CN106047906A

CN106047906A - Gene for improving plant disease resistance and application thereof

Info

Publication number: CN106047906A
Application number: CN201610331638.2A
Authority: CN
Inventors: 杨郁文; 胡节立; 张保龙; 王金彦
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2016-05-18
Filing date: 2016-05-18
Publication date: 2016-10-26
Anticipated expiration: 2036-05-18
Also published as: CN106047906B

Abstract

The invention discloses a gene for improving the plant disease resistance and application thereof. The gene LeAct1 codes an agmatine transferase, which has a DNA (Deoxyribonucleic Acid) sequence shown as SEQ ID NO.1 in a sequence table, or has a DNA sequence capable of being hybridized with SEQ ID NO.1 under the strictly strict condition, or the gene LeAct1 codes a DNA sequence with the same amino acid sequence as the SEQ ID NO.1 in the sequence table. The gene is transformed and imported into a receiver plant genome; the agmatine transferase is expressed; and the disease resistance capability of a receiver plant can be improved. When the gene is applied to the agricultural biological technology breeding for improving the crop disease-resistant properties, the breeding period can be greatly shortened; and the breeding efficiency is improved.

Description

A kind of gene for improving disease resistance of plant and application thereof

Technical field

The invention belongs to genetic engineering field, be specifically related to a kind of gene for improving disease resistance of plant and application thereof.

Background technology

Tomato yellow leaf curl (Tomato yellow leaf curl disease, TYLCD) is in tomato production The destructive disease of kind of extremely difficult preventing and treating, first this disease is found in the Israel Jordan River one band, after break out in large area all over the world, In recent years China's harm day by day serious (Antignus&Cohen, 1994；Boulton, 2003；The gorgeous prunus mume (sieb.) sieb.et zucc. of state etc., 2009).This disease Caused by geminivirus infection, China especially with tomato yellow leaf curl virus (Tomato yellow leaf curl virus, TYLCV) harm is the most very (Li Jiawei etc., 2016).Tomato cultivation germ plasm resource lacks TYLCV resistant gene, identifies at present Resistant gene Ty-1-Ty-5 derives from Wild related germplasm.Wherein Ty-2 is significantly stronger than Ty-1/ to the inhibitory action of virus replication , between 3 genes, the most there is not additive effect (Li Jiawei etc., 2016) in Ty-3 simultaneously.By molecular mark, can be by Ty-1, Ty-2, Ty-3 and Ty-4 are applied to cultivate Fructus Lycopersici esculenti disease-resistant variety, but this method breeding cycle is long, it usually needs 8- 10 years, and be difficult to during transformation take out Linkage drag, affect breeding efficiency.

The pathogen of verticillium wilt is verticillium dahliae (Verticillium dahliae Kleb), and the Microsclerotia of formation exists In soil, survival was up to more than 10 years；Its host range is extensive, can infect 660 various plants, including Fructus Lycopersici esculenti, Fructus Solani melongenae, Rhizoma Solani tuber osi, The Important Agricultural industrial crops such as Fructus Cucumidis sativi, Cotton Gossypii, Nicotiana tabacum L., Fructus Capsici (Wilhelm et al, 1955；Fradin et al,2006；Slowly Bright, 2015).This bacterium causes the control of disease to be the great difficult problem in agricultural production.Such as cotton verticillium wilt is commonly called as Cotton Gossypii " cancer Disease ", Cotton Production is had high risks, annual underproduction 10-15%, be the big disease of Cotton Gossypii first (letter Gui Liang etc., 2003； Fradin et al,2006；Zhang Baolong etc., 2012).China's seriously area sickness rate is up to more than 80%, and onset area reaches 222-266 ten thousand hectares, annual loss up to more than 10 hundred million yuan (letter Gui Liang etc., 2007).So far there is no effectively preventing method.

Pathogen is destructive to the infringement of plant, and plant utilizes the secondary metabolism of internal generation by long-term evolution The invasion (Tian Wenzhong etc., 1998) of thing defence pathogen.Hydroxycinnamic acid amides compound (HCAAs) is that a class is extremely important Plant Secondary Metabolites, the growth of involved in plant and degeneration-resistant process (Mary M.D.et al, 2015).Recently at arabidopsis In be isolated to HCAAs, it is mainly made up of p-coumaric acyl gamatine (CouAgm) and other HCAAs products, including Resina Ferulae acyl agmatine (FerAgm), p-tonkabean putrescine (CouPtr) and Resina Ferulae acyl putrescine (FerTre).Its action principle its contain Some alkaloids can suppress fungal mycelia prolongation and be gathered in plant cell wall formed nature intercept or increase leaves of plants The toughness of sheet (Mayama et al, 1981；Miyagawa et al.,2014；Schmidt et al.,1998；Ishihara A et al.,2008).It is reported, hydroxycinnamic acid amide polymer is the composition of suberin, and suberin has strong hydrophobic Property, it is possible to effective prevention moisture penetration to (Bernards et al., 1995) in plant tissue.HCAAs is required by life institute Amine substance composition.Gamatine acyltransferase (ACT) is the enzyme of catalysis HCAAs biosynthesis final step, guanidine radicals fourth Amine acyltransferase (ACT) tends to using gamatine as acyl acceptor, using p-coumaric acyl-coenzyme A as acry radical donor. ACT belongs to BAHD acyltransferase family, is positioned in cytosol.To arabidopsis gamatine acyltransferase (AtACT) Study on mutant, find that this mutant can not accumulate HCAAs, and easily infected (D'Auria by melasma J.C.2006).Proving in arabidopsis body, HCAAs is the important substance resisting pathogen invasion.The report such as Muroi A will be intended The AtACT of south mustard converts HUDIECAO, and the HCAAs content in transformant significantly raises and improves gray mold resistance, but for 3 Plant herbivorous insect thrips (Frankliniella occidentalis), aphid (Aphis gossypii) and tetranychid (Tetranychus ludeni) does not has resistance (Muroi et al.2009).In addition to arabidopsis, for the ACT base of other plant Cause and functional study thereof do not appear in the newspapers (Muroi A et al, 2012).

