KR101369701B1 - Disease-resistant transgenic plants using capsicum annuum osmotin-like protein 1 caosm1 - Google Patents

Abstract

The present invention relates to: a transgenic plant transformed by a recombinant vector which has a resistance against bacterial blight or downy mildew, and contains a CaOSM1 gene (NCBI Accession No. AY262059) related to cell death; and a production method of the transgenic plant. According to the present invention, the disease resistant mechanism of the CaOSM1 gene can be revealed and the transgenic plant resistant to bacterial blight or downy mildew can be effectively produced.

Description

Disease-Resistant Transgenic Plants Using Capsicum annuum Osmotin-like Protein 1 CaOSM1}

The present invention relates to a pathogenic transgenic plant using the plant disease defense and cell death related protein osmotin gene ( CaOSM1 ) of red pepper. More specifically, the present invention reveals the mechanism of pathogenic resistance of the osmotin gene of red pepper, and includes a transgenic plant having resistance to bacterial blight or fungal disease comprising the gene and an antibody against a protein encoded by the gene. It relates to a method for detecting the expression of CaOSM1 protein level by the immune response.

Plants use structural or induced defense mechanisms to combat invading microbial pathogens. One of them is to recognize the pathogen-associated molecular pattern (PAMP), a specific molecular substance of pathogens, by activating innate immunity by the pattern recognition receptor (PRR). Pathogens inactivate the immune response by injecting effector proteins as plant pathogens into plant cells to inhibit pathogen recognition of the receptor. A stronger defense response of plants that inhibit pathogen invasion is rapid cell death, which is manifested as hypersensitive response (HR) in the pathogen invasion zone. It involves rapid ionic flow changes, generation of reactive oxygen species (ROS), activation of defense-related genes, and the like during hypersensitivity apoptosis. Hypersensitivity apoptosis is caused by combinations of resistant proteins of host plants that recognize the effector proteins of the pathogen as non-pathogenic factors. These studies are of great value in elucidating the defense physiology of plants, and the pathogenic genes obtained can not only maximize disease resistance of the crop, but also enable molecular breeding of other plant species.

Conventional techniques known in connection with the induction of disease resistance and apoptosis in pepper include E3 ubiquitin ligase gene CAI ring1, calmodulin gene CMA1, mannosevine sugar lectin 1, lipoxygenase 1, epsis acid reaction. Recently, a technology for producing a transgenic plant expressing higher resistance to invading pathogens using genes of ABI1 and the like has been recently reported.

Osmotin, on the other hand, is a protein belonging to the pathogenesis-related protein 5 group and is characterized by being induced against osmotic stress. Osmotins have also been reported to be expressed by biological and abiotic stimuli and have been shown to have antimicrobial activity against some pathogens. Osmotin of Capsicum annuum osmotin-like protein1, CaOSM1) is a bacterial pathogen spots (Xanthomonas campestris pv. vesocatoira ) The patent application (Republic of Korea Patent Publication No. 10-2005-0031687) is based on the results of research showing that the base and protein amino acid sequence of the gene encoding the protein induced during infection is known and is induced by biological and abiotic stimulation And reported in the international journal (Physiol. Mol. Plant Pathol. 64: 301-310). Contrary to these findings, it is still unclear what role osmotin plays in pathogenesis. Therefore, if the resistance assay can be evaluated through the production of transgenic plants using red pepper osmotin and functional analysis in apoptosis, it not only accumulates the knowledge information about the pathogenic mechanism of the plant but also uses the same. By contributing to the development and development of resistant plants, they will offer practical alternatives for plant protection and food resources.

As a background technology of the present invention, US Pat. No. 7,141,723 B2 (Nov. 26, 2006) to a transgenic plant resistant to tomato fungal disease and black scab using the osmotin gene of tobacco, soybean, carrot, cotton, potato or soybean. Although it is described, transgenic plants having resistance to bacterial blight or Downy mildew using the pepper-derived OSM gene associated with apoptosis are not disclosed.

Republic of Korea Patent Application Publication No. 10-2005-0031687 (2005.04.06) US patent registration US 7,141,723 B2 (2006.11.26)

Physiol. Mol. Plant Pathol. 2004, 64: 301-310 GenBank Accession No. AY262059.1: Capsicum annuum osmotin-like protein (OSM1) mRNA (2005.07.06.)

