CN109762833A - A kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene and its application - Google Patents

Abstract

The invention discloses a kind of Aegilops varibilis phenylalanine lyase nucleic acid sequence and its application, the Aegilops varibilis Phenylalanine Ammonia-Lyase Gene nucleic acid sequence is as shown in SEQ ID NO.1.Aegilops varibilis Phenylalanine Ammonia-Lyase Gene of the present invention encodes a phenylalanine lyase, and anti-cereal cyst nematode performance is high, has important references and application value to the anti-cereal cyst nematode breeding of wheat.

Description

A kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene and its application

Technical field

The present invention relates to phenylalanine lyase fields, are specifically related to a kind of Aegilops varibilis phenylalanine lyase core Acid sequence and its application.

Background technique

PAL (Phenylalanine Ammonia-Lyase, phenylalanine lyase) is in phenylpropyl alcohol alkane metabolic pathway One enzyme and key enzyme, it is catalyzed L-phenylalanine and is converted into trans-cinnamic acid.Trans-cinnamic acid is again through downstream different metabolic Branch is separately converted to the secondary metabolites such as anthocyanidin, lignin, Flavonoid substances, phytoalexin, some of substances It is reported in plant disease-resistant and works.

PALs in plant is the homologous heterogeneous albumen encoded by multigene family, they have respective expression characteristic And function is also not exactly the same.1961, Conn and Koukol had found in barley seedlings for the first time and have isolated and purified out PAL, Hereafter the research of PAL is gradually spread out, constantly improve raising with isolation and purification method technology, successfully from other plants PAL albumen, such as wheat, soybean, poplar etc. have been isolated and purified out in object.

The expression of PAL and bioactivity can change with biological development, external environment stimulation changes.Salt stress can swash The expression of crowtoe PAL gene living, and lead to the accumulation of phenolic substances.In tobacco, in the processing such as NaCl, mannitol, low temperature Under the conditions of, the significant up-regulation of PAL expression.Low-temperature treatment cucumber seedling, PAL enzymatic activity improve, and promote the conjunction of phenylpropyl alcohol alkyl compound At the removing with intracellular antioxidase to peroxide caused by low temperature.In addition, PAL is also played in plant immune reaction Important role.Tomato by potato cyst roundworm after being infected, and PAL gene expression is significantly raised in tomato resistant variety, and Without significant change in susceptible variety.After infecting gibberella, PAL gene expression increases considerably wheat with PAL enzyme.Pepper Leaves When being infected by Xcv (Xanthomonas campestris pv.Vesicatoria), CaPAL1 is induced.CaPAL1 is heavy Silent pepper plant, when being infected by mortality or non-lethal Xcv, silenced plant shows as easy susceptible type.And CaPAL1 gene is overexpressed in arabidopsis, be overexpressed plant show to Pseudomonas syringae pv. tomato and The resistance of Hyaloperonospora arabidopsidis.Soybean GmPAL2.1 gene is by soyabean phytophthora induction significantly It adjusts, the resistance for turning the anti-Phytophthora sojae of soybean plant strain of GmPAL2.1 gene significantly improves.PAL enzymatic activity is turning It is significantly improved in transgenic soybean plant, activity is lower in GmPAL2.1 silencing plant, while detecting discovery and being overexpressed In GmPAL2.1 soybean plant strain, Daidzein (daidzein), genitein (genistein) and SA (salicylic acid) Content dramatically increases, and the increase of these substances and GmPAL2.1 gene are participating in soybean regulation to Phytophthora Serve in the resistance of sojae positive.Although the biological function of PAL is constantly studied and reports, so far, do not report yet Whether road PAL gene participates in the reaction of Genes For Plant Tolerance cereal cyst nematode.

Aegilops varibilis (Aegilops variabilis) is the nearly edge species of wheat, has drought resisting, stripe rust resisting, resists The characteristics such as worm can produce fertile offspring when carrying out distant hybridization with wheat, be the excellent resources of genetic improvement of wheat.Variable goat Grass is to cereal cyst nematode (H.avenae, cereal cyst nematode, CCN), root-knot nematode (Meloidogync Naasi) there is high resistance.

Summary of the invention

In order to solve the above technical problems, the present invention provides a kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene and its answers With after carrying out gene silencing, it is significant that the expression that Resistance Identification discovery reduces PAL gene will lead to root cereal cyst nematode number Increase；Binary expression vector is constructed, which is overexpressed in wheat, Resistance Identification is the result shows that PAL is overexpressed wheat pair The resistance of cereal cyst nematode significantly improves；And not influence vegetation growth of plant in the case where, reduce cereal cyst nematode cause The underproduction.

