bean putrescine (CouPtr) and asafoetide acyl putrescine (FerTre).Its action principle its contain Some alkaloids can inhibit the extension of hypha,hyphae and be gathered in plant cell wall formed nature barrier or increase leaves of plants Piece toughness (Mayama et al, 1981；Miyagawa et al.,2014；Schmidt et al.,1998；Ishihara A et al.,2008).It is reported that hydroxycinnamic acid amide polymer is the ingredient of suberin, suberin has strongly hydrophobic Property, it can effectively prevent moisture penetration (Bernards et al., 1995) into plant tissue.HCAAs is required by life institute Amine substance composition.Gamatine acyltransferase (ACT) is the enzyme for being catalyzed HCAAs biosynthesis final step, guanidine radicals fourth Amine acyltransferase (ACT) tends to using gamatine as acyl acceptor, using p- coumaric acyl-coacetylase as acry radical donor. ACT belongs to BAHD acyltransferase family, is positioned in cytosol.To arabidopsis gamatine acyltransferase (AtACT) It is studied on mutant, it is found that the mutant cannot accumulate HCAAs, and the infection (D'Auria vulnerable to black spot J.C.2006).It proves in arabidopsis body, HCAAs is the important substance for resisting pathogen invasion.The reports such as Muroi A will be intended The AtACT of southern mustard converts butterfly grass, and the HCAAs content in transformant is significantly increased and improved to gray mold resistance, but for 3 Kind herbivorous insect thrips (Frankliniella occidentalis), aphid (Aphis gossypii) and tetranychid (Tetranychus ludeni) does not have resistance (Muroi et al.2009).In addition to arabidopsis, for the ACT base of other plant Because and its functional study and have not been reported (Muroi A et al, 2012).

The present invention has found the gene of the gamatine transferase of tomato by the transcript profile of the anti-sense material of analysis tomato LeACT1 is raised after TYLCV infects in disease-resistant material, and the gene in susceptible material is lowered after infecting.The gene is carried out Sequence analysis has found that while that the code area of the gene does not have difference in anti-sense material, but their promoter region difference compared with Greatly, thus it is speculated that exactly this species diversity causes the gene in the anti-difference for feeling inducing expression mode in material.The anti-black spot of arabidopsis The resistance mechanism of action of (Alternaria brassicicola) gene C DK8 (CYCLIN-DEPENDENT KINASE8) is It can combine with the promoter of AtACT and activate its transcription, to increase the content (Zhu et al.2014) of HCAAs.Together When, by by the promoter of LeACT1 and each gene co-injection of TYLCV, it was demonstrated that the promoter can be lured by these genes It leads.In addition, the gene silencing vector of building LeACT1, respectively by the target gene silencing in anti-sense tomato material, and to silencing Plant is inoculated with TYLCV, and the virus quantity after 15d in silencing plant is 30 times of control, meanwhile, it is abnormal that distortion, shrinkage etc. occurs in blade Shape phenotype.The over-express vector and transformation of tobacco of LeACT1 are constructed, Resistance Identification analyzes the TYLCV the result shows that transgenic plant And resistance to verticillium wilt significantly improves.

Bibliography:

Miyagawa H.,Ishihara A.,Nishimoto T.,et al.,Induction of Avenanthramides in Oat Leaves Inoculated with Crown Rust Fungus,Puccinia coronate f.sp.avenae.Bioscience,Biotechnology and Biochemistry,2014.59(12): 2305-2306.

Schmidt A,Scheel D,Strack D.Elicitor-stimulated biosynthesis of hydroxycinn amoyltyramines in cell suspension cultures of Solanum tuberosum.Planta,1998,205(1):51-55.

Ishihara A.,Hashimoto Y.,Tanaka C.,et al.,The tryptophan pathway is involved in the defense responses of rice against pathogenic infection via serotonin production.Plant J,2008.54(3):481-95.

Bernards M A,Lopez M L,Zajicek J,et al.Hydroxycinnamic acid-derived polymers constitute the polyaromatic domain of suberin.Journal of Biological Chemistry,1995,270(13):7382-7386.

Antignus Y, Cohen S..Complete nucleotide sequence of an infectious clone of a mild isolate of Tomato yellow leaf curl virus(TYLCV) .Phytopathology, 1994,84 (7): 707-712.

Boulton M I.2003.Geminiviruses:Major threats to world Agriculture.Annals of Applied Biology, 142 (2): 143-143.

D'Auria J.C.Acyltransferases in plants:a good time to be BAHD.Curr Opin Plant Biol,2006.9(3):331-40.

Fradin EF,Thomma BP.Physiology and molecular aspects of Verticillium wilt diseases caused by V.dahliae and V.albo-atrum.Molecular Plant Pathology, 2006,7(2):71-86.

Macoy D.M.,Kim W.Y.,Lee S.Y.,Kim M.G.Biotic Stress Related Functions of Hydroxycinnamic Acid Amide in Plants.J.Plant Biol.,2015,58:156-163

Mayama S,Tani T,Matsuura Y,et al.The production of phytoalexins by oat in response to crown rust.Puccinia coronata f.sp.Avenae.Physiologial Plant Pathology,1981,19(2).

Muroi A.,Ishihara A.,Tanaka C.,et al.,Accumulation of hydroxycinnamic acid amides induced by pathogen infection and identification of agmatine coumaroyltransferase in Arabidopsis thaliana.Planta,2009.230(3):517-527.