DISCLOSURE OF THE INVENTION The present invention has been made in view of the above-mentioned problems of the prior art, in view of the biological properties that although several defense-related genes have been found, biological activity is controlled by complex interactions.

It is an object of the present invention to provide a method for treating red pepper bacterial spotty disease ( Xanthomonas campestris pv. vesicatoria ) is to provide a transgenic plant having a resistance to plant diseases by introducing an osmotin gene ( CaOSM1 ) related to resistance and cell death occurring during a defense reaction in plants infected with vesicatoria ) and a method of producing the same.

Still another object of the present invention is to provide a method for detecting the expression of osmotin at the protein level by an immune response using an antibody against the osmotin protein encoded by the gene.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a transgenic plant resistant to bacterial blight or downy mildew, into which a CaOSM1 gene (NCBI Accession No. AY262059) or a recombinant vector comprising the gene is introduced.

According to another aspect of the present invention, the present invention comprises the steps of preparing an expression vector comprising a CaOSM1 gene (NCBI Accession No. AY262059); And introducing the expression vector into plant cells. It provides a method for producing a transformed plant having resistance to bacterial blight or fungal disease.

According to another aspect of the invention, the present invention comprises the steps of inserting the CaOSM1 gene (NCBI Accession No. AY262059) into the TRV2 vector to produce a recombinant vector TRV: CaOSM1 ; And introducing the recombinant vector into plant cells. The method provides a method for producing a transformed plant having susceptibility to bacterial blight or fungal disease.

According to another aspect of the invention, the present invention comprises the steps of preparing an expression vector comprising a CaOSM1 gene (NCBI Accession No. AY262059); And introducing the expression vector into plant cells.

According to another aspect of the invention, the present invention comprises the steps of inserting the CaOSM1 gene (NCBI Accession No. AY262059) into the TRV2 vector to produce a recombinant vector TRV: CaOSM1 ; And introducing the recombinant vector into a plant cell. The method provides a method for inhibiting a cell death reaction of a plant when invading a pathogen comprising the plant.

According to another embodiment of the present invention, the present invention provides a peptide (198-PDAYSYPQDDPTSTFTC-214; SEQ ID NO: 1) consisting of the amino acid sequence 198 to 214 of the amino acid sequence of CaOSM1 protein (NCBI Accession No. AAP86781.1) An antibody against CaOSM1 protein obtained by injection in is provided.

Hereinafter, the configuration of the present invention will be described in detail with reference to the accompanying drawings.

The present invention is put to function in disease resistance of disease-related genes isolated pepper CaOSM1 revealed through the chemical cell and molecular biological analysis of chilli, Nicotiana benthamiana , Arabidopsis thaliana ) was achieved by confirming the induction of plant disease resistance through overexpression with Agrobacterium in plants.

Accordingly, the present invention provides a transgenic plant resistant to bacterial blight or Downy mildew, into which a CaOSM1 gene (NCBI Accession No. AY262059) or a recombinant vector containing the gene is introduced.

The recombinant vector is preferably a recombinant plant expression vector. The recombinant vector is, but is not limited to, for example, pBIN35S: CaOSM1 , pBIN35S: CaOSM1 : GFP or pTRV2: CaOSM1 . Using the recombinant vector pBIN35S: CaOSM1 : GFP, it was confirmed that CaOSM1 is expressed in the cell membrane (see FIG. 1). Apoptosis was confirmed by transient overexpression using the recombinant vector pBIN35S: CaOSM1 (see FIGS. 2 to 5). The recombinant vector pTRV2: CaOSM1 was prepared by inserting the gene ( CaOSM1 ) into TRV2 (Tobacco Rattle Virus 2) vector, a vector for virus-induced gene silencing (VIGS), and confirmed its effect. (See FIGS. 7-10).

Furthermore, transformation of a plant means any method of transferring DNA to a plant. Any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable plant cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery.

Preferably the pathogen of the bacterial blight in the present invention is Pseudomonas syringae .

Preferably the pathogen of the Bacillus disease is Hyaloperonospora arabidopsidis .

In the present invention, the plant is not particularly limited, but may preferably be Arabidopsis, pepper, tobacco, and the like.

The present invention CaOSM1 Also provided is a method of making a disease resistant or disease sensitive transgenic plant comprising the step of transforming the plant using a recombinant vector that induces or inhibits gene expression.