The present invention, by analyzing the transcript profile of Fructus Lycopersici esculenti anti-sense material, finds the gene of the gamatine transferring enzyme of Fructus Lycopersici esculenti LeACT1 raises after in disease-resistant material, TYLCV infects, and this gene in susceptible material is lowered after infecting.This gene is carried out Sequence analysis, has found that while that the coding region of this gene does not has difference in anti-sense material, but their promoter region difference is relatively Greatly, thus it is speculated that this species diversity causes this gene difference of abduction delivering pattern in anti-sense material just.The anti-melasma of arabidopsis The resistance mechanism of action of (Alternaria brassicicola) gene C DK8 (CYCLIN-DEPENDENT KINASE8) is It can combine and activate it with the promoter of AtACT and transcribe, thus increases the content (Zhu et al.2014) of HCAAs.With Time, by each gene of the promoter of LeACT1 and TYLCV is injected altogether, it was demonstrated that this promoter can be lured by these genes Lead.It addition, build the gene silencing vector of LeACT1, respectively by reticent for the genes of interest in anti-sense Fructus Lycopersici esculenti material, and to silence Plant inoculation TYLCV, after 15d, the virus quantity in reticent plant is 30 times of comparison, and meanwhile, blade occurs that distortion, shrinkage etc. are abnormal Shape phenotype.Building over-express vector the transformation of tobacco of LeACT1, Resistance Identification analysis result shows the TYLCV of transfer-gen plant And resistance to verticillium wilt significantly improves.

List of references:

Miyagawa H.,Ishihara A.,Nishimoto T.,et al.,Induction of Avenanthramides in Oat Leaves Inoculated with Crown Rust Fungus,Puccinia coronate f.sp.avenae.Bioscience,Biotechnology and Biochemistry,2014.59(12):2305-2306.

Schmidt A,Scheel D,Strack D.Elicitor-stimulated biosynthesis of hydroxycinn amoyltyramines in cell suspension cultures of Solanum tuberosum.Planta,1998,205(1):51-55.

Ishihara A.,Hashimoto Y.,Tanaka C.,et al.,The tryptophan pathway is involved in the defense responses of rice against pathogenic infection via serotonin production.Plant J,2008.54(3):481-95.

Bernards M A,Lopez M L,Zajicek J,et al.Hydroxycinnamic acid-derived polymers constitute the polyaromatic domain of suberin.Journal of Biological Chemistry,1995,270(13):7382-7386.

Antignus Y, Cohen S..Complete nucleotide sequence of an infectious clone of a mild isolate of Tomato yellow leaf curl virus(TYLCV).Phytopathology, 1994,84 (7): 707 712.

Boulton M I.2003.Geminiviruses:Major threats to world agriculture.Annals Of Applied Biology, 142 (2): 143 143.

D'Auria J.C.Acyltransferases in plants:a good time to be BAHD.Curr Opin Plant Biol,2006.9(3):331-40.

Fradin EF,Thomma BP.Physiology and molecular aspects of Verticillium wilt diseases caused by V.dahliae and V.albo-atrum.Molecular Plant Pathology,2006, 7(2):71-86.

Macoy D.M.,Kim W.Y.,Lee S.Y.,Kim M.G.Biotic Stress Related Functions of Hydroxycinnamic Acid Amide in Plants.J.Plant Biol.,2015,58:156-163

Mayama S,Tani T,Matsuura Y,et al.The production of phytoalexins by oat in response to crown rust.Puccinia coronata f.sp.Avenae.Physiologial Plant Pathology,1981,19(2).

Muroi A.,Ishihara A.,Tanaka C.,et al.,Accumulation of hydroxycinnamic acid amides induced by pathogen infection and identification of agmatine coumaroyltransferase in Arabidopsis thaliana.Planta,2009.230(3):517-527.

Wilhelm,S.1955.Longevity of Verticillium wilt fungus in the laboratory and field.Phytopathology,45:180-181

Zhu Y,Schluttenhoffer CM,Wang P,Fu F,Thimmapuram J,Zhu JK,Lee SY,Yun DJ, Mengiste T.CYCLIN-DEPENDENT KINASE8differentially regulates plant immunity to fungal pathogens through kinase-dependent and-independent functions in Arabidopsis.Plant Cell, 2014 Oct；26(10):4149-70.

The gorgeous prunus mume (sieb.) sieb.et zucc. of state, Du Yongchen, Wang Xiaoxuan, the progress of high Jianchang .2009. tomato yellow leaf curl virus sick (TYLCV). China Agricultural science and technology Leader, 11 (5): 30 35.

Hou Fuen, the screening of Fructus Lycopersici esculenti anti-TYLCV related molecular marker and the research of molecular marker assisted selection resistant polymeric thereof, 2011

Letter osmanthus is good, Lu Meiguang, Wang Fenghang, Zhang Hongcheng. personal enemy mountain transgenic pest-resistant verticillium wilt of cotton integrated control technique system.Plant Protection, 2007,33:136-140.

Letter osmanthus is good, Zou Yafei, Ma Cun. reason that cotton verticillium wilt is the most popular and countermeasure. and Cotton, 2003,30:13-14.

Li Jiawei, Lin Ming, Hu Hong, Wang Xiaoxuan, the gorgeous prunus mume (sieb.) sieb.et zucc. of state, Huang Zejun, Du Yongchen, high Jianchang. Fructus Lycopersici esculenti resisting etiolation leaf curl gene The impact at different temperatures TYLCV replicated, gardening journal, 2016,43 (1): 71 79.

Tian Wenzhong, Ding Li, Cao Shouyun, Dai Shunhong, Ye Songqing, Li good timber. phytoalexin rice transformation and transfer-gen plant Bioassay. Botany Gazette, 1998,40 (9): 803-808

Xu Ming. high virulence verticillium dahliae special secreted protein gene functional study [Ph.D. Dissertation]. Scientia Agricultura Sinica Institute.

Zhang Baolong, holds letter good, Yang Yuwen. verticillium wilt resistance of cotton by same progress, and Scientia Agricultura Sinica technology publishing house, 2012

Summary of the invention

It is an object of the invention to provide a kind of gene for improving disease resistance of plant and application thereof, this gene LeAct1 compiles Code gamatine transferring enzyme, by this gene-transformed plant, expresses above-mentioned gamatine transferring enzyme, can improve the anti-of recipient plant Condition of disease power, including anti-TYLCV and verticillium wilt ability.