Wilhelm,S.1955.Longevity of Verticillium wilt fungus in the laboratory and field.Phytopathology,45:180-181

Zhu Y,Schluttenhoffer CM,Wang P,Fu F,Thimmapuram J,Zhu JK,Lee SY,Yun DJ,Mengiste T.CYCLIN-DEPENDENT KINASE8differentially regulates plant immunity to fungal pathogens through kinase-dependent and-independent functions in Arabidopsis.Plant Cell, 2014 Oct；26(10):4149-70.

The gorgeous plum of state, Du Yongchen, Wang Xiaoxuan, the progress of Gao Jianchang .2009. tomato yellow leaf curl virus sick (TYLCV) Chinese agriculture science and technology Leader, 11 (5): 30-35.

Hou Fuen, the anti-TYLCV related molecular marker screening of tomato and its research of molecular marker assisted selection resistant polymeric, 2011

Simple Gui Liang, Lu Meiguang, Wang Fenghang, Zhang Hongcheng personal enemy mountain transgenic pest-resistant verticillium wilt of cotton integrated control technique system. Plant protection, 2007,33:136-140.

Simple Gui Liang, Zou Yafei, Ma Cun cotton verticillium wilt popular reason and countermeasure Cotton year after year, 2003,30: 13-14.

Li Jiawei, Lin Ming, Hu Hong, Wang Xiaoxuan, Guo Yanmei, Huang Zejun, Du Yongchen, Gao Jianchang tomato resisting etiolation leaf curl The gene influence to TYLCV duplication at different temperatures, gardening journal, 2016,43 (1): 71-79.

Tian Wenzhong, Ding Li, Cao Shouyun, Dai Shunhong, Ye Songqing, Li Liangcai phytoalexin rice transformation and transgenosis are planted The bioassay Botany Gazette of strain, 1998,40 (9): 803-808

Special secreted protein gene functional study [Ph.D. Dissertation] the Chinese agriculture of Xu Ming high virulence verticillium dahliae Academy of sciences

Zhang Baolong, holds great good, Yang Yuwen verticillium wilt resistance of cotton by same progress, Scientia Agricultura Sinica technology publishing house, and 2012

Summary of the invention

The gene and its application that the object of the present invention is to provide a kind of for improving disease resistance of plant, gene LeAct1 are compiled The gene-transformed plant is expressed above-mentioned gamatine transferase by code gamatine transferase, and the anti-of recipient plant can be improved Sick ability, including anti-TYLCV and verticillium wilt ability.

The technical solution adopted by the present invention are as follows:

It is a kind of for improving the gene of disease resistance of plant, the gene are as follows:

1) sequence DNA sequence dna as shown in SEQ ID NO.1；Or

2) DNA sequence dna that can hybridize with SEQ ID NO.1 under high high stringency conditions；Or

3) the mutually homotactic DNA sequence dna of amino acid encoded with SEQ ID NO.1 is encoded.

The high high stringency conditions are as follows: in 0.1 × SSPE (15mM NaCl, 1mM NaH₂PO₄,0.1mM EDTA)、0.1× SSC (15mM NaCl, 1.5mM sodium citrate), 0.1%SDS (dodecyl sodium sulfate) solution in, wash film under the conditions of 65 DEG C.

A kind of recombinant plasmid, it includes described for improving the gene of disease resistance of plant.

A kind of recombinant bacterium, it contains the recombinant plasmid.

The gene for improving disease resistance of plant is improving the application in disease resistance of plant, will be used to improve Genes For Plant Tolerance The genetic transformation of characteristic of disease imports in recipient plant genome, expresses gamatine transferase, improves the disease resistance of recipient plant.

The disease resistance refers to the ability of anti-tomato yellow leaf curl or cotton wilt.

The plant is tobacco.

Gamatine transferase is the enzyme that catalysis forms phytoalexin substance hydroxycinnamic acid amide (HCAAs).

The present invention relates to Cloning Plant Genes, functional analysis and application provide a plant disease-resistant related gene LeAct1, the gene source in anti-TYLCV tomato material C LN2777A (Chen T, Lv Y, Zhao T, Li N, Yang Y, Yu W,He X,Liu T,and Zhang B*.Comparative Transcriptome Profiling of a Resistant vs.Susceptible Tomato(Solanum lycopersicum)Cultivar in Response to Infection by Tomato Yellow Leaf Curl Virus.PLoS One, 2013,8 (11): e80816),

The gene LeAct1 as shown in SEQ ID NO.1 is to turn from 5 ' the 2017th bit bases of end by 4303 base compositions Initiation site is recorded, is denoted as+1；3346th bit base is translational termination site.Complete encoder block length is 1332 bases, coding Albumen is 443 amino acid, protein molecular weight 50.5KD, isoelectric point 6.07.The albumen has transfer enzyme domains.

The present invention provides the expression vector containing gene of the present invention and host strain and any segments for expanding the gene Primer.

Beneficial effect；

Tomato LeAct1 gene of the invention encodes a gamatine transferase, and the gene is in anti-TYLCV tomato material Risen in CLN2777A by virus induction expression quantity, and is declined in the susceptible material 4840 of TYLCV by virus induction expression quantity. LeAct1 is overexpressed the verticillium wilt of transgenic plant and tomato yellow leaf curl (TYLCVD) resistance dramatically increases.Excised leaf The content of phenylalanine lyase significantly increases compared with nontransgenic plants after inoculation verticillium wilt pathogen.Meanwhile the promoter of LeAct1 Can be induced respectively by the different albumen (C1, AC2, AC4, V1 and V3) of TYLCV, can use it is of the invention it is gene constructed at Various plant expression vectors applied to agricultural biotechnologies breeding to improve crop disease-resistant character, and can be greatly shortened and be educated The kind period improves breeding efficiency.