Preferably the present invention comprises the steps of preparing an expression vector comprising a CaOSM1 gene (NCBI Accession No. AY262059); And introducing the expression vector into plant cells; It provides a method for producing a transformed plant having resistance to bacterial blight or Bacillus disease.

In addition, the present invention comprises inserting the CaOSM1 gene (NCBI Accession No. AY262059) into the TRV2 vector to produce a recombinant vector TRV2: CaOSM1 ; And introducing the recombinant vector into plant cells. The method provides a method for producing a transformed plant having susceptibility to bacterial blight or fungal disease.

Furthermore, the present invention comprises the steps of preparing an expression vector comprising the CaOSM1 gene (NCBI Accession No. AY262059); And introducing the expression vector into plant cells.

In addition, the present invention comprises inserting the CaOSM1 gene (NCBI Accession No. AY262059) into the TRV2 vector to produce a recombinant vector TRV2: CaOSM1 ; And introducing the recombinant vector into a plant cell. The method provides a method for inhibiting a cell death reaction of a plant when invading a pathogen comprising the plant.

As described above, preparation of the expression vector and introduction of the expression vector into plant cells can use transformation methods known to those skilled in the art. In an embodiment of the present invention, a CaOSM1 gene is inserted into a pBIN35S vector (or TRV2 vector). PBIN35S: CaOMS1 (or TRV2: CaOSM1 ) produced by the Agrobacterium was transformed and then introduced into the plant through the floral dipping method. The transformed plant method may further comprise the step of selecting a transformant to which the expression vector is introduced by a known method such as reverse transcription polymerase chain reaction.

More specifically, the present invention relates to CaOSM1 gene using TRV2 vector (Bulcombe DC (1999) Fast forward genetics using Tobacco Rattle Virus (TRV), which is used for virus-induced gene silencing (VIGS)). based on virus-induced gene silencing.Curr. Opin.Plant Biol. 2: 109-113) to produce a recombinant vector TRV2: CaOSM1 . The recombinant vector was introduced into a plant to prepare a VIGS plant in which CaOSM1 expression was suppressed, thereby confirming that apoptosis was decreased and pathogenic resistance was reduced, thereby providing a transformed plant (see FIGS. 7 to 10).

Furthermore, CaOSM1 according to the present invention Recombinant vector containing gene (pBIN35S: CaOSM1 ) and Agrobacterium tumefaciens ( Agrobacterium) tumefaciens strain GV3101) strain, the transgenic expression in Arabidopsis plants was confirmed to increase the apoptosis response and CaOSM1 gene plant disease resistance (see Fig. 11 to 16).

The present invention provides antibodies to the proteins of the invention. The antibody of the present invention can be prepared by cloning a CaOSM1 coding gene into an expression vector according to a conventional method to obtain a protein encoded by the gene, and from the obtained protein by a conventional method. Also included are partial peptides that can be made from the protein, and the partial peptides of the invention include at least 7 amino acids, preferably 9 amino acids, more preferably 12 amino acids. The form of the antibody of the present invention is not particularly limited and a part thereof is included in the antibody of the present invention and all immunoglobulin antibodies are included as long as they are polyclonal antibody, monoclonal antibody or antigen-binding. Although not limited thereto, the present invention preferably provides a peptide (198-PDAYSYPQDDPTSTFTC-214; SEQ ID NO: 1) consisting of amino acid sequences 198 to 214 of the amino acid sequence of the CaOSM1 protein (NCBI Accession No. AAP86781.1). Antibodies to CaOSM1 protein obtained by injection are provided. The peptide is hydrophilic and sequence specific, which is advantageous for antibody formation and reduces the probability of recognition of other proteins.

In addition, the present invention is to extract the plant protein treated with biological, chemical or environmental stress using the antibody of the CaOSM1 protein as a probe (Probe) to determine whether the plant disease resistance comprising the step of confirming the expression of CaOSM1 protein Provide a way to navigate. More specifically, the biological treatment is exemplified by a pathogenic bacterium such as a pathogenic bacterium of hot pepper, a non-pathogenic bacterium, The chemical treatment is exemplified by ethylene or salicylic acid which is a plant hormone. The environmental stress treatment is exemplified by drying or salt. Preferably, the antibody is a CaOSM1 protein obtained by injecting a peptide (198-PDAYSYPQDDPTSTFTC-214; SEQ ID NO: 1) consisting of amino acids sequence 198 to 214 of the amino acid sequence of CaOSM1 protein (NCBI Accession No. AAP86781.1) Is an antibody to the antibody (see FIG. 2).