One of present invention of above technical problem Aegilops varibilis Phenylalanine Ammonia-Lyase Gene is solved, feature exists In: the Aegilops varibilis Phenylalanine Ammonia-Lyase Gene nucleic acid sequence is as shown in SEQ ID NO.1.

Aegilops varibilis phenylalanine lyase (AeVPAL) gene is cloned for the first time in the present invention, and nucleic acid sequence has uniqueness Property, there is sequence phenylalanine to crack enzyme domains, not be homologous or approximate with other Aegilops varibilis anti insect genes.

A kind of application of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene in the present invention, in wheat breeding or anti-cereal spore Application in capsule nematode.

The amino acid sequence of the Aegilops varibilis phenylalanine lyase is as shown in SEQ ID NO.2.

The AeVPAL complete encoding sequence amplimer sequence:

PAL-1:ATGGCCACTAATGGCAACGAC；PAL-2:TTAGCAGATAGGCAGGGGCTC；

AeVPAL VIGS fragment amplification primer sequence:

OHL087:CTAGCTAGCTAGACAACGTGGAAACCTCGGT；

OHL088:CTAGCTAGCTAGAGTAAACTGTGCCCAGCTC。

AeVPAL nucleic acid sequence overall length 2124bp in the present invention, 707 amino acid of sequential coding, albumen 76.3kDa.

The present invention is based on the coded sequence design primers of PAL in nearly edge species (barley, wheat, Triticum tauschii), with variable mountain The cDNA of No. 1 material of sheep's hay is template, carries out homologous clone, obtains full length sequence.Gene silencing primer is designed, by silencing segment It is connected into VIGS (Virus-induced gene silencing) carrier, after carrying out gene silencing, Resistance Identification discovery reduces PAL The expression of gene will lead to root cereal cyst nematode number and dramatically increase；Binary expression vector is constructed, by the gene in wheat Middle overexpression, Resistance Identification is the result shows that AeVPAL overexpression wheat significantly improves the resistance of cereal cyst nematode.

Aegilops varibilis Phenylalanine Ammonia-Lyase Gene encodes a phenylalanine lyase, anti-cereal spore in the present invention Capsule nematode ability is high, to wheat breeding and improves the anti-cereal cyst nematode ability of wheat with important references value.

Detailed description of the invention

Infect cereal cyst nematode staining conditions and statistical results chart in Fig. 1 AeVPAL silencing plant root

(wherein in figure: A is the cereal cyst nematode situation map that adjoining tree root is infected, and B is AeVPAL silencing plant root The cereal cyst nematode situation map that portion is infected, the expression quantity that C is AeVPAL in AeVPAL silencing plant root, which is substantially less than, to be compareed Plant figure, D are that the CCN number infected in AeVPAL silencing plant root is significantly more than adjoining tree figure)

Fig. 2 AeVPAL overexpression wheat root infects cereal cyst nematode number and compares figure

(wherein in figure: A is transgenic wheat Line15,18 and control Wheat volatiles AeVPAL primer amplified Electrophoresis result, B be transgenic wheat Line15,18 and control wheat in AeVPAL expression quantity comparison figure, C be transgenosis it is small Wheat Line15,18 and control wheat root infect the statistical comparison figure of cereal cyst nematode number)

Specific embodiment

Invention is further explained With reference to embodiment:

Wherein, used material and reagent are as follows:

Vegetable material: Aegilops varibilis 1 (derives from Chendu Inst. of Biology, Chinese Academy of Sciences laboratory), Fielder wheat (being given by academy of agricultural sciences, Shandong Province crop).

The primer sequence, see the table below 1.

Table 1

Reagent: Total RNAs extraction Trizol kit is purchased from TIANGEN company；DNA Marker,pEASY-T1 cloning Kit, pEASY-Blunt E1Expression Kit, QPCR mix are Quan Shi King Company product；KOD high fidelity enzyme, reversion Recording kit is TOYOBO Products.External RNA synthetic agent box is purchased from Promega company.Plant leaf blade Direct PCR reagent Box is Foregene company.Acid fuchsin is traditional Chinese medicines product.Restriction enzyme is purchased from NEB company.

Embodiment 1

The amplification of Aegilops varibilis PAL complete encoding sequence and plant Total RNAs extraction and reverse transcription:

(1) No. 1 seed of Aegilops varibilis is impregnated in water, places 4 DEG C of refrigerators and is uniformly elaborated after 2 days, then by seed It is placed on the filter paper of constant moisture in the culture dish of 5cm diameter, in the periodicity of illumination environment of 24 DEG C or so of room temperatures and 16h/8h Issue seedling.