Detailed description of the invention

The similarity system design of Fig. 1 LeAct1 promoter.CLN2777A is disease-resistant material, and TMXA48-4-0 is susceptible material, Reference is with reference to genome.

The structural domain of Fig. 2 LeAct1 is predicted.

The signal peptide prediction of Fig. 3 LeAct1.

Relative expression quantity of Fig. 4 LeAct1 in different organ and tissue.

The expression of Fig. 5 TYLCV induction LeAct1.0,3,5 after 0dpi, 3dpi, 5dpi, 7dpi, 10dpi respectively induction, 7,10 days.

The Subcellular Localization of Fig. 6 LeAct1.Left figure is the positioning signal of LeAct1, and arrow meaning is nucleus.It is right MCherry is schemed for membrane positioning signal label.

The VIGS result of Fig. 7 LeAct1.The expression analysis of LeAct1 after A, VIGS；The virus of B, LeAct1VIGS plant Amount detection.Trv2 is empty vector control, and 71480VIGS is the gene silencing plant of LeAct1.

The TYLCV Resistance Identification result of Fig. 8 LeAct1 silencing plant.Trv2 is empty vector control, and 71480VIGS is The gene silencing plant of LeAct1.

The Molecular Identification of Fig. 9 LeAct1 transgenic plant.A, the PCR amplification analysis of transgenic plant；B, transgenic plant The expression analysis of middle target gene.M is molecular weight marker, and 1-18 is regeneration plant, and 19 be unconverted adjoining tree.

The resisting verticillium of Figure 10 LeAct1 transgenic plant is analyzed.A, disease index, WT are WT lines；L5, L6 with And L15 is respectively transgenic plant；B, the relative expression quantity of the yellow bacterium actin gene that withers；C, transformed plant and control strain inoculation are fallen Phenotype after blade profile verticillium wilt fungus strain V991.

Figure 11 LeAct1 transgenic plant is inoculated with the viral number identification after TYLCV.L5, L6, L10, L15 are respectively transgenosis Plant, WT are wild type.

The induced character of the promoter of Figure 12 LeAct1 is analyzed.A is LeAct1 promoter and the co-injection of TYLCV different genes GUS staining analysis afterwards.B is that pAACT1 is LeAct1 promoter and the GUS quantitative analysis after the co-injection of TYLCV different genes. The promoter of LeAct1, EV are empty vector control, and V1, V3, AC2, C1, AC4 is the different genes of TYLCV.

The PAL content of Figure 13 LeAct1 transgenic plant is identified.

Specific embodiment

Method therefor is conventional method unless otherwise instructed in following embodiments, and the primer sequence is by Shanghai English Pretty Bioisystech Co., Ltd's synthesis, the percentage composition is mass percentage.This experiment tomato material used is anti- CLN2777A and susceptible variety TMXA48-4-0 (Chen T, Lv Y, Zhao T, Li N, Yang Y, the Yu W, He of TYLCV X,Liu T,and Zhang B*.Comparative Transcriptome Profiling of a Resistant vs.Susceptible Tomato(Solanum lycopersicum)Cultivar in Response to Infection by Tomato Yellow Leaf Curl Virus.PLoS One,2013,8(11):e80816).Tobacco is Ben Shi cigarette (Nicotiana benthamiana).Tomato and tobacco all grow in phytotron.Intensity of illumination is 130 μm of ol photons m^–2s^–1, humidity 65%.

1, the acquisition of LeAct1 and bioinformatic analysis

This laboratory confrontation sense material C LN2777A and TMXA48-4-0 inoculation front and back carries out transcriptome differences analysis (Chen T, et al., 2013), find Solyc11g071480.1 in disease-resistant material, RPKM (Reads Per Kilobase of Exon model per Million mapped reads) induction front and back respectively 3.97 and 25.62, and in susceptible material For 32.59 and 4.01.Expression pattern significant difference of the LeAct1 in anti-sense material, illustrates that the gene may be in anti-TYLCV Play the role of highly important.Design primer

JAGN1151:5'-GGACAAAGGTGGTAGGGTATTTC-3 ' and

JAGN1152:5'-TGCCTAGTATTCATATTCACATCAC-3 ' expands the gene coding in anti-sense material respectively Sequence；

Primer JAGN1078:5'-TAGTTCCTGTCCTCAGAACCCATT-3 ' and

JAGN1079:5'-ATAATTGTGGCCCTAAAGCATTGTT-3 ' expands the gene promoter in anti-sense material respectively Subsequence.According to sequencing result, the gene coding region is 1332bp in disease-resistant material, encodes 443 amino acid, protein molecule Amount is 50.5KD, which is LeAct1 by isoelectric point 6.07.The promoter region of confrontation sense material carries out sequence point It is found after analysis, the promoter of LeAct1 is only 89% (Fig. 1) with susceptible material and with reference to the similitude of genome.It utilizes SMART on-line analysis software (http://smart.embl-heidelberg.de/), discovery LeAct1 have conservative transfer Enzyme domains (Fig. 2).It is analyzed using signal peptide prediction (http://www.cbs.dtu.dk/services/SignalP/) soft Part is found LeAct1 no signal peptide (Fig. 3).

2, the expression pattern analysis of LeAct1

Expression pattern analysis is carried out to LeAct1 using Real time RT-PCR.It takes in the same strain of tomato CLN2777A 1-7 piece leaf, stem top, stem, flower, bud, fruit, cortex and root, rapidly as being freezed in liquid nitrogen.It is extracted and is tried with RNA Agent box (Tiangeng, DP419) extracts sample total serum IgE, is obtained with reverse transcription reagent box (Vazyme, R123-01) and is used for Real time The cDNA template of RT-PCR.