The technical solution used in the present invention is:

A kind of gene for improving disease resistance of plant, this gene is:

1) sequence DNA sequence as shown in SEQ ID NO.1；Or

2) can be with the DNA sequence of SEQ ID NO.1 hybridization under high high stringency conditions；Or

3) DNA sequence of the aminoacid identical sequence that coding encodes with SEQ ID NO.1.

Described high high stringency conditions is: at 0.1 × SSPE (15mM NaCl, 1mM NaH₂PO₄,0.1mM EDTA)、0.1× SSC (15mM NaCl, 1.5mM sodium citrate), 0.1%SDS (dodecyl sodium sulfate) solution in, wash film under the conditions of 65 DEG C.

A kind of recombiant plasmid, it comprises the described gene for improving disease resistance of plant.

A kind of recombinant bacterium, it contains described recombiant plasmid.

The application in improving disease resistance of plant of the described gene for improving disease resistance of plant, will be used for improving Genes For Plant Tolerance The gene transformation of characteristic of disease imports in recipient plant genome, expresses gamatine transferring enzyme, improves the resistance against diseases of recipient plant.

Described resistance against diseases refers to the ability of anti-tomato yellow leaf curl or cotton wilt.

Described plant is Nicotiana tabacum L..

Gamatine transferring enzyme is the enzyme that catalysis forms phytoalexin class material hydroxycinnamic acid amide (HCAAs).

The present invention relates to Cloning Plant Genes, functional analysis and application, it is provided that a plant disease-resistant related gene LeAct1, this gene source in anti-TYLCV Fructus Lycopersici esculenti material C LN2777A (Chen T, Lv Y, Zhao T, Li N, Yang Y, Yu W,He X,Liu T,and Zhang B*.Comparative Transcriptome Profiling of a Resistant vs.Susceptible Tomato(Solanum lycopersicum)Cultivar in Response to Infection by Tomato Yellow Leaf Curl Virus.PLoS One, 2013,8 (11): e80816),

Gene LeAct1 as shown in SEQ ID NO.1 is by 4303 base compositions, from 5 ' end the 2017th bit bases for transcribing Beginning site, is designated as+1；3346th bit base is translational termination site.Complete a length of 1332 bases of encoder block, encoding proteins Being 443 aminoacid, protein molecular weight is 50.5KD, and isoelectric point, IP is 6.07.This albumen has transferring enzyme domain.

The invention provides the expression vector containing gene of the present invention and Host Strains and expand arbitrary fragment of this gene Primer.

Beneficial effect；

One gamatine transferring enzyme of Fructus Lycopersici esculenti LeAct1 gene code of the present invention, this gene is at anti-TYLCV Fructus Lycopersici esculenti material CLN2777A is risen by virus induction expression, and is declined by virus induction expression in the susceptible material of TYLCV 4840. Verticillium wilt and tomato yellow leaf curl (TYLCVD) resistance of LeAct1 process LAN transfer-gen plant dramatically increase.Excised leaf After inoculation verticillium wilt pathogen, the content relatively nontransgenic plants of PAL significantly increases.Meanwhile, the promoter of LeAct1 Can be induced respectively by the different albumen (C1, AC2, AC4, V1 and V3) of TYLCV, it is possible to use the gene constructed one-tenth of the present invention Various plant expression vectors, are applied to agricultural biotechnologies breeding to improve crop disease-resistant character, and can be greatly shortened and educate In the cycle of kind, improve breeding efficiency.

Accompanying drawing explanation

The similarity system design of Fig. 1 LeAct1 promoter.CLN2777A is disease-resistant material, and TMXA48-4-0 is susceptible material, Reference is with reference to genome.

The domain prediction of Fig. 2 LeAct1.

The signal peptide prediction of Fig. 3 LeAct1.

Fig. 4 LeAct1 relative expression quantity in different organ and tissue.

The expression of Fig. 5 TYLCV induction LeAct1.0dpi, 3dpi, 5dpi, 7dpi, 10dpi be respectively induction after 0,3,5, 7,10 days.

The Subcellular Localization of Fig. 6 LeAct1.Left figure is the framing signal of LeAct1, and arrow indication is nucleus.Right Figure mCherry is film framing signal labelling.

The VIGS result of Fig. 7 LeAct1.The expression analysis of LeAct1 after A, VIGS；The disease of B, LeAct1VIGS plant Poison amount detection.Trv2 is empty vector control, and 71480VIGS is the gene silencing plant of LeAct1.

The TYLCV Resistance Identification result of Fig. 8 LeAct1 silence plant.Trv2 is empty vector control, and 71480VIGS is The gene silencing plant of LeAct1.

The Molecular Identification of Fig. 9 LeAct1 transfer-gen plant.A, the PCR Amplification Analysis of transfer-gen plant；B, transfer-gen plant The expression analysis of middle genes of interest.M is molecular weight marker, and 1-18 is regeneration plant, and 19 is unconverted adjoining tree.

The resisting verticillium analysis of Figure 10 LeAct1 transfer-gen plant.A, disease index, WT is WT lines；L5, L6 with And L15 is respectively transfer-gen plant；B, Huang withers the relative expression quantity of bacterium actin gene；C, transformed plant and comparison strain inoculation fall Phenotype after blade profile verticillium wilt fungus strain V991.

Viral number after Figure 11 LeAct1 transfer-gen plant inoculation TYLCV is identified.L5, L6, L10, L15 respectively transgenic is planted Strain, WT is wild type.

The induced character analysis of the promoter of Figure 12 LeAct1.A is that LeAct1 promoter is noted altogether with TYLCV different genes GUS staining analysis after penetrating.B be pAACT1 be that the GUS after LeAct1 promoter is injected altogether with TYLCV different genes quantitatively divides Analysis.The promoter of LeAct1, EV is empty vector control, and V1, V3, AC2, C1, AC4 are the different genes of TYLCV.

The PAL content of Figure 13 LeAct1 transfer-gen plant is identified.