(2) clip sends out 20 days after kind seedling roots, mills in liquid nitrogen, extracts total serum IgE by Trizol reagent protocol.

(3) cDNA is synthesized referring to TOYOBO Reverse Transcription method reverse transcription

The amplification of Aegilops varibilis PAL complete encoding sequence and silencing segment:

Using reverse transcription product cDNA as template, using two pairs of different primers expand respectively AeVPAL complete encoding sequence and AeVPAL gene silencing segment, 1799~1990 sections of AeVPAL full length sequence are amplified for silencing AeVPAL gene, with Reduce the expression of AeVPAL gene.Wherein AeVPAL complete encoding sequence amplimer sequence:

PAL-1:ATGGCCACTAATGGCAACGAC；PAL-2:TTAGCAGATAGGCAGGGGCTC.

AeVPAL gene silencing fragment amplification primer sequence:

OHL087:CTAGCTAGCTAGACAACGTGGAAACCTCGGT；

OHL088:CTAGCTAGCTAGAGTAAACTGTGCCCAGCTC。

Amplification reaction system is as follows:

PCR amplification program condition is 94 DEG C of 2min；98 DEG C of 10s, 55-62 DEG C of 30s, 68 DEG C of 1min/kb, 38 are followed Ring；Last 68 DEG C of extensions 10min.

Embodiment 2

AeVPAL VIGS vector construction and VIGS (virus induced gene silencing) inoculation:

(1) BSMV- α, BSMV- β, γ: GFP plasmid of BSMV- are placed in spare in -20 DEG C of refrigerators.

(BSMV- α, BSMV- β, γ: GFP plasmid origin of BSMV- are in genetic development research institute, the Chinese Academy of Sciences.)

(2) digestion of target fragment and BSMV carrier:

Digestion target fragment (the silencing segment with restriction enzyme site): restriction enzyme site is NheI point.

γ: GFP plasmid of digestion BSMV-:

Operating procedure are as follows: 37 DEG C of temperature, after digestion in 5 hours, run glue recovery product.Recycling step is Ago-Gel electricity Operating procedure in kit specification of swimming.Digestion is single endonuclease digestion, same as below.Plasmid is cut in digestion, is used for its linearisation It connects below.

Recycling step can be as follows:

1.5% agarose gel electrophoresis of product, comparison DNA Marker cuts purpose band, be transferred to 2mL it is clean from In heart pipe.It is added in the recycling of 600 μ L glue Binding Buffer, with 60 DEG C of water-baths and places 15 minutes by every 100mg gel, every 2- Shake in 3 minutes mixes primary.The gel of thawing is transferred in recovery column, and recovery column is put into collecting pipe, at room temperature 10, 000rpm is centrifuged 1 minute.Recovery column is removed, the solution in collecting pipe is outwelled, recovery column is put into collecting pipe again, is added 700 μ L of Wash solution, 10,000rpm is repeated after being centrifuged 1 minute and be washed once at room temperature.Recovery column is put into another In a clean 1.5mL centrifuge tube, 30~50 μ L Elution Buffer are added on recovery column film, being stored at room temperature 2 minutes, 10,000rpm is centrifuged 1 minute.

(3) connection of target fragment (through NheI digestion silencing segment after the recovery) and BSMV carrier:

It will be through NheI digestion silencing segment after the recovery and through NheI digestion γ: GFP carrier (BSMV of BSMV- after the recovery Silent carrier) it connects, reaction system is as follows:

After standing 2~3 hours in the metal bath that operating procedure is 16 DEG C of temperature, connection product is used as Escherichia coli and is turned Change, carries out plasmid extraction after picking out positive colony.

Escherichia coli step of converting: connection 5 μ L of reaction solution is transferred in 200 μ L of competent escherichia coli cell, mixes, keeps away Exempt to vibrate, be placed 30 minutes on ice.Make competent cell heat shock 90 seconds in 42 DEG C of water-baths, ice bath 5 minutes, then fastly The LB liquid medium 1mL of 37 DEG C of preheatings is added in speed, and centrifuge tube is placed horizontally on 37 DEG C of shaking tables and slowly shakes 45 minutes.Room Lower 4, the 000rpm of temperature is centrifuged 5 minutes, is left about 100 μ L supernatants, so that cell is suspended again with sterile pipette tips, bacterial suspension is applied In on the LB solid plate containing Ampr (100 μ g/mL).In order to be fully absorbed bacterium solution, plate is placed into about 1 minute rear cover On, it is inverted, 37 DEG C of cultures, it is observed that bacterium colony is grown after 12-16 hours.

Plasmid extracts: extracting according to Tiangeng plasmid extraction kit specification.