Design primer 80F:5'-GAATCACTTTGTCCAAACTTGGAAG-3 ',

80R:5'-CTCCAATAAATGATGGCACAAGAAA-3 ' expands LeAct1.

Tomato internal control primer is JAGN1015:5'-TGGTCGGAATGGGACAGAAG-3 ',

JAGN1016:5'-CTCAGTCAGGAGAACAGGGT-3 ' (actin:AB199316).

PCR system are as follows: cDNA template 1ul, Primer F 0.5ul, Primer R 0.5ul, SYBR Premix ExTaqTM II Kit (2 ×) 7.5ul, ddH2O up to 15ul.PCR program are as follows: 95 DEG C of 1min, 95 DEG C of 15s, 60 DEG C of 20s, 72 DEG C of 20s, 40 circulations.Quantitative PCR apparatus is qTOWER 2.0/2.2 (Analytik jena, Germany), utilizes 2^-ΔΔCTSide Method calculates the relative expression quantity of gene, and all quantitative tests at least detect 3 biology and repeat.

Expression quantity of the LeAct1 in blade is low compared with its hetero-organization, the higher (figure of expression quantity in bud, in cortex and root 4).In addition, expression analysis is the result shows that in disease-resistant material, after TYLCV handles 3d, LeAct1 gene expression amount increases, up-regulation Expression, and reach highest within 5 days after treatment, then restore original expression (Fig. 5).LeAct1 responds TYLCV induction, explanation The gene is related to anti-TYLCV effect.

3, the Subcellular Localization of LeAct1

The subcellular localization of analysis LeAct1 is instantaneously infected using tobacco.According to sequence SEQ ID NO.1 design primer, and KpnI and SalI endonuclease recognized site is added in primer.

JAGN2488:5 '-CGGGGTACCATGAATGTGAAAATTGATAG-3 ',

JAGN2489:5 '-ACGCGTCGACCTTTGCTTTCAAATCTAGAG-3 '.With this to primer amplification tomato The cDNA of CLN2777A.With KpnI and SalI simultaneously digestion pcr amplification product and GFP carrier (Liu T, Guo S, Lian Z, Chen F,Yang Y,Chen T,Ling X,A P4-ATPase Gene GbPATP of cotton confers Chilling tolerance in plants.Plant Cell Physiol., 2015,56 (3): 549-57), recycle digestion Product and with T4 ligase connection.Recombinant vector is converted into Agrobacterium GV3101 by recombinant vector freeze-thaw method achieved above. With suspension (10mM MES pH5.7,10mM MgCl2,200 μM of acetosyringone) suspension Agrobacterium thallus, adjust OD600=0.5 injects Ben's Tobacco Leaves.48h is placed on fluorescence microscopy under the microscope.It is thin that positioning result shows that the gene is located at On karyon and cell membrane (Fig. 6).

4, Gene Silencing (VIGS) analysis of LeAct1 gene

It take Tobacco rattle virus (TRV) as the virus of basic carrier (Chen T, et al., 2013) building LeAct1 gene Induced gene silent carrier.According to sequence SEQ ID NO.1 design primer, and BamH I and I inscribe of Xba are added in primer Enzyme recognition site,

JAGN1080:5'-CATGGATCCTCAACCAACTATCAACTTCCAA-3 ' and

JAGN1081:5'-TTGTCTAGAGGAAGGAGAAGAATTATACCTAGG-3'.With this to primer amplification tomato The cDNA of CLN2777A.With BamH I and Xba I, digestion pcr amplification product and TRV2, recycling digestion products are used in combination simultaneously T4ligase connection.Recombinant vector is converted into Agrobacterium GV3103 by recombinant vector freeze-thaw method achieved above.Select the positive Clone shakes bacterium, and thalline were collected by centrifugation by 4000rpm 5min RT when logarithmic phase, and with suspension (10mM MES pH5.7,10mM MgCl2,200 μM of acetosyringone) suspension Agrobacterium thallus, it is small that OD600=2.0, room temperature 30-50rpm cultivate at least 4 When more than, TRV1 and TRV2:LeAct1 bacterium solution 1:1 is mixed for plant inoculating, and PDS (phytoene dehydrogenase) is arranged Control test silencing system success or not.It is inoculated with Agrobacterium before true leaf is grown after tomato is unearthed, takes the disposable injection of a 1ml Device draws bacterium solution, in the case where cotyledon back is several with the syringe needle thorn with bacterium solution, then touches the needle tubing injection of needle-less, inoculation is planted Strain is placed in insect prevention greenhouse, cultivates under 23 DEG C, 16h illumination.After 15 days, the plant for injecting PDS shows apparent albefaction, explanation Silencing system success.The blade RNA for extracting injection TRV2:LeAct1 detects silence efficiency using Real time RT-PCR.Knot Fruit shows that the expression quantity of target gene is only inject empty vector control plant 40% or so, and illustration purpose gene is effectively sunk Silent (Fig. 7 A).LeAct1 gene silencing and adjoining tree are inoculated with simultaneously TYLCV infectious clone (Yuan Hongbo, Guo Jiaru, what Ice, Chen Tianzi, Yang Yuwen, Wu Dan, Zhang Baolong, Liu Aimin.It is obtained using tomato yellow leaf curl virus infectious clone transformation of tobacco Obtain resistant mutant.Jiangsu's agriculture journal, 2012,28 (6): 1241-1246).After 15 days extract blade total DNA (Tiangeng, DP320), viral number is detected using Real time PCR.Amplification virus capsid protein primer be

JAGN2126:5'-GGATTTCGTTGTATGTTAGC-3 ',

JAGN2127:5'-ATGATTATATCGCCTGGTC-3 ', tomato reference gene are JAGN1015 and JAGN1016. After quantitative result shows LeAct1 gene silencing, the viral number of plant is 30 times or so (Fig. 7 B) of control.Meanwhile blade occurs The deformity phenotype such as distortion, shrinkage, illustrates that the disease resistance of plant is remarkably decreased (Fig. 8).VIGS the result shows that LeAct1 with The resistant effect of CLN2777A is closely related.