Detailed description of the invention

In following embodiment, method therefor is conventional method if no special instructions, and the primer sequence is by Shanghai English The synthesis of pretty Bioisystech Co., Ltd, described percentage composition is weight/mass percentage composition.Fructus Lycopersici esculenti material used by this experiment is anti- The CLN2777A of TYLCV and susceptible variety TMXA48-4-0 (Chen T, Lv Y, Zhao T, Li N, Yang Y, Yu W, He X,Liu T,and Zhang B*.Comparative Transcriptome Profiling of a Resistant vs.Susceptible Tomato(Solanum lycopersicum)Cultivar in Response to Infection by Tomato Yellow Leaf Curl Virus.PLoS One,2013,8(11):e80816).Nicotiana tabacum L. is Ben Shi cigarette (Nicotiana benthamiana).Fructus Lycopersici esculenti all grows with Nicotiana tabacum L. in phytotron.Intensity of illumination is 130 μm ol photons m^–2s^–1, humidity is 65%.

1, the acquisition of LeAct1 and bioinformatic analysis

This laboratory antagonism sense material C LN2777A and TMXA48-4-0 inoculation before and after carry out transcriptome differences analysis (Chen T, Et al., 2013), Solyc11g071480.1 is in disease-resistant material in discovery, its RPKM (Reads Per Kilobase of Exon model per Million mapped reads) it is respectively 3.97 and 25.62, and in susceptible material before and after induction It is 32.59 and 4.01.LeAct1 expression pattern significant difference in anti-sense material, illustrates that this gene may be in anti-TYLCV Play highly important effect.Design primer

JAGN1151:5'-GGACAAAGGTGGTAGGGTATTTC-3 ' and

JAGN1152:5'-TGCCTAGTATTCATATTCACATCAC-3 ' expands the gene coded sequence in anti-sense material respectively；

Primer JAGN1078:5'-TAGTTCCTGTCCTCAGAACCCATT-3 ' and

JAGN1079:5'-ATAATTGTGGCCCTAAAGCATTGTT-3 ' expands the gene promoter sequence in anti-sense material respectively Row.According to sequencing result, in disease-resistant material, this gene coding region is 1332bp, encodes 443 aminoacid, and protein molecular weight is 50.5KD, isoelectric point, IP is 6.07, is LeAct1 by this unnamed gene.After the promoter region of antagonism sense material carries out sequence analysis Finding, the promoter of the LeAct1 similarity with susceptible material and with reference to genome is only 89% (Fig. 1).SMART is utilized to exist Line analysis software (http://smart.embl-heidelberg.de/), finds that LeAct1 has conservative transferring enzyme domain (Fig. 2).Utilize signal peptide prediction (http://www.cbs.dtu.dk/services/SignalP/) to analyze software, find LeAct1 no signal peptide (Fig. 3).

2, the expression pattern analysis of LeAct1

Utilize Real time RT-PCR that LeAct1 is carried out expression pattern analysis.Take the 1-in the same strain of Fructus Lycopersici esculenti CLN2777A 7 leaves, stem top, stem, flower, alabastrum, fruit, cortex and root, rapidly as freezing in liquid nitrogen.Test kit is extracted with RNA (sky root, DP419) extracts sample total serum IgE, obtains for Real time RT-with Reverse Transcription box (Vazyme, R123-01) The cDNA template of PCR.

Design primer 80F:5'-GAATCACTTTGTCCAAACTTGGAAG-3 ',

LeAct1 is expanded by 80R:5'-CTCCAATAAATGATGGCACAAGAAA-3 '.

Fructus Lycopersici esculenti internal reference primer is JAGN1015:5'-TGGTCGGAATGGGACAGAAG-3 ',

JAGN1016:5'-CTCAGTCAGGAGAACAGGGT-3 ' (actin:AB199316).

PCR system is: cDNA template 1ul, Primer F 0.5ul, Primer R 0.5ul, SYBR Premix ExTaqTM II Kit (2 ×) 7.5ul, ddH2O up to 15ul.PCR program is: 95 DEG C of 1min, 95 DEG C of 15s, 60 DEG C of 20s, 72 DEG C of 20s, 40 circulations.Quantitative PCR apparatus is qTOWER 2.0/2.2 (Analytik jena, Germany), utilizes 2^-ΔΔCTSide Method calculates the relative expression quantity of gene, and all of quantitative test at least detects and repeats 3 biologys.

LeAct1 expression in blade is low compared with its hetero-organization, the higher (figure of expression in alabastrum, cortex and root 4).It addition, expression analysis result shows in disease-resistant material, after TYLCV processes 3d, LeAct1 gene expression amount increases, and raises Express, and within 5 days, reach the highest after treatment, recover original expression (Fig. 5) subsequently.LeAct1 response TYLCV induction, explanation This gene is relevant to anti-TYLCV effect.

3, the Subcellular Localization of LeAct1

Utilize the instantaneous Subcellular Localization infecting analysis LeAct1 of Nicotiana tabacum L..Design primer according to sequence SEQ ID NO.1, and drawing Thing adds KpnI and SalI endonuclease recognized site.

JAGN2488:5 '-CGGGGTACCATGAATGTGAAAATTGATAG-3 ',

JAGN2489:5 '-ACGCGTCGACCTTTGCTTTCAAATCTAGAG-3 '.With this to primer amplification Fructus Lycopersici esculenti CLN2777A CDNA.With KpnI and SalI simultaneously enzyme action pcr amplification product and GFP carrier (Liu T, Guo S, Lian Z, Chen F, Yang Y,Chen T,Ling X,A P4-ATPase Gene GbPATP of cotton confers chilling Tolerance in plants.Plant Cell Physiol., 2015,56 (3): 549-57), reclaim digestion products and use T4 Ligase connects.Recombinant vector is converted by recombinant vector freeze-thaw method achieved above Agrobacterium GV3101.Use suspension (10mM MES pH5.7,10mM MgCl2,200 μMs of acetosyringone) suspension Agrobacterium thalline, regulates OD600= 0.5, inject Ben Shi Tobacco Leaves.48h is placed on fluorescence microscopy Microscopic observation.Positioning result shows that this gene is positioned at nucleus with thin On after birth (Fig. 6).