As described above, the present invention confirms that CaOSM1 plays a pivotal role in regulating disease resistance to bacterial blight or fungal disease, and can accumulate genetic information of CaOSM1 's response to disease and its associated pathogenic protein (PR protein). It can provide interesting models of plant signaling, and can be used to develop biotechnological plants that increase disease resistance by understanding the biochemical changes that cause resistance.

As described above, by the completion of the present invention, the bacterial spotty pathogen of pepper plants ( Xanthomonas camperstris pv. Effect of contributing to the development of resistant plant varieties and the production of transgenic plants by providing a method for detecting resistance of plants using the antibody of osmotin protein, a gene specifically induced when infected with non-pathogenic strain (Bv5-4a) of vesicatoria) You can expect.

Therefore, the present invention is a very useful invention for the plant breeding industry because it can develop resistant varieties using pepper osmotin gene source.

Figure 1 shows the intracellular expression location of red pepper osmotin (CaOSM1) according to the present invention Nicotiana benthamiana A diagram showing the results confirmed using the green fluorescence protein (GFP) in the leaves,
2 is a view showing the results of confirming the expression of CaOSM1-GFP expressed in Figure 1 by protein gel blotting using the CaOSM1 antibody,
3 is a diagram showing the phenotype of apoptosis after the overexpression of CaOSM1 on the leaves of red pepper cultivation varieties, UV exposure confirmation, ethanol discoloration,
Figure 4 is a graph showing the results of measuring trypan blue staining and ion conductivity performed to observe apoptosis after CaOSM1 transient overexpression on the leaves of the red pepper cultivation varieties,
5 is a graph showing the results of measuring the amount of oxygen peroxide generated after CaOSM1 was temporarily overexpressed on the leaves of the red pepper cultivation varieties through dip dyeing.
6 is a diagram showing the results of confirming the expression of protein levels using CaOSM1 specific antibodies after transient overexpression of CaOSM1 on the leaves of the red pepper cultivation varieties,
7 shows recombinant vector TRV: CaOSM1 and Agrobacterium. After introducing a tumefaciens strain GV3101 strain it when pepper plants to the cotyledon time CaOSM1 gene silencing plants produced by inoculating bacterial pathogens spots (Xanthomonas campestris pv. vesicatoria ) is a diagram showing the results of confirming the expression of CaOSM1 gene by reverse transcription polymerase chain reaction (RT-PCR) after inoculation,
8 is CaOSM1 prepared in FIG. In a pepper plant in which the gene was silenced, bacterial spotty bacilli ( Xanthomonas campestris pv. vesicatoria ) after inoculation, and FIG.
9 is CaOSM1 prepared in FIG. In a pepper plant in which the gene was silenced, bacterial spotty bacilli ( Xanthomonas campestris pv. vesicatoria ) is a diagram showing the cell death through trypan blue staining and the result of measuring the ion conductivity after inoculation,
10 is CaOSM1 prepared in FIG. In a pepper plant in which the gene was silenced, bacterial spotty bacilli ( Xanthomonas campestris pv. vesicatoria ) and the graph showing the result of measuring the amount of oxygen peroxide generated by the dip dye staining and the generation of free radicals,
Figure 11 shows the results confirmed by reverse transcription polymerase chain reaction (RT-PCR) expression of CaOSM1 in transgenic Arabidopsis plants overexpressing the CaOSM1 gene in Arabidopsis thaliana plants through recombinant vectors (pBIN35S: CaOSM1 ). Drawing,
12 is a bacterial blight pathogen Pseudomonas syringae in the transformed plant prepared in FIG. pv. tomato of the pathogenic strain DC3000 and the non-pathogenic strain DC3000 ( avrRpm1 ).
13 is a bacterial blight pathogen Pseudomonas syringae in the transformed plant prepared in FIG. pv. After inoculation of the pathogenic strain DC3000 and non-pathogenic strain DC3000 ( avrRpm1 ) of tomato and try to try to kill the cells by trypan blue staining and the figure showing the results of measuring the ion conductivity,
14 is a bacterial blight pathogen in the transformed plant prepared in FIG. Pseudomonas syringae pv. After inoculating DC3000 and tomato non-pathogenic strains DC3000 ( avrRpm1 ), a diagram showing the production of free radicals through dip dye staining and a graph showing the results of measurement of the amount of oxygen peroxide,
FIG. 15 is a diagram showing the results of assaying the number of sporeangiophores formed on cotyledon after inoculating Bacillus hyaloperonospora arabidopsidis isolate Noco2 to the transformed plant prepared in FIG. 11.
FIG. 16 is a diagram showing the results of assaying spores formed on cotyledon after inoculating Bacillus hyaloperonospora arabidopsidis isolate Noco2 into the transformed plant prepared in FIG. 11.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