5, the building and Plant Transformation of LeAct1 gene plant expression vector

In order to study the function of LeAct1, according to sequence SEQ ID NO.1 design primer, and Sma I is added in primer With I endonuclease recognized site of Sac,

JAGN2347:5'-tgacccgggTGCCTAGTATTCATATTCACATCAC-3'；

JAGN2348:5'-actgagctcTTGTATGATAAAGGCAGAAGACT-3'.With this to primer amplification tomato The cDNA of CLN2777A.With Sma I and Sac I, digestion pcr amplification product and PCAMBIA2301, recycling digestion products are used in combination simultaneously T4ligase connection.Recombinant vector is converted into Agrobacterium LBA4404 with freeze-thaw method by recombinant vector achieved above.Use Agrobacterium Mediated method converts Ben Shi cigarette, and (Zhang Baolong, Yang Yuwen, Ni Wanchao, Hou Jibo turn the research of H5 avian influenza virus M2e genetic tobacco Jiangsu's agriculture journal, 2010,01:51-54).T0 is extracted for single plant with CTAB method, is existed using primer JAGN2347 and JAGN2348 Whether testing goal gene is transferred on DNA level, the whether successful table of primer 80F and 80R the testing goal gene on rna level It reaches.Acquisition segment can be expanded on DNA and rna level is then considered as positive transformants.

DNA cloning identifies 2Kb size segment, identifies 9 plants of positive plant (Fig. 9 A).Recycle Real time RT-PCR inspection The expression of foreign gene is surveyed, the expression quantity of strain 5,6,10,15 is higher, for the candidate strain (Fig. 9 B) further studied. Single plant is divided to harvest tobacco seed.T1 is tied up on the MS culture medium containing 40mg/L kanamycins for transgenic line and is screened, It selects green plant and transplants into Nutrition Soil continued growth and for Disease Resistance Identification.

6, LeAct1 is overexpressed the Disease-resistance Analysis of tobacco

Preliminary Resistance Identification is carried out to transgenic plant, Verticillium Dahliae strain used is defoliation High pathogenicity bacterial strain V991 (such as Xu Rongqi, Wang Jiani, Chen Jieyin verticillium dahliae T-DNA insertion mutation body phenotypic characteristic and flanking sequence point Analyse Scientia Agricultura Sinica, 2010,43 (3): 489-496；Zhang Tianzhen, Zhou Zhaohua, Min Liufang wait cotton to the resistance of verticillium wilt The breeding technique Acta Agronomica Sinica of hereditary pattern and anti-(resistance to) sick kind, 2000,26 (6): 673-680).Pathogen is through PDA plate After activation, it is put into PDB culture solution from colony edge picking fungus block, 25 DEG C, 120rmin cultivates 5-6d, with filtered through gauze culture Liquid, microscopy are simultaneously counted with blood counting chamber, and adjustment spore concentration is 1 × 107,40 plants of the identification strain number of every kind of pathogen, inoculation A situation arises for observation disease daily afterwards, can obviously see disease symptom after 15 days, be mainly shown as yellowing leaf, wither It is listless, delayed growth.Referring to cotton and arabidopsis verticillium wilt grade scale, tobacco verticillium wilt is classified.It is divided into 0~4 grade 5 A standard, wherein 0 grade is normal plant, morbidity below 25% blade is 1 grade, and the morbidity of 25%~50% blade is 2 grades, 50%~ The morbidity of 75% blade is 3 grades, 75% fallen ill with blade or it is dead be 4 grades.Disease Resistance Identification is the results show that for defoliation Huang Disease of withering V991, control wild type disease, which refers to, reaches 85.36%, and the disease of 3 transgenic lines refers to only 24.35%, 38.19% He 58.33% (Figure 10 A).Transgenic tobacco plant DNA is further extracted, and is carried out by mycelia of the PCR to the arabidopsis of morbidity It is quantitative.Data show that quantitative result is consistent with phenotype, and the hyphae content being inoculated in the transgenic plant of V991 is only that wild type is quasi- Southern mustard 30%-50% or so (Figure 10 B).Show the resistance (figure that LeAct1 can significantly increase Ben Shi cigarette to Strain of Defoliating Type V991 10C)。

TYLCV infectious clone is inoculated with to transgenosis Ben Shi cigarette plant, blade total DNA detection virus is extracted after inoculation 15 days Relative amount, Real time PCR amplification the result shows that, the viral number of 4 transgenic lines all relatively control significantly reduce (figure 11).Show that LeAct1 can significantly increase Ben Shi cigarette to the resistance of TYLCV.