4, the Gene Silencing (VIGS) of LeAct1 gene is analyzed

Based on Tobacco rattle virus (TRV), carrier (Chen T, et al., 2013) builds the virus induction of LeAct1 gene Gene silencing vector.Design primer according to sequence SEQ ID NO.1, and in primer, add the knowledge of BamH I and Xba I restriction endonuclease Other site,

JAGN1080:5'-CATGGATCCTCAACCAACTATCAACTTCCAA-3 ' and

JAGN1081:5'-TTGTCTAGAGGAAGGAGAAGAATTATACCTAGG-3’.With this to primer amplification Fructus Lycopersici esculenti The cDNA of CLN2777A.With BamH I and Xba I enzyme action pcr amplification product and TRV2 simultaneously, reclaim digestion products and use T4ligase connects.Recombinant vector is converted by recombinant vector freeze-thaw method achieved above Agrobacterium GV3103.Select the positive Clone shakes bacterium, 4000rpm 5min RT centrifugal thalline of collecting during logarithmic (log) phase, and with suspension (10mM MES pH5.7,10mM MgCl2,200 μMs of acetosyringone) suspension Agrobacterium thalline, OD600=2.0, it is little that room temperature 30-50rpm cultivates at least 4 More than time, TRV1 and TRV2:LeAct1 bacterium solution 1:1 is mixed for plant inoculating, and arranges PDS (phytoene dehydrogenase) Control test silencing system success or not.After Fructus Lycopersici esculenti is unearthed, true leaf grows front inoculation Agrobacterium, takes the disposable injection of a 1ml Device, draw bacterium solution, cotyledon back with bacterium solution syringe needle sting several under, then touch needleless needle tubing injection, inoculation is planted Strain is placed in insect protected greenhouse, 23 DEG C, cultivate under 16h illumination.After 15 days, the plant of injection PDS shows obvious albefaction, explanation Silencing system success.Extract the blade RNA of injection TRV2:LeAct1, utilize Real time RT-PCR to detect silence efficiency.Knot Fruit shows, the expression of genes of interest is only injects about the 40% of empty vector control plant, and illustration purpose gene is effectively sunk Silent (Fig. 7 A).LeAct1 gene silencing and adjoining tree are inoculated simultaneously TYLCV infectious clone (Yuan Hongbo, Guo Jiaru, what Ice, Chen emperor, Yang Yuwen, Wu Dan, Zhang Baolong, Liu Aimin.Tomato yellow leaf curl virus infectious clone transformation of tobacco is utilized to obtain Obtain resistant mutant.Jiangsu's agriculture journal, 2012,28 (6): 1241-1246).Extract after 15 days blade STb gene (sky root, DP320), Real time PCR detection virus number is utilized.The primer of amplicon virus coat protein is

JAGN2126:5'-GGATTTCGTTGTATGTTAGC-3 ',

JAGN2127:5'-ATGATTATATCGCCTGGTC-3 ', Fructus Lycopersici esculenti reference gene is JAGN1015 and JAGN1016.Quantitatively After result shows LeAct1 gene silencing, the viral number of plant is about 30 times (Fig. 7 B) of comparison.Meanwhile, turning round occurs in blade The deformity phenotype such as song, shrinkage, illustrates that the disease resistance of plant is remarkably decreased (Fig. 8).VIGS result shows LeAct1 and CLN2777A Resistant effect closely related.

5, the structure of LeAct1 gene plant expression vector and Plant Transformation

In order to study the function of LeAct1, design primer according to sequence SEQ ID NO.1, and in primer, add Sma I and Sac I endonuclease recognized site,

JAGN2347:5'-tgacccgggTGCCTAGTATTCATATTCACATCAC-3’；

JAGN2348:5'-actgagctcTTGTATGATAAAGGCAGAAGACT-3’.With this to primer amplification Fructus Lycopersici esculenti The cDNA of CLN2777A.With Sma I and Sac I enzyme action pcr amplification product and PCAMBIA2301 simultaneously, reclaim digestion products and use T4ligase connects.Recombinant vector is converted Agrobacterium LBA4404 by recombinant vector freeze-thaw method achieved above.Use Agrobacterium Mediated method conversion Ben Shi cigarette (Zhang Baolong, Yang Yuwen, Ni Wanchao, Hou Jibo. turn the research of H5 avian influenza virus M2e genetic tobacco. Jiangsu's agriculture journal, 2010,01:51-54).With CTAB method extraction T0 for individual plant, primer JAGN2347 and JAGN2348 is utilized to exist On DNA level, whether testing goal gene proceeds to, the most successful table of primer 80F and 80R testing goal gene on rna level Reach.All can expand acquisition fragment on DNA and rna level is then considered as positive transformants.

DNA cloning identifies 2Kb size fragment, identifies positive plant 9 strain (Fig. 9 A).Recycling Real time RT-PCR inspection Surveying the expression of exogenous gene, strain 5,6, the expression of 10,15 is higher, for candidate's strain (Fig. 9 B) of research further. Divide individual plant results tobacco seed.T1 is tied up to the enterprising row filter of MS culture medium containing 40mg/L kanamycin for transgenic line, Select green plant to transplant to continued growth in Nutrition Soil and for Disease Resistance Identification.

6, the Disease-resistance Analysis of LeAct1 process LAN Nicotiana tabacum L.

Transfer-gen plant carries out preliminary Resistance Identification, and Verticillium Dahliae strain used is defoliation High pathogenicity bacterial strain V991 (Xu Rongqi, Wang Jiani, Chen Jieyin etc. verticillium dahliae T-DNA insertion mutation body phenotypic characteristic and flanking sequence analysis. in State's agricultural sciences, 2010,43 (3): 489-496；Zhang Tianzhen, Zhou Zhaohua, Min Liufang, etc. the Cotton Gossypii genetics of resistance to verticillium wilt Pattern and the breeding technique of anti-(resistance to) sick kind. Acta Agronomica Sinica, 2000,26 (6): 673-680).Pathogen activates through PDA plate After, put into PDB culture fluid from colony edge picking truffle, 25 DEG C, 120r min cultivates 5-6d, uses filtered through gauze culture fluid, mirror Inspection also counts with blood counting chamber, and adjusting spore concentration is 1 × 107, qualification strain number 40 strain of every kind of pathogen, every day after inoculation A situation arises to observe disease, the most just can substantially see disease symptom, mainly show as yellowing leaf, wilts, raw Length delays.With reference to Cotton Gossypii and arabidopsis verticillium wilt grade scale, Nicotiana tabacum L. verticillium wilt is carried out classification.It is divided into 0～4 grade 5 marks Standard, wherein 0 grade is normal plant, and below 25% blade, morbidity is 1 grade, and 25%～50% blade morbidity is 2 grades, 50%～75% Blade morbidity be 3 grades, 75% with blade morbidity or death be 4 grades.Disease Resistance Identification result shows, for defoliation verticillium wilt V991, comparison wild type disease refers to reach 85.36%, and the disease of 3 transgenic lines refers to only 24.35%, 38.19% He 58.33% (Figure 10 A).Extract transgenic tobacco plant DNA further, and by PCR, the mycelia of the arabidopsis of morbidity is carried out Quantitatively.Data display quantitative result is consistent with phenotype, and the hyphae content in the transfer-gen plant of inoculation V991 is only wild type to be intended South mustard about 30%-50% (Figure 10 B).Show that LeAct1 can be obviously enhanced the Ben Shi cigarette resistance (figure to Strain of Defoliating Type V991 10C)。