(4) BSMV virus particle linearized enzyme digestion and recycling:

BSMV- α or BSMV- γ (including silencing segment, i.e. plasmid after AeVPAL silencing segment and BSMV- γ integration) 8 μL(500μg/mL)

Mlu I 1μL

10×buffer 3μL

ddH₂O 18μL

37 DEG C of temperature, the digestion of 8 hours time；

37 DEG C, digestion in 8 hours.

Finally, the recycling of linearized enzyme digestion restrovirus carrier:

With phenol: chloroform: isoamyl alcohol (25:24:1) extracts 1 time, and isometric isopropanol is added, places 1 hour at -20 DEG C, 4 DEG C, 12,000g centrifugations 10 minutes are carefully outwelled supernatant, are precipitated 1 time, 6,000 rpm with 70% ethanol wash, room temperature wink When be centrifuged, place to alcohol volatilization after, be added RNase free water 30-50 μ L dissolution precipitating after, -20 DEG C preservation.

(5) production and inoculation of BSMV virus total RNA:

Using Promega Ribomax RNA mass production kit, it is viral (20 μ L system) to produce BSMV.

37 DEG C of temperature of amplification, proliferation time 3h.

The mixing of viral dip dyeing liquid for shell: it is mixed by each raw material in following system.

Wherein, 2 × GKP buffer formula is as follows:

50mM glycine, 30mM dipotassium hydrogen phosphate, pH9.2,1%bentonite, 1%celite.

Almost the same highland barley two leaves, the one heart stage seedling of growth conditions is chosen, using rubber gloves, above-mentioned virus is disseminated Liquid is inoculated in the base portion of lobus cardiacus, every plant of 8 μ L of seedling inoculation, gently scoops up blade base using rubber gloves when inoculation, causes subtle wound Mouth sprays a small amount of sterile water to seedling using sprayer after inoculation in favor of poisoning intrusion to keep humidity, and use plastics Film closes the seedling after inoculation 3 days.

Plasmid α, β, γ-silencing fragment electrophoretic band of virus linearisation are single.

Embodiment 3

No. 1 PAL gene binary vector con- struction of Aegilops varibilis and the genetic transformation to wheat:

(1) AeVPAL over-express vector constructs:

AeVPAL complete encoding sequence is connected into pLGY02 carrier by exchange reaction, and converts Agrobacterium EA105, is selected Positive Agrobacterium is used for subsequent transformation.Exchange reaction illustrates to operate with reference to Tiangeng company EasyGeno Quick Casting Cloning Kit It forms.PLGY02 carrier derives from academy of agricultural sciences, Shandong Province crop institute.

(2) genetic transformation wheat:

The preparation of agrobacterium suspension: bacterium, 160r, 28 DEG C of cultures are shaken within one day before the test；After wheat tassel is ready to, open Begin to prepare agrobacterium suspension；It takes 1ml bacterium solution in 1.5ml centrifuge tube, 1.4 μ L acetosyringones (0.1M) is added and mix.

It infects: taking the wheat tassel of pollination 15 days or so, carry out stripping embryo after taking grain；Ready bacterium solution is added and infects 5 points Be put into after clock on total training culture medium (crop institute, academy of agricultural sciences, Shandong Province, MS culture medium), 23 DEG C dark culture 3 days.

Rest: it is put into after co-cultivation on rest culture medium (MS culture medium) dark culture 5 days, 25 DEG C；

Screening 1: callus is transferred on screening and culturing medium 1 (MS culture medium)；Culture dish is sealed with sealing film, at 25.5 DEG C Dark culture 2 weeks in incubator.

Screening 2: it is transferred to after callus is cut on screening and culturing medium 2 (MS culture medium)；Culture dish is sealed with sealing film, Dark culture 2 weeks in 25.5 DEG C of incubators.

Regeneration 1: it after callus cutting screening 2 weeks, shows resistant callus and is transferred on regeneration culture medium (MS culture medium)；

Kanamycin-resistant callus tissue generally has green bud perhaps green point or to have beautiful ecru chondritic.It is paste and brown Callus not shift.Smaller callus can be cut into again by having the callus of hyperplasia.Fritter from the same callus (line) is answered This swings on the same line again.The direction of callus is paid attention to, for example, green bud and green point are upward.Culture dish is sealed, 25 DEG C of cultures are put into Illumination (16h) is cultivated 2 weeks in case.

Regeneration 2: after regeneration 2 weeks, the seedling of healthy growth is transferred in new resistance regeneration capsule.It is grown to centainly to seedling Size can be with sample detection.

(3) identification of transformed wheat plant is screened with pure lines:

Transgenic wheat is screened and identified using plant leaf blade direct PCR method.It reflects by single plant sowing and offspring It is fixed, two pure lines are obtained altogether, and Line15, Line18 transgenic positive are sheerly wheat.