[ Example  One] CaOSM1 Protein Intracellular  Expression Positioning

[Step 1]

CausM1 : Capsicum , one of the pathogen-related proteins for pepper bacterial spot disease annum Osmotin - like In order to confirm the intracellular expression position of protein1 ), the following test was performed.

CaOSM1 The gene was introduced into the pBIN35S vector along with the green fluorscence protein (GFP) to express pBIN35S: CaOSM1 - GFP. A recombinant vector was prepared and then Agrobacterium tumefaciens strain GV3101) by electroporation and Nicotiana benthamiana CaOSM1 was temporarily overexpressed by inoculating the leaves, and then the labeling of GFP was observed through confocal laser microscopy to confirm the intracellular expression of CaOSM1. As a result, CaOSM1 was observed along the cell membrane, and it was confirmed that CaOSM1 was expressed in the cell membrane compared to PIP2A, a cell membrane expression marker protein overexpressed together (see FIG. 1).

[Step 2]

Agrobacterium tumefaciens In order to confirm the transient expression of CaOSM1-GFP at the protein level using strain GV3101), the leaves of the inoculated plants were harvested 24 hours after inoculation, the proteins were extracted, electrophoresed and transferred to a nylon membrane (Hybond P ⁺ ). . Previously, a specific peptide (198-PDAYSYPQDDPTSTFTC-214; SEQ ID NO: 1) was synthesized among CaOSM1 amino acid sequence (GenBank Accession No. AAP86781.1) to obtain an antibody by injection into a rabbit. Immunobloting was performed using this antibody to confirm the expression of CaOSM1 protein (see FIG. 2).

[ Example  2] Agrobacterium ( Agrobacterium tumefaciens strain GV3101 ) CaOSM1  Gene transient expression ( Agrobacterium - mediated transient  expression) on plants

[Step 1]

CaOSM1 During Hypersensitivity Cell Death in Pepper Plants Because of the strong expression of the gene, CaOSM1 was used to determine its relevance in this physiological response. Introducing the gene into the pBIN35S vector allows pBIN35S: CaOSM1 A recombinant vector was prepared and then Agrobacterium tumefaciens strain GV3101) by electroporation and CaOSM1 in pepper plants The gene was temporarily overexpressed. Three days after inoculation, a pronounced apoptosis was observed at the site of overexpression of CaOSM1 (first diagram in FIG. 3), which was evident through UV exposure and ethanol decolorization (second, third diagram in FIG. 3). ).

[Step 2]

In order to visualize and quantify the degree of cell death in Step 1 of Example 2, trypan blue staining and ionic conductivity were measured to quantify cell death, resulting in overexpression of the CaOSM1 gene, resulting in much cell death. It was observed that the conductivity was higher than that of the control due to the large amount of ion leakage in the leaves (see FIG. 4). In addition, the change of free radicals due to overexpression of this gene was confirmed and quantified through Dab (DAB) staining, and it was confirmed that the production of oxygen peroxide was increased in CaOSM1 expressed leaves (see FIG. 5).

[Step 3]

CaOSM1-specific antibodies prepared in Example 1 after extracting the protein by harvesting leaves at 24 and 48 hours after Agrobacterium inoculation to confirm the expression of CaOSM1 protein in the test in Step 1 and 2 of Example 2 Protein gel blotting was performed to confirm that the CaOSM1 protein was encoded only in plants overexpressing the CaOSM1 gene, and that the amount of protein was equally loaded (see FIG. 6).

[ Example  3] using virus-derived vector CaOSM1  Increased inhibition of gene expression and subsequent disease susceptibility

[Step 1]

To investigate the pathogenic changes when CaOSM1 gene expression was inhibited in pepper plants, the gene was introduced into the virus-derived Tobacco rattle virus (TRV) vector and TRV2: CaOSM1 A recombinant vector was prepared and subjected to virus-induced gene silencing (VIGS).