Transgenic Ben Shi cigarette plant is inoculated TYLCV infectious clone, after inoculating 15 days, extracts blade STb gene detection virus Relative amount, Real time PCR amplification shows, the viral number of 4 transgenic lines the most relatively compares and significantly reduce (figure 11).Show that LeAct1 can be obviously enhanced the Ben Shi cigarette resistance to TYLCV.

7, LeAct1 promoter feature analysis

In order to study the promoter feature of LeAct1, design primer according to SEQ ID NO.3, and in primer, add Hind III He BamH I endonuclease recognized site, utilizes primer

JAGN2372:5'-CATAAGCTTATAATTGTGGCCCTAAAGCATTGTT-3 ',

The DNA of JAGN2373:5'-AACGGATCCTAGTTCCTGTCCTCAGAACCCATT-3 ' amplification Fructus Lycopersici esculenti CLN2777A, uses Hind III and BamH I enzyme action pcr amplification product and PBI101 simultaneously, reclaim digestion products and connect with T4ligase.More than Jiang Recombinant vector is converted Agrobacterium GV3101 by the recombinant vector PBI101:pLeAct1 freeze-thaw method obtained.Build TYLCV simultaneously The plant expression vector of related gene, primer is as shown in table 1, and restriction enzyme site is KpnI/BamHI.With KpnI and BamHI enzyme simultaneously Cut pcr amplification product and GFP carrier (Liu T, Guo S, Lian Z, Chen F, Yang Y, Chen T, Ling X, A P4- ATPase Gene GbPATP of cotton confers chilling tolerance in plants.Plant Cell Physiol., 2015,56 (3): 549-57), reclaim digestion products and connect with T4ligase.By recombinant vector achieved above With freeze-thaw method, recombinant vector converted Agrobacterium GV3101.

Table 1 builds TYLCV related gene plant expression vector relevant primer

Primer	Primer sequence
		JAGN2084_V2F	CGGGGTACCATGTGGGAcCCACTTCTA
JAGN2085_V2R	CGCGGATCCGGGCTTCGATACATTCTG
		JAGN2086_V1F	CGGGGTACCATGTCGAAGCGACCAGGC
JAGN2087_V1R	CGCGGATCCATTTGATATTGAATCATAGAAATA
		JAGN2088_V3F	CGGGGTACCATGGATTCACGCACAGGG
JAGN2089_V3R	CGCGGATCCATAAAATTTATATTTTATATCATGA
		JAGN2090_AC2F	CGGGGTACCATGCAACCTTCGTCACCC
JAGN2091_AC2R	CGCGGATCCAATACTCTTAAGAAACGACC
		JAGN2092_C1F	CGGGGTACCATGCCTCGTTTATTTAAAATA
JAGN2093_C1R	CGCGGATCCCGCCTTATTGGTTTCTTC
		JAGN2094_AC4F	CGGGGTACCATGGGGAACCACATCTCC
JAGN2095_AC4R	CGCGGATCCATATATTGAGGGCCTCGG

Select positive colony and shake bacterium, and with suspension suspension Agrobacterium thalline, OD600=0.5, room temperature 30-50rpm is cultivated at least More than 4 hours, PBI101:pLeAct1 is mixed with the expression vector 1:1 of TYLCV related gene respectively, and it is instantaneous to carry out Nicotiana tabacum L. Infect.Compareing of PBI101:pLeAct1 with GFP mixing is set simultaneously.After injection 48h, take blade and carry out GUS dyeing, specifically side Method is: GUS histochemical stain is made with 5-bromo-4-chloro-3-indolyl β-Dglucuronic acid (X-Gluc) For substrate.By tobacco leaf with after the abundant desolventing technology of acetone of 90%, it is immersed in GUS reactant liquor (containing 50mmol/L phosphoric acid Sodium buffer (pH 7.0), 10mmol/L EDTA, the 2mmol/L potassium ferricyanide, 2mmol/L potassium ferrocyanide, 2.0mmol/L X- Gluc and 0.2%Triton X-100), 37 DEG C of incubations 1～3 days, until coloring reaches sufficient intensity.GUS coloration result shows, TYLCV related gene all can induce the promoter (Figure 12 A) of LeAct1.Extracting the Nicotiana tabacum L. RNA of injection point, reverse transcription is laggard simultaneously Row Real time RT-PCR analyzes.Amplification demonstrates the result that GUS is quantitative, and shows wherein C1, and AC2 induction is the most aobvious Write (Figure 12 B).PLeAct1 responds TYLCV related gene, further demonstrates this gene closely related with the resistance of TYLCV.