Plant leaf blade direct PCR method uses the plant leaf blade Direct PCR kit of foregene company.Operating procedure: it cuts Take 3-5mg leaf tissue (diameter 5-7mm) into 200 μ l or 1.5ml centrifuge tubes.50 μ l Buffer P1 are added, it is ensured that cracking Liquid can be totally submerged leaf tissue.Centrifuge tube lid is covered, is placed it in PCR instrument or metal bath, 95 DEG C of cracking 10min.Add Enter 50 μ l Buffer P2, mixing of being blown and beaten or be vortexed with micropipettor.Gained crack mixed liquor can 4 DEG C save (5 days with It is interior) or directly as template progress PCR reaction.By lysate template, specific primer and amplified reaction mixed liquor by specification It prepares, and carries out PCR amplification.It takes 10 μ l to come out obtained PCR product and runs agarose gel electrophoresis, and take pictures.

Embodiment 4

CCN (wheat cyst roundworm) Resistance Identification:

By the pure lines transgenic wheat (Line15, Line18 transgenic positive are sheerly wheat) and non-transgenic wheat of acquisition (control group) is sowed simultaneously and culture, grew up to for 2 leaf phases to seedling, seedling is moved in sterile soil respectively, carries out after 1 day in root 300 every basins of CCN J2/ of fixed point inoculation, earthing is in 19 DEG C of incubator cultures after inoculation.After inoculation nematode 3 days, take each plant all Root is dyed after cleaning with acid fuchsin, carries out statistics and comparative analysis to the CCN number of dyeing under an optical microscope.

Dyeing course:

Acid fuchsin reservoir: taking 3.5g acid fuchsin to be dissolved in 250ml glacial acetic acid, and rear distilled water to be dissolved is settled to 1L, this It is a to take 1ml to be added in 30~50ml distilled water to use again.

Acid glycerin liquid: 2-3 drop 5M HCl is added dropwise in 20-30ml pure glycerin.

50ml distilled water and 10ml 5.25%NaClO solution (final concentration of 1%), by wash clean are added in beaker Wheat root be respectively put into beaker, NaClO solution will be totally submerged root tissue, be gently mixed root tissue, 5min with glass bar Afterwards, it takes out root tissue and gently rinses 1min with flowing water, then by root bubble 15min in distilled water.

In the beaker that another fills 30-50ml distilled water, 1ml acid fuchsin reservoir is added, is boiled in micro-wave oven, it will Ready root tissue is respectively put into the fuchsin solution boiled before, and middle high fire boils 30s after placing into micro-wave oven, slightly cold But after, root tissue is gently rinsed with flowing water, is put into the beaker equipped with acid glycerin liquid, beaker is put into boiling water, 30s is boiled Root is set to fade, the root tissue after boiling is immersed in be seen in glycerol.

Interpretation of result:

The CCN number that VIGS silencing AeVPAL gene causes root to be infected dramatically increases.

Using BSMV viral vectors (AeVPAL VIGS carrier) to Aegilops varibilis 1 (Ae.variabilis No.1) The AeVPAL gene of plant root carries out silencing, and silencing operating procedure smears repeatedly in the second leaf base gloves and causes wound, Make cell entry.

No. 1 seedling of Aegilops varibilis of one heart stage of two leaves is selected, after two weeks, choose blade has BSMV to invade to inoculation BSMV virus The plant of phenotype is contaminated, there is striped spot in new linear leaf, using AeVEF gene (elongation factor-1) as reference gene, Utilize No. 1 AeVPAL-silenced plant of fluorescence quantitative PCR detection Aegilops varibilis (BSMV infects the plant after phenotype) and right According to the expression quantity of plant (having infected the virus without PAL silencing segment) root tissue AeVPAL.

Fluorescent quantitation is the results show that relative to control group plant, and the expression of AeVPAL gene is in AeVPAL1-silenced Plant root significantly reduces, and expression quantity reduces nearly 60%.

To AeVPAL-silenced plant silencing plant root fixed point inoculation CCN J2 larva, to plant root after inoculation 3 days Portion carries out acid fuchsin dyeing, and observation statistics under an optical microscope.

Statistical analysis shows that the CCN number that AeVPAL1-silenced silencing plant root is infected, which is significantly more than, to be compareed The CCN number of plant root；Compared with the control, the CCN number that AeVPAL1-silenced silencing plant root is infected increases 40% or more.These results suggest that AeVPAL gene silencing causes the ability of the anti-CCN of plant to decline, AeVPAL exists Play positive regulation in the anti-CCN reaction of Ae.variabilis No.1.Such as Fig. 1.