More specifically, the TRV2 vector was cut with the restriction enzyme Eco RI, followed by ethanol precipitation, dissolved in sterile water, and recovered to DNA, followed by dephosphorylation with alkaline phosphatase. The pCR2.1-TOPO vector for amplifying; (SEQ ID NO: 2 GGTCACTTGACAACTTGTTTAG) attached to the restriction enzyme Eco RI (GAATTC) sites in both sequences with the polymerase chain reaction (PCR) was provided by Invitrogen 21 nucleotides of the nucleotide sequence of CaOSM1 Inserted. The TOPO vector was cut with the restriction enzyme Eco RI, and the fragment was inserted into the TRV2 vector using a ligase to generate a TRV2: CaOSM1 recombinant vector. TRV2, an empty gene, was used as a control (Baulcombe DC (1999) Fast forward genetics based on virus-induced gene silencing.Curr. Opin. Plant Biol. 2: 109-113).

This vector was transformed into Agrobacterium as applied in Examples 1 and 2 above, and the strain was inoculated into the cotyledon at the pepper cotyledon growing period to induce the inhibition of expression of these genes in newly generated leaves.

[Step 2]

In order to confirm the silencing of the genes in the pepper plants which inhibited the expression of CaOSM1 , RNA was extracted by harvesting the leaves at 18 hours after inoculating CaOSM1 gene silencing plants with bacterial stalk germ ( Xanthomonas campestris pv.vesicatoria ). As a result of confirming the expression of CaOSM1 gene by reverse transcriptase polymerase chain reaction (RT-PCR), the expression of CaOSM1 gene was confirmed in control plants, but no expression was detected in CaOSM1 gene silencing plants (see FIG. 7).

[Step 3]

In order to determine whether the resistance to bacterial spot disease is reduced in pepper plants inhibited by the expression of CaOSM1 , bacterial spot disease bacteria ( Xanthomonas campestris) on the prepared pepper plants pv. vesicatoria ) After inoculation of the pathogenic strain Ds1 and the non-pathogenic strain Bv5-4a, bacterial growth was observed on days 0 and 3 in each plant. Bacterial proliferation was increased in both peppery plants that inhibited CaOSM1 expression when infected with both pathogenic and non-pathogenic strains than in control plants (see FIG. 8). Therefore, CaOSM1 gene was found to be involved in pathogenic resistance to bacterial spot pattern germs.

[Step 4]

Since the CaOSM1 in Example 2 and it plays a role in apoptosis and free radicals generated CaOSM1 Changes in cell death and free radicals were observed during gene expression inhibition. Observation of dead cells through trypan blue staining showed that hypersensitivity cell death occurred in non-pathogenic strains in control plants and plants, but apoptosis was decreased in plants inhibited in CaOSM1 gene expression (FIG. 9). In addition, it was confirmed that the inhibition of CaOSM1 gene expression has an effect on reducing cell death by quantifying cell death through ion conductivity analysis (see FIG. 9).

In addition, after inoculating the bacterial spot pattern germ to the plant and confirming the active oxygen by Dab (DAB) staining, in accordance with the result of cell death, the control plants were detected strong free radicals when infected with non-pathogenic strains, but inhibited CaOSM1 gene expression No detection was made in the plants (see FIG. 10). Quantitative quantitative results of hydrogen peroxide supported the Dab (DAB) staining test (see FIG. 10).

[ Example  4] CaOSM1 Production of transgenic plants using genes Disease resistance  quest

[Step 1]

The pBIN35S vector used in Example 2 CaOSM1 PBIN35S recombinant vector was created by inserting a gene: After transforming CaOSM1 the Agrobacterium floral dipping (floral dipping) CaOSM1 in Arabidopsis thaliana plants by the method The gene was introduced and transformed. CaOSM1 in Transgenic Arabidopsis Plants In order to confirm whether the gene is structurally overexpressed, three transgenic plant lines were selected by reverse transcription polymerase chain reaction experiment (see FIG. 11).

[Step 2]

As mentioned above, bacterial blight pathogen Pseudomonas syringae in a transgenic plant overexpressing CaOSM1. pv. tomato and a non-pathogenic strain of this pathogen Pseudomonas syringae pv. After inoculating tomato ( avrRpm1 ) at 5 x 10 ⁴ cfu / mL and harvesting the leaves on days 0 and 3, the bacterial growth of the leaves was measured. As a result, the growth of pathogenic and non-pathogenic strains was observed in plants overexpressing the CaOSM1 gene. All were more suppressed in wild type plants (Col-0) (see FIG. 12).