7, LeAct1 promoter signature analysis

In order to study the starting subcharacter of LeAct1, according to SEQ ID NO.3 design primer, and Hind is added in primer III and BamH, I endonuclease recognized site, utilizes primer

JAGN2372:5'-CATAAGCTTATAATTGTGGCCCTAAAGCATTGTT-3 ',

JAGN2373:5'-AACGGATCCTAGTTCCTGTCCTCAGAACCCATT-3 ' expands tomato CLN2777A's DNA, with Hind III and BamH I, digestion pcr amplification product and PBI101, recycling digestion products are simultaneously connected with T4ligase simultaneously. Recombinant vector is converted into Agrobacterium GV3101 by recombinant vector PBI101:pLeAct1 freeze-thaw method achieved above.It constructs simultaneously The plant expression vector of TYLCV related gene, primer is as shown in table 1, restriction enzyme site KpnI/BamHI.With KpnI and BamHI Digestion pcr amplification product and GFP carrier (Liu T, Guo S, Lian Z, Chen F, Yang Y, Chen T, Ling X, A simultaneously P4-ATPase Gene GbPATP of cotton confers chilling tolerance in plants.Plant Cell Physiol., 2015,56 (3): 549-57), it recycles digestion products and is connected with T4ligase.By weight achieved above Recombinant vector is converted Agrobacterium GV3101 by group carrier freeze-thaw method.

Table 1 constructs TYLCV related gene plant expression vector relevant primer

Primer	Primer sequence
		JAGN2084_V2F	CGGGGTACCATGTGGGAcCCACTTCTA
JAGN2085_V2R	CGCGGATCCGGGCTTCGATACATTCTG
		JAGN2086_V1F	CGGGGTACCATGTCGAAGCGACCAGGC
JAGN2087_V1R	CGCGGATCCATTTGATATTGAATCATAGAAATA
		JAGN2088_V3F	CGGGGTACCATGGATTCACGCACAGGG
JAGN2089_V3R	CGCGGATCCATAAAATTTATATTTTATATCATGA
		JAGN2090_AC2F	CGGGGTACCATGCAACCTTCGTCACCC
JAGN2091_AC2R	CGCGGATCCAATACTCTTAAGAAACGACC
		JAGN2092_C1F	CGGGGTACCATGCCTCGTTTATTTAAAATA
JAGN2093_C1R	CGCGGATCCCGCCTTATTGGTTTCTTC
		JAGN2094_AC4F	CGGGGTACCATGGGGAACCACATCTCC
JAGN2095_AC4R	CGCGGATCCATATATTGAGGGCCTCGG

It selects positive colony and shakes bacterium, and with suspension suspension Agrobacterium thallus, OD600=0.5, room temperature 30-50rpm culture At least 4 hours or more, PBI101:pLeAct1 is mixed with the expression vector 1:1 of TYLCV related gene respectively, and carry out tobacco Instantaneously infect.PBI101:pLeAct1 is arranged simultaneously to compare with what GFP was mixed.After injecting 48h, blade is taken to carry out GUS dyeing, tool Body method are as follows: GUS histochemical stain is with 5-bromo-4-chloro-3-indolyl β-Dglucuronic acid (X- Gluc) it is used as substrate.After the 90% abundant decolorization of acetone of tobacco leaf, it is immersed in GUS reaction solution and (contains 50mmol/L sodium phosphate buffer (pH 7.0), 10mmol/L EDTA, the 2mmol/L potassium ferricyanide, 2mmol/L potassium ferrocyanide, 2.0mmol/L X-gluc and 0.2%Triton X-100), 37 DEG C incubate 1~3 day, until coloring reaches sufficient intensity.GUS Coloration result, which shows TYLCV related gene all, can induce the promoter (Figure 12 A) of LeAct1.The tobacco of injection point is extracted simultaneously RNA carries out Real time RT-PCR analysis after reverse transcription.It is quantitative as a result, and showing wherein that amplification demonstrates GUS C1, AC2 induction are the most significant (Figure 12 B).PLeAct1 responds TYLCV related gene, further demonstrates the gene and TYLCV Resistance it is closely related.

<110>Jiangsu Province Agriculture Science Institute

<120>a kind of gene and its application for improving disease resistance of plant