AeVPAL is overexpressed the CCN number that transgenic wheat root is infected and substantially reduces:

AeVPAL gene is transferred to wheat breed Fielder, it is then right with specific primer (OHL129 and OHL604) Plant after transgenosis is detected and is screened.T3 generation is bred, has screened and has obtained 2 AeVPAL transgenic wheat pure lines Line15 and Line18.Line15, Line18 transgenic positive are sheerly wheat and adjoining tree (nontransgenic plants) together Seedling and plantation are sent out, takes root acid fuchsin after connecing worm 3 days in plant root fixed point inoculation CCN J2 larva to 2 leaf phases to wheat length Dyeing, microscope take pictures and count wheat root tissue CCN nematode count.

Statistic analysis result is shown, turns the plant root CCN nematode of AeVPAL gene pure lines wheat Line15 and Line18 Infect the plant that number is substantially less than control group.The result shows that AeVPAL transgenic wheat is significantly higher than control to the resistance of CCN Wheat.As shown in Fig. 2, AeVPAL transgenic wheat is high to the resistance of CCN, extraordinary effect is obtained, and stablize.

Basic principles and main features and advantages of the present invention of the invention, above-described embodiment has been shown and described above It is merely illustrated the principles of the invention with described in specification, without departing from the spirit and scope of the present invention, the present invention It will also have various changes and improvements, these changes and improvements are fallen in scope of the claimed invention.The present invention claims The range of protection is defined by the appending claims and its equivalent thereof.

Sequence table

<110>Chendu Inst. of Biology, Chinese Academy of Sciences

<120>a kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene and its application