<110>Jiangsu Province Agriculture Science Institute

<120>a kind of gene for improving disease resistance of plant and application thereof

<130>

<160> 31

<170> PatentIn version 3.3

<210> 1

<211> 4303

<212> DNA

<213>artificial sequence

<400> 1

ataattgtgg ccctaaagca ttgttcattg acaccccact cccaccatgt tcagaacgtg 60

ttttacaaaa ggcataataa ataaatatac cttttaactt gatttcaaat tgcagttatg 120

ttttttaatt ttagtgtaca taattaaata gttaaatttg tataaaatta aataaataga 180

cacacatgtc ttatatgtca ttttttatcc tacgtagtgt cgtatgtgta ttttgctatg 240

tagaaattat ttgcttattt atttaaaagt tggatagtta aagtgtctgt ttgttcatta 300

tgaaaattaa agatcaaagt taaaatttaa aatcaagttt agaatccgat atatgtatta 360

tgcctttata aaatgatata aaagaagata aagatgtttt gaaaaatagc tatcacttgt 420

cagtaaggat agatatgata tgatatatat tgaattatta tattatatcg aaatttttaa 480

taattatgaa attcgacaag gtatatggta tagattttaa atatttttca cgtttggtat 540

gatatttggt agttggaaac aatatattaa accatatcga agcatatagt tacataatat 600

aaactaaaag ttttagaaaa ttttgactat tctattttaa ttgaaattaa tatatccaaa 660

taaaattgat taacacagta gtttgtattt cttttggaat taatatatat atttcaacat 720

gtgtaatata ttagtaatta atatgataca gttgagactc cttttcgaat tttgaagtca 780

taacacttta ctatacgagt atatattacg aagataaata aattataatt atcaatttac 840

catattgtaa aacactaaaa ttaaaaattt atataaatag ataaattctt ttaaagatat 900

caatatttta tgtatttctc gaacataaaa tatactagct cataatttta caaaattctc 960

aatttcactt ctacagagag tttcttaagg ttcgacctac cctaattgga ttgtaaaata 1020

catggacatt tgtgagcatt tgcatgagat aatataataa aaaattttac taaaaaattt 1080

atcatgaact atttaatttg tattttaaag gtagtttaaa gccaaataaa ataattaaac 1140

caatattaaa gttcattaaa aaaaatacaa gaaataatct tctttctcat tctcctatag 1200

tcattttttt aatcactcca agtgaaccat aaagttttaa agtttattcc aataatctct 1260

ttatttaaca aaaaaaaaaa ggtgaatagt caccttgtta taatttatat gtcttaattt 1320

atttagttta acatatattt tatgtttaat acataatatg ttaaacaata taatatacaa 1380

gaaatatctt cttattttct aaaattttgt gatcaatatt taattaagga ataaagcata 1440

aagatccctc tagaatatga ttaaaatttc acatatatat atcttaacta aactaaggtc 1500

ttattatttt gagaactaat ttatttttta attttataca ctgtttgact tacgtgacac 1560

actatgtgat tctatgtagt tgagacacat gggaggtgtt tcaatgtcac gtaaaccaac 1620

aatgcgtaca aaattagaat aaatgggttc tgaggacagg aactaataga accttaattt 1680

tgttaaaaag ggtgtctttg aaatttcgat aataatatag ggatactttt ggcaagacat 1740

ataacatgaa atatgtggaa gaatttcttt aatactacta acaaataaga caaaagtgtt 1800

agtactcaca ttatatttat aataataaca cttccatcaa aaccataaac aaagacatat 1860

ataatgccta gtattcatat tcacatcaca taaagaatac ctctatagag aagaaagcac 1920

ctaaaaaaat ttagtagcca tgcctagtat tcatattcac atcacacaaa gaatacctct 1980

atagagaaga aagcacctaa aaaaatttta gtagccatga atgtgaaaat tgatagttca 2040

aaaatcatca agccactata tgaaggaact cctccttcaa ctacaactca tattcctttc 2100

aatatctttg acaatgtaac atttgatgct ctaatggctc taatatatgc ctatagacca 2160

cccacccctc ccacatccac tattgaaata ggacttcgaa agacgttatc gatttatcga 2220

gagtgggcag gaagaatagg tgaagatgaa catggtaatc gaggagtttt tctcaatgat 2280

gagggtgttc gattcatcga ggcgtctgtg gacacctcat tggatgaagt attgccctta 2340

aagccttcgc cctctatgct ctccttgcat cctagcttaa aggatgtagt ggagttaatc 2400

caagtccaag tcacacgttt cacgtgtggc tctgtggtgg tcggtttcac cggccaccac 2460

atgatagctg acggccatgc tgcaagcaac ttttttgtcg cgtggggtca agcatgccga 2520

gggatggaaa ttacacccct cccggtgaac gaccgtacta ttttccgccc tcgggatcca 2580

cccctcgtcg agtataacca tgttggggcc gaattcgtgt ccaaattagt aaacaaggag 2640

ttagtcaaag tcaacaacga tgaatgtaaa gagaagaata tcatagtcca caaagtccat 2700

ttcaccttgg agtacctaag gaaactcaag gcgcatgctt cttttatgaa cgaaaatgcc 2760

aaaacttata gcacgttcga aagtctaata gcccatttgt ggagggttat tacaaaattg 2820

cgtgacttaa acgcatttca gaacacccaa attcgaatat cggtcgatgg aaggagaaga 2880

ataacaccta gggttccgga tgaatttttt ggtaacatag tgttatgggc atttccaaca 2940

tcaaaagtga aggacttact agatgagcca cttcactatg caacaaagat tatacatgag 3000

gcaattagta aagttgatga caaatatttc aagtcattta ttgactttgc aaatgatgaa 3060

aaagtgatga ctagacaaga tttaatacca agtgcaaaca tgaacaatga atcactttgt 3120

ccaaacttgg aagttgatag ttggttgagg tttccatttt atgacttgga ttttggtact 3180

ggttgcccat ttgtgtttat gccttcttat tatccaatag aagggatgat gtttcttgtg 3240

ccatcattta ttggagatgg aagcattgat gcttttattc ctttatatga acacaatcta 3300

acaaatttca acaaaatttg ttactctcta gatttgaaag caaagtgaga agacctactt 3360

atggggtagg tggggtgggg gtgtttttgg tattttttgt tgtttttagt atattttgtt 3420

gtttaataac caaaagtaat taaaactttt ggttattatt tttatgtaat gtcatgttga 3480

tgatctatga gttttggaga agaagtttaa attggcattt ctttgtgatt ttatttatag 3540

tattacttgt ctaattttct attttatttg tttattttga caaattaaga aaggataatt 3600

tttttttatc tattatatcc tcaattaatt attttgaaaa aggtaaaact tctaaaaatt 3660

ttaaattttt tattcatcca cttcataatt aatatggata aaaaagataa acacattatg 3720

ttaatttttt ttattattat tattatgtta attcaaaagt gaacaagtaa ttatgaatat 3780

aaagagtata tattagtgat tgatgaatat tgcttggttg tttttctatt tctaaaatta 3840

taaatttatg aactgatttt gtaatttcta ttaattttca taagtagttc attttagtct 3900