<130>

<160> 31

<170> PatentIn version 3.3

<210> 1

<211> 4303

<212> DNA

<213>artificial sequence

<400> 1

ataattgtgg ccctaaagca ttgttcattg acaccccact cccaccatgt tcagaacgtg 60

ttttacaaaa ggcataataa ataaatatac cttttaactt gatttcaaat tgcagttatg 120

ttttttaatt ttagtgtaca taattaaata gttaaatttg tataaaatta aataaataga 180

cacacatgtc ttatatgtca ttttttatcc tacgtagtgt cgtatgtgta ttttgctatg 240

tagaaattat ttgcttattt atttaaaagt tggatagtta aagtgtctgt ttgttcatta 300

tgaaaattaa agatcaaagt taaaatttaa aatcaagttt agaatccgat atatgtatta 360

tgcctttata aaatgatata aaagaagata aagatgtttt gaaaaatagc tatcacttgt 420

cagtaaggat agatatgata tgatatatat tgaattatta tattatatcg aaatttttaa 480

taattatgaa attcgacaag gtatatggta tagattttaa atatttttca cgtttggtat 540

gatatttggt agttggaaac aatatattaa accatatcga agcatatagt tacataatat 600

aaactaaaag ttttagaaaa ttttgactat tctattttaa ttgaaattaa tatatccaaa 660

taaaattgat taacacagta gtttgtattt cttttggaat taatatatat atttcaacat 720

gtgtaatata ttagtaatta atatgataca gttgagactc cttttcgaat tttgaagtca 780

taacacttta ctatacgagt atatattacg aagataaata aattataatt atcaatttac 840

catattgtaa aacactaaaa ttaaaaattt atataaatag ataaattctt ttaaagatat 900

caatatttta tgtatttctc gaacataaaa tatactagct cataatttta caaaattctc 960

aatttcactt ctacagagag tttcttaagg ttcgacctac cctaattgga ttgtaaaata 1020

catggacatt tgtgagcatt tgcatgagat aatataataa aaaattttac taaaaaattt 1080

atcatgaact atttaatttg tattttaaag gtagtttaaa gccaaataaa ataattaaac 1140

caatattaaa gttcattaaa aaaaatacaa gaaataatct tctttctcat tctcctatag 1200

tcattttttt aatcactcca agtgaaccat aaagttttaa agtttattcc aataatctct 1260

ttatttaaca aaaaaaaaaa ggtgaatagt caccttgtta taatttatat gtcttaattt 1320

atttagttta acatatattt tatgtttaat acataatatg ttaaacaata taatatacaa 1380

gaaatatctt cttattttct aaaattttgt gatcaatatt taattaagga ataaagcata 1440

aagatccctc tagaatatga ttaaaatttc acatatatat atcttaacta aactaaggtc 1500

ttattatttt gagaactaat ttatttttta attttataca ctgtttgact tacgtgacac 1560

actatgtgat tctatgtagt tgagacacat gggaggtgtt tcaatgtcac gtaaaccaac 1620

aatgcgtaca aaattagaat aaatgggttc tgaggacagg aactaataga accttaattt 1680

tgttaaaaag ggtgtctttg aaatttcgat aataatatag ggatactttt ggcaagacat 1740

ataacatgaa atatgtggaa gaatttcttt aatactacta acaaataaga caaaagtgtt 1800

agtactcaca ttatatttat aataataaca cttccatcaa aaccataaac aaagacatat 1860

ataatgccta gtattcatat tcacatcaca taaagaatac ctctatagag aagaaagcac 1920

ctaaaaaaat ttagtagcca tgcctagtat tcatattcac atcacacaaa gaatacctct 1980

atagagaaga aagcacctaa aaaaatttta gtagccatga atgtgaaaat tgatagttca 2040

aaaatcatca agccactata tgaaggaact cctccttcaa ctacaactca tattcctttc 2100

aatatctttg acaatgtaac atttgatgct ctaatggctc taatatatgc ctatagacca 2160

cccacccctc ccacatccac tattgaaata ggacttcgaa agacgttatc gatttatcga 2220

gagtgggcag gaagaatagg tgaagatgaa catggtaatc gaggagtttt tctcaatgat 2280

gagggtgttc gattcatcga ggcgtctgtg gacacctcat tggatgaagt attgccctta 2340

aagccttcgc cctctatgct ctccttgcat cctagcttaa aggatgtagt ggagttaatc 2400

caagtccaag tcacacgttt cacgtgtggc tctgtggtgg tcggtttcac cggccaccac 2460

atgatagctg acggccatgc tgcaagcaac ttttttgtcg cgtggggtca agcatgccga 2520

gggatggaaa ttacacccct cccggtgaac gaccgtacta ttttccgccc tcgggatcca 2580

cccctcgtcg agtataacca tgttggggcc gaattcgtgt ccaaattagt aaacaaggag 2640

ttagtcaaag tcaacaacga tgaatgtaaa gagaagaata tcatagtcca caaagtccat 2700

ttcaccttgg agtacctaag gaaactcaag gcgcatgctt cttttatgaa cgaaaatgcc 2760

aaaacttata gcacgttcga aagtctaata gcccatttgt ggagggttat tacaaaattg 2820

cgtgacttaa acgcatttca gaacacccaa attcgaatat cggtcgatgg aaggagaaga 2880

ataacaccta gggttccgga tgaatttttt ggtaacatag tgttatgggc atttccaaca 2940

tcaaaagtga aggacttact agatgagcca cttcactatg caacaaagat tatacatgag 3000

gcaattagta aagttgatga caaatatttc aagtcattta ttgactttgc aaatgatgaa 3060

aaagtgatga ctagacaaga tttaatacca agtgcaaaca tgaacaatga atcactttgt 3120

ccaaacttgg aagttgatag ttggttgagg tttccatttt atgacttgga ttttggtact 3180

ggttgcccat ttgtgtttat gccttcttat tatccaatag aagggatgat gtttcttgtg 3240

ccatcattta ttggagatgg aagcattgat gcttttattc ctttatatga acacaatcta 3300

acaaatttca acaaaatttg ttactctcta gatttgaaag caaagtgaga agacctactt 3360

atggggtagg tggggtgggg gtgtttttgg tattttttgt tgtttttagt atattttgtt 3420

gtttaataac caaaagtaat taaaactttt ggttattatt tttatgtaat gtcatgttga 3480

tgatctatga gttttggaga agaagtttaa attggcattt ctttgtgatt ttatttatag 3540

tattacttgt ctaattttct attttatttg tttattttga caaattaaga aaggataatt 3600

tttttttatc tattatatcc tcaattaatt attttgaaaa aggtaaaact tctaaaaatt 3660

ttaaattttt tattcatcca cttcataatt aatatggata aaaaagataa acacattatg 3720