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2124

<212> DNA

<213> Aegilops variabilis

<400> 1

atggccacta atggcaacga cggtttgtgc gtggccaagc cgcggagtgc tgacccgctc 60

aactggggga aggcggcgga ggagctgtcg gggagccatc ttgacgccgt caagcggatg 120

gtggaggagt accgcaggcc ggtggtagtt atggagggcg ccagcttgac catcgcccag 180

gtcgcggcgg tggccgccgc cgacggggcc agggtggagc tcgacgagtc cgcccgcggc 240

cgcgtcaagg agagcagcga ttgggtcatg agcagcatgg cgaatgggac tgacagctac 300

ggcgtcacca ccggcttcgg cgccacctcc catcggagga ccaaggaggg gggcgcgctg 360

cagagggagc tcatccggtt ccttaacgcc ggtgcgttcg gcaccggcag cgacggccac 420

gtgctgcccg cggccaccac gcgtgcggcg atgctcgtcc gcgtcaacac cctgctccaa 480

gggtactctg gcatccgctt tgagatcctc gagaccatcg ccacgctgct caacgccaac 540

gtgacaccat gcctgccgct ccgaggcact atcaccgctt ccggtgatct tgtcccgctc 600

tcctacatcg ccggacttgt caccggccgc ccaaatgccg tcgctgttgc tcctgatggc 660

acaaaagtta atgctgccga ggcatttaag atcgccggta tccaacacgg cttcttcgag 720

ctacagccca aggaaggcct tgctatggtt aatggaacgg cggtgggctc cgggctcgcg 780

tccattgttc tctttgaagc gaacatcctt ggtgtccttg ctgaagtttt atcagccgta 840

ttctgcgaag tgatgaacgg caagccagag tacaccgacc acctaacaca taagttgaag 900

caccaccccg gacagatcga ggctgcggcc atcatggagc acatcctaga ggggagctcc 960

tacatgatgc ttgcgaagaa acttggtgag ctcgacccat tgatgaagcc aaagcaagac 1020

agatatgctc tccgcacgtc accgcaatgg cttggtcctc aaattgaggt catccgtgca 1080

gcgacgaagt cgatcgagcg cgagatcaac tctgtcaatg acaacccact cattgacgta 1140

tctcgtggaa aggcaatcca tggtggcaac tttcaaggca cacccattgg cgtgtccatg 1200

gacaacacga ggcttgccat tgctgcgata ggcaagctca tgtttgccca gttctcagag 1260

ctagtgaacg acttctacaa caatggcttg ccctctaacc tctctggtgg tcgcaaccca 1320

agcctggact atggcttcaa gggtgctgag atcgccatgg cgtcatattg ctcggagctt 1380

caattcttgg gcaaccctgt gaccaaccat gtccagagcg cggagcaaca caaccaagac 1440

gttaactccc ttggattaat ctcgtcccgg aagaccgctg aggccattga cattctgaag 1500

ctcatgtcct ctacattttt ggttgcgctg tgccaagcca tcgacctgcg ccaccttgag 1560

gagaatgtca agaacgccgt caagaattgt gtcacaagag tggctaggaa gaccctgatc 1620

acaaatgaca tgggtggcct ccacaatgca cgtttctgtg agaaggacct gctccaaaca 1680

atcgaccgcg aggcggtgtt tgcatacgca gacgaccctt gcagcgccaa ctatcctctc 1740

atgaagaaga tgcgcgcggt gttggttgag catgccctgg ccaacggcga ggctgagcac 1800

aacgtggaaa cctcggtgtt tgccaaggtt gccaaattcg agcaggagct ctgtgcaaca 1860

ctacctcagg aggttgaggc tgctagaggt gcagtggaga atggcaccgc tgaagaacca 1920

aaccgtatcg tagactgccg gtcataccct ctataccggt tcgtgcgcga ggagctgggc 1980

acagtttact tgaccggaga gaagactcgg tcacctggcg aggaggtgga caaggtgttc 2040

gttgccatga accagggtaa gcacatcgat gctctgctgg agtgcctcca ggagtggaac 2100

ggcgagcccc tgcctatctg ctaa 2124

<210> 2

<211> 707

<212> PRT

<213> Aegilops variabilis

<400> 2

Met Ala Thr Asn Gly Asn Asp Gly Leu Cys Val Ala Lys Pro Arg Ser

1 5 10 15

Ala Asp Pro Leu Asn Trp Gly Lys Ala Ala Glu Glu Leu Ser Gly Ser

20 25 30

His Leu Asp Ala Val Lys Arg Met Val Glu Glu Tyr Arg Arg Pro Val

35 40 45

Val Val Met Glu Gly Ala Ser Leu Thr Ile Ala Gln Val Ala Ala Val

50 55 60

Ala Ala Ala Asp Gly Ala Arg Val Glu Leu Asp Glu Ser Ala Arg Gly

65 70 75 80

Arg Val Lys Glu Ser Ser Asp Trp Val Met Ser Ser Met Ala Asn Gly

85 90 95

Thr Asp Ser Tyr Gly Val Thr Thr Gly Phe Gly Ala Thr Ser His Arg

100 105 110

Arg Thr Lys Glu Gly Gly Ala Leu Gln Arg Glu Leu Ile Arg Phe Leu

115 120 125

Asn Ala Gly Ala Phe Gly Thr Gly Ser Asp Gly His Val Leu Pro Ala

130 135 140

Ala Thr Thr Arg Ala Ala Met Leu Val Arg Val Asn Thr Leu Leu Gln

145 150 155 160

Gly Tyr Ser Gly Ile Arg Phe Glu Ile Leu Glu Thr Ile Ala Thr Leu

165 170 175

Leu Asn Ala Asn Val Thr Pro Cys Leu Pro Leu Arg Gly Thr Ile Thr

180 185 190

Ala Ser Gly Asp Leu Val Pro Leu Ser Tyr Ile Ala Gly Leu Val Thr

195 200 205

Gly Arg Pro Asn Ala Val Ala Val Ala Pro Asp Gly Thr Lys Val Asn

210 215 220

Ala Ala Glu Ala Phe Lys Ile Ala Gly Ile Gln His Gly Phe Phe Glu

225 230 235 240

Leu Gln Pro Lys Glu Gly Leu Ala Met Val Asn Gly Thr Ala Val Gly

245 250 255

Ser Gly Leu Ala Ser Ile Val Leu Phe Glu Ala Asn Ile Leu Gly Val