tctgctttta tcatacaagg aatcacatat aagttctcta ttttatgtca aattaattaa 3960

aataattagt ctcacttaga ctaatttatt gatgtgtgta gatacattga atctttttgg 4020

aactattttc ttcttcttta attctagcaa attcttgtgg aaatttaatt tctttgtagt 4080

gattgacata tttattggga aaaaaaatta attacatcaa atgagacaat tttaaccaag 4140

aaaaatatgc atagttcttt ttaaaaaatc atttctcttt ccatagtctt tcaaagaaaa 4200

atttgcatgg ggcaattaat gacttaaaat tacaattatt tcaccatatg aaaccaaaaa 4260

tgaaagtcat gtcaaatatg gaaataccct accacctttg tcc 4303

<210> 2

<211> 23

<212> DNA

<213>artificial sequence

<400> 2

ggacaaaggt ggtagggtat ttc 23

<210> 3

<211> 25

<212> DNA

<213>artificial sequence

<400> 3

tgcctagtat tcatattcac atcac 25

<210> 4

<211> 24

<212> DNA

<213>artificial sequence

<400> 4

tagttcctgt cctcagaacc catt 24

<210> 5

<211> 25

<212> DNA

<213>artificial sequence

<400> 5

ataattgtgg ccctaaagca ttgtt 25

<210> 6

<211> 25

<212> DNA

<213>artificial sequence

<400> 6

gaatcacttt gtccaaactt ggaag 25

<210> 7

<211> 25

<212> DNA

<213>artificial sequence

<400> 7

ctccaataaa tgatggcaca agaaa 25

<210> 8

<211> 20

<212> DNA

<213>artificial sequence

<400> 8

tggtcggaat gggacagaag 20

<210> 9

<211> 20

<212> DNA

<213>artificial sequence

<400> 9

ctcagtcagg agaacagggt 20

<210> 10

<211> 29

<212> DNA

<213>artificial sequence

<400> 10

cggggtacca tgaatgtgaa aattgatag 29

<210> 11

<211> 30

<212> DNA

<213>artificial sequence

<400> 11

acgcgtcgac ctttgctttc aaatctagag 30

<210> 12

<211> 31

<212> DNA

<213>artificial sequence

<400> 12

catggatcct caaccaacta tcaacttcca a 31

<210> 13

<211> 33

<212> DNA

<213>artificial sequence

<400> 13

ttgtctagag gaaggagaag aattatacct agg 33

<210> 14

<211> 20

<212> DNA

<213>artificial sequence

<400> 14

ggatttcgtt gtatgttagc 20

<210> 15

<211> 19

<212> DNA

<213>artificial sequence

<400> 15

atgattatat cgcctggtc 19

<210> 16

<211> 34

<212> DNA

<213>artificial sequence

<400> 16

tgacccgggt gcctagtatt catattcaca tcac 34

<210> 17

<211> 32

<212> DNA

<213>artificial sequence

<400> 17

actgagctct tgtatgataa aggcagaaga ct 32

<210> 18

<211> 34

<212> DNA

<213>artificial sequence

<400> 18

cataagctta taattgtggc cctaaagcat tgtt 34

<210> 19

<211> 33

<212> DNA

<213>artificial sequence

<400> 19

aacggatcct agttcctgtc ctcagaaccc att 33

<210> 20

<211> 27

<212> DNA

<213>artificial sequence

<400> 20

cggggtacca tgtgggaccc acttcta 27

<210> 21

<211> 27

<212> DNA

<213>artificial sequence

<400> 21

cgcggatccg ggcttcgata cattctg 27

<210> 22

<211> 27

<212> DNA

<213>artificial sequence

<400> 22

cggggtacca tgtcgaagcg accaggc 27

<210> 23

<211> 33

<212> DNA

<213>artificial sequence

<400> 23

cgcggatcca tttgatattg aatcatagaa ata 33

<210> 24

<211> 27

<212> DNA

<213>artificial sequence

<400> 24

cggggtacca tggattcacg cacaggg 27

<210> 25

<211> 34

<212> DNA

<213>artificial sequence

<400> 25

cgcggatcca taaaatttat attttatatc atga 34

<210> 26

<211> 27

<212> DNA

<213>artificial sequence

<400> 26

cggggtacca tgcaaccttc gtcaccc 27

<210> 27

<211> 29

<212> DNA

<213>artificial sequence

<400> 27

cgcggatcca atactcttaa gaaacgacc 29

<210> 28

<211> 30

<212> DNA

<213>artificial sequence

<400> 28

cggggtacca tgcctcgttt atttaaaata 30

<210> 29

<211> 27

<212> DNA

<213>artificial sequence

<400> 29

cgcggatccc gccttattgg tttcttc 27

<210> 30

<211> 27

<212> DNA

<213>artificial sequence

<400> 30

cggggtacca tggggaacca catctcc 27

<210> 31

<211> 27

<212> DNA

<213>artificial sequence

<400> 31

cgcggatcca tatattgagg gcctcgg 27

Claims

1. the gene being used for improving disease resistance of plant, it is characterised in that this gene is:

1) sequence DNA sequence as shown in SEQ ID NO.1；Or

Gene for improving disease resistance of plant the most according to claim 1, it is characterised in that described high high stringency conditions For: 0.1 × SSPE, 0.1 × SSC, 0.1% SDS solution in, wash film under the conditions of 65 DEG C.

3. a recombiant plasmid, it comprises the gene for improving disease resistance of plant described in claim 1.

4. a recombinant bacterium, it contains the recombiant plasmid described in claim 3.

5. described in claim 1, it is used for the gene improving disease resistance of plant application in improving disease resistance of plant.

Application the most according to claim 5, it is characterised in that the gene transformation importing being used for improving disease resistance of plant is subject to In body Plant Genome, express gamatine transferring enzyme, improve the resistance against diseases of recipient plant.

Application the most according to claim 6, it is characterised in that described resistance against diseases refers to anti-tomato yellow leaf curl or cotton The ability of flower droop.

Application the most according to claim 6, it is characterised in that described plant is Nicotiana tabacum L..