ttaatttttt ttattattat tattatgtta attcaaaagt gaacaagtaa ttatgaatat 3780

aaagagtata tattagtgat tgatgaatat tgcttggttg tttttctatt tctaaaatta 3840

taaatttatg aactgatttt gtaatttcta ttaattttca taagtagttc attttagtct 3900

tctgctttta tcatacaagg aatcacatat aagttctcta ttttatgtca aattaattaa 3960

aataattagt ctcacttaga ctaatttatt gatgtgtgta gatacattga atctttttgg 4020

aactattttc ttcttcttta attctagcaa attcttgtgg aaatttaatt tctttgtagt 4080

gattgacata tttattggga aaaaaaatta attacatcaa atgagacaat tttaaccaag 4140

aaaaatatgc atagttcttt ttaaaaaatc atttctcttt ccatagtctt tcaaagaaaa 4200

atttgcatgg ggcaattaat gacttaaaat tacaattatt tcaccatatg aaaccaaaaa 4260

tgaaagtcat gtcaaatatg gaaataccct accacctttg tcc 4303

<210> 2

<211> 23

<212> DNA

<213>artificial sequence

<400> 2

ggacaaaggt ggtagggtat ttc 23

<210> 3

<211> 25

<212> DNA

<213>artificial sequence

<400> 3

tgcctagtat tcatattcac atcac 25

<210> 4

<211> 24

<212> DNA

<213>artificial sequence

<400> 4

tagttcctgt cctcagaacc catt 24

<210> 5

<211> 25

<212> DNA

<213>artificial sequence

<400> 5

ataattgtgg ccctaaagca ttgtt 25

<210> 6

<211> 25

<212> DNA

<213>artificial sequence

<400> 6

gaatcacttt gtccaaactt ggaag 25

<210> 7

<211> 25

<212> DNA

<213>artificial sequence

<400> 7

ctccaataaa tgatggcaca agaaa 25

<210> 8

<211> 20

<212> DNA

<213>artificial sequence

<400> 8

tggtcggaat gggacagaag 20

<210> 9

<211> 20

<212> DNA

<213>artificial sequence

<400> 9

ctcagtcagg agaacagggt 20

<210> 10

<211> 29

<212> DNA

<213>artificial sequence

<400> 10

cggggtacca tgaatgtgaa aattgatag 29

<210> 11

<211> 30

<212> DNA

<213>artificial sequence

<400> 11

acgcgtcgac ctttgctttc aaatctagag 30

<210> 12

<211> 31

<212> DNA

<213>artificial sequence

<400> 12

catggatcct caaccaacta tcaacttcca a 31

<210> 13

<211> 33

<212> DNA

<213>artificial sequence

<400> 13

ttgtctagag gaaggagaag aattatacct agg 33

<210> 14

<211> 20

<212> DNA

<213>artificial sequence

<400> 14

ggatttcgtt gtatgttagc 20

<210> 15

<211> 19

<212> DNA

<213>artificial sequence

<400> 15

atgattatat cgcctggtc 19

<210> 16

<211> 34

<212> DNA

<213>artificial sequence

<400> 16

tgacccgggt gcctagtatt catattcaca tcac 34

<210> 17

<211> 32

<212> DNA

<213>artificial sequence

<400> 17

actgagctct tgtatgataa aggcagaaga ct 32

<210> 18

<211> 34

<212> DNA

<213>artificial sequence

<400> 18

cataagctta taattgtggc cctaaagcat tgtt 34

<210> 19

<211> 33

<212> DNA

<213>artificial sequence

<400> 19

aacggatcct agttcctgtc ctcagaaccc att 33

<210> 20

<211> 27

<212> DNA

<213>artificial sequence

<400> 20

cggggtacca tgtgggaccc acttcta 27

<210> 21

<211> 27

<212> DNA

<213>artificial sequence

<400> 21

cgcggatccg ggcttcgata cattctg 27

<210> 22

<211> 27

<212> DNA

<213>artificial sequence

<400> 22

cggggtacca tgtcgaagcg accaggc 27

<210> 23

<211> 33

<212> DNA

<213>artificial sequence

<400> 23

cgcggatcca tttgatattg aatcatagaa ata 33

<210> 24

<211> 27

<212> DNA

<213>artificial sequence

<400> 24

cggggtacca tggattcacg cacaggg 27

<210> 25

<211> 34

<212> DNA

<213>artificial sequence

<400> 25

cgcggatcca taaaatttat attttatatc atga 34

<210> 26

<211> 27

<212> DNA

<213>artificial sequence

<400> 26

cggggtacca tgcaaccttc gtcaccc 27

<210> 27

<211> 29

<212> DNA

<213>artificial sequence

<400> 27

cgcggatcca atactcttaa gaaacgacc 29

<210> 28

<211> 30

<212> DNA

<213>artificial sequence

<400> 28

cggggtacca tgcctcgttt atttaaaata 30

<210> 29

<211> 27

<212> DNA

<213>artificial sequence

<400> 29

cgcggatccc gccttattgg tttcttc 27

<210> 30

<211> 27

<212> DNA

<213>artificial sequence

<400> 30

cggggtacca tggggaacca catctcc 27

<210> 31

<211> 27

<212> DNA

<213>artificial sequence

<400> 31

cgcggatcca tatattgagg gcctcgg 27

Claims (5)

1. a kind of for improving the gene of disease resistance of plant, which is characterized in that the gene is sequence as shown in SEQ ID NO.1 DNA sequence dna.

2. a kind of recombinant plasmid, it includes described in claim 1 for improving the gene of disease resistance of plant.

3. a kind of recombinant bacterium, it contains recombinant plasmid as claimed in claim 2.

4. improving the application in disease resistance of plant, the plant for improving the gene of disease resistance of plant described in claim 1 For tobacco, the disease resistance refers to anti-tomato yellow leaf curl or cotton wilt.

5. application according to claim 4, which is characterized in that by be used to improve disease resistance of plant genetic transformation import by In body Plant Genome, gamatine transferase is expressed, the disease resistance of recipient plant is improved.