260 265 270

Leu Ala Glu Val Leu Ser Ala Val Phe Cys Glu Val Met Asn Gly Lys

275 280 285

Pro Glu Tyr Thr Asp His Leu Thr His Lys Leu Lys His His Pro Gly

290 295 300

Gln Ile Glu Ala Ala Ala Ile Met Glu His Ile Leu Glu Gly Ser Ser

305 310 315 320

Tyr Met Met Leu Ala Lys Lys Leu Gly Glu Leu Asp Pro Leu Met Lys

325 330 335

Pro Lys Gln Asp Arg Tyr Ala Leu Arg Thr Ser Pro Gln Trp Leu Gly

340 345 350

Pro Gln Ile Glu Val Ile Arg Ala Ala Thr Lys Ser Ile Glu Arg Glu

355 360 365

Ile Asn Ser Val Asn Asp Asn Pro Leu Ile Asp Val Ser Arg Gly Lys

370 375 380

Ala Ile His Gly Gly Asn Phe Gln Gly Thr Pro Ile Gly Val Ser Met

385 390 395 400

Asp Asn Thr Arg Leu Ala Ile Ala Ala Ile Gly Lys Leu Met Phe Ala

405 410 415

Gln Phe Ser Glu Leu Val Asn Asp Phe Tyr Asn Asn Gly Leu Pro Ser

420 425 430

Asn Leu Ser Gly Gly Arg Asn Pro Ser Leu Asp Tyr Gly Phe Lys Gly

435 440 445

Ala Glu Ile Ala Met Ala Ser Tyr Cys Ser Glu Leu Gln Phe Leu Gly

450 455 460

Asn Pro Val Thr Asn His Val Gln Ser Ala Glu Gln His Asn Gln Asp

465 470 475 480

Val Asn Ser Leu Gly Leu Ile Ser Ser Arg Lys Thr Ala Glu Ala Ile

485 490 495

Asp Ile Leu Lys Leu Met Ser Ser Thr Phe Leu Val Ala Leu Cys Gln

500 505 510

Ala Ile Asp Leu Arg His Leu Glu Glu Asn Val Lys Asn Ala Val Lys

515 520 525

Asn Cys Val Thr Arg Val Ala Arg Lys Thr Leu Ile Thr Asn Asp Met

530 535 540

Gly Gly Leu His Asn Ala Arg Phe Cys Glu Lys Asp Leu Leu Gln Thr

545 550 555 560

Ile Asp Arg Glu Ala Val Phe Ala Tyr Ala Asp Asp Pro Cys Ser Ala

565 570 575

Asn Tyr Pro Leu Met Lys Lys Met Arg Ala Val Leu Val Glu His Ala

580 585 590

Leu Ala Asn Gly Glu Ala Glu His Asn Val Glu Thr Ser Val Phe Ala

595 600 605

Lys Val Ala Lys Phe Glu Gln Glu Leu Cys Ala Thr Leu Pro Gln Glu

610 615 620

Val Glu Ala Ala Arg Gly Ala Val Glu Asn Gly Thr Ala Glu Glu Pro

625 630 635 640

Asn Arg Ile Val Asp Cys Arg Ser Tyr Pro Leu Tyr Arg Phe Val Arg

645 650 655

Glu Glu Leu Gly Thr Val Tyr Leu Thr Gly Glu Lys Thr Arg Ser Pro

660 665 670

Gly Glu Glu Val Asp Lys Val Phe Val Ala Met Asn Gln Gly Lys His

675 680 685

Ile Asp Ala Leu Leu Glu Cys Leu Gln Glu Trp Asn Gly Glu Pro Leu

690 695 700

Pro Ile Cys

705

<210> 3

<211> 21

<212> DNA

<213> PAL-1

<400> 3

<210> 4

<211> 21

<212> DNA

<213> PAL-2

<400> 4

<210> 5

<211> 31

<212> DNA

<213> OHL087

<400> 5

<210> 6

<211> 31

<212> DNA

<213> OHL088

<400> 6

<210> 7

<211> 21

<212> DNA

<213> OHL135

<400> 7

<210> 8

<211> 24

<212> DNA

<213> OHL136

<400> 8

<210> 9

<211> 36

<212> DNA

<213> OHL099

<400> 9

tctagaggat ccccgatggc cactaatggc aacgac 36

<210> 10

<211> 36

<212> DNA

<213> OHL100

<400> 10

ttcgagctct ctagattagc agataggcag gggctc 36

<210> 11

<211> 22

<212> DNA

<213> OHL129

<400> 11

<210> 12

<211> 23

<212> DNA

<213> OHL604

<400> 12

actttatgct tccggctcgt atg 23

Claims (5)

1. a kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene, it is characterised in that: the Aegilops varibilis phenylalanine solution ammonia Enzyme gene nucleotide sequence is as shown in SEQ ID NO.1.

2. a kind of application of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene according to claim 1, it is characterised in that:

Application of the gene in wheat breeding.

3. a kind of application of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene according to claim 1 or 2, feature exist In: application of the gene in anti-cereal cyst nematode.

4. a kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene according to claim 1, it is characterised in that: the mutability Goatweed phenylalanine lyase amino acid sequence is as shown in SEQ ID NO.2.

5. a kind of Aegilops varibilis Phenylalanine Ammonia-Lyase Gene according to claim 1, it is characterised in that: the PAL Complete encoding sequence amplimer sequence:

PAL-1:ATGGCCACTAATGGCAACGAC；PAL-2:TTAGCAGATAGGCAGGGGCTC；

PAL VIGS fragment amplification primer sequence:

OHL087:CTAGCTAGCTAGACAACGTGGAAACCTCGGT；

OHL088:CTAGCTAGCTAGAGTAAACTGTGCCCAGCTC。