[Step 3]

As mentioned above, bacterial blight pathogen Pseudomonas syringae in a transgenic plant overexpressing CaOSM1. pv. tomato and non-pathogenic strains of this pathogen Pseudomonas syringae pv. Inoculated tomato ( avrRpm1 ) at a concentration of 10 ⁷ cfu / mL and trypan blue staining after 24 hours to observe apoptosis and to measure the ionic conductivity of the caOSM1 gene overexpressed plants in pathogenic and non-pathogenic strain infection All confirmed that the apoptosis was increased than in wild-type plants (Col-0) (see Fig. 13).

[Step 4]

As mentioned above, bacterial blight pathogen Pseudomonas syringae in a transgenic plant overexpressing CaOSM1. pv. tomato and non-pathogenic strains of this pathogen Pseudomonas syringae pv. Inoculated with tomato ( avrRpm1 ) at a concentration of 10 ⁷ cfu / mL, and after 24 hours, Dap staining was used to observe and quantify the production of free radicals. Wild plants in both pathogenic and non-pathogenic strains were infected with CaOSM1 genes. It was confirmed that the production of oxygen peroxide was increased than in (Col-0) (see FIG. 14).

[Step 5]

Downy mildew in the CaOSM1 a transgenic plant, such as the bacteria Hyaloperonospora arabidopsidis isolate Noco2 to 5 x 10 ⁴ inoculated with spores / mL concentration, and results of testing the individual spores light formed by collecting 50 of cotyledons 7 days CaOSM1 gene Spore diameter formation was reduced in the overexpressed plants (see FIG. 15), and spore formation was decreased in plants overexpressing the CaOSM1 gene (see FIG. 16). Therefore, it was found that overexpression of CaOSM1 confers resistance to bacterial blight and fungal disease on Arabidopsis plants.

Although specific portions of the present invention have been described in detail, those skilled in the art will appreciate that these specific embodiments are merely examples of preferred embodiments and that the scope of the present invention is not limited thereto. It is therefore intended that the scope of the present invention be defined by the appended claims and their equivalents.

Attach an electronic file to a sequence list

Claims (6)

Pseudomonas syringe pv, into which the CaOSM1 gene (NCBI Accession No. AY262059) or a recombinant vector containing the gene was introduced. Tomato (Pseudomonas syringae pv. Tomato) caused by bacterial blight or A transgenic red pepper or Arabidopsis plant resistant to Downy mildew caused by Hyaloperonospora arabidopsidis isolate Noco2. Preparing an expression vector comprising a CaOSM1 gene (NCBI Accession No. AY262059); And
Introducing the expression vector into plant cells; comprising Pseudomonas syringe pv. Tomato (Pseudomonas syringae pv. Tomato) caused by bacterial blight or A method for producing a transgenic pepper or Arabidopsis plant that is resistant to Downy mildew disease by Hyaloperonospora arabidopsidis isolate Noco2. Inserting the CaOSM1 gene (NCBI Accession No. AY262059) into the TRV2 vector to produce recombinant vector TRV2: CaOSM1 ; And
Introducing the recombinant vector into plant cells; comprising Pseudomonas syringe pv. Tomato (Pseudomonas syringae pv. Tomato) caused by bacterial blight or A method of producing a transgenic pepper or Arabidopsis plants susceptible to Downy mildew disease by Hyaloperonospora arabidopsidis isolate Noco2. Preparing an expression vector comprising a CaOSM1 gene (NCBI Accession No. AY262059); And
Introducing the expression vector into a plant cell; a method of inducing a cell death reaction of a pepper or Arabidopsis plant when invading a pathogen comprising a. Inserting the CaOSM1 gene (NCBI Accession No. AY262059) into the TRV2 vector to produce recombinant vector TRV2: CaOSM1 ; And
Introducing the recombinant vector into a plant cell; a method for inhibiting apoptosis of pepper or Arabidopsis plant when invading a pathogen comprising a. An antibody against a CaOSM1 protein obtained by injecting a peptide (198-PDAYSYPQDDPTSTFTC-214; SEQ ID NO: 1) consisting of amino acid sequences 198 to 214 of the amino acid sequence of a CaOSM1 protein (NCBI Accession No. AAP86781.1) into an animal.

Images