KR101390835B1 - Disease resistance-related phenylalanine ammonia-lyase gene CaPAL1, and transgenic plants using the same - Google Patents

Abstract

The present invention relates to an isolated gene ( CaPAL1 ) encoding phenylalanine ammonia- lyase from pepper as a gene related to plant disease resistance and a transformant using the same. According to the present invention, CaPAL1 can be provided as a material for breeding a disease-resistant plant, thereby promoting the development of resistant cultivars.

Description

Disease resistance-related phenylalanine ammonia-lyase gene CaPAL1, and transgenic plants using the same. The phenylalanine ammonia-

The present invention relates to a disease resistance-related phenylalanine ammonia-lyase gene CYP1A1 and a transgenic plant using the same. More particularly, the present invention relates to a process for the preparation of capsicum annuum L.), a novel plant disease resistance-related gene ( CaPAL1 : C apsicum a nnuum P henylalanine A mmonia - L yase 1 ), a disease resistance search method using the same, and the production of a disease resistant transgenic plant.

Studies on the disease resistance response of plants have scientific value to identify in vivo signaling mechanisms. Information on plant defense deficiency genes can also be provided as a direct source of molecular genetic breeding for increased disease resistance in crops.

In order to increase environmentally friendly food production, crop breeding using various genes related to disease defenses can reduce food production costs by minimizing losses caused by economically important pathogens, weeds, and environmental stresses, and by providing high quality food, And contributes to the revitalization of various industries associated with the development of new varieties.

Plant disease control of pepper (Capsicum annuum L.), which is intensively cultivated in Korea and as a major economic crop, is of great importance and provides a good experimental system for studying the signaling pathway of defense against plant diseases. The isolation and function analysis of the genes involved in the defense reaction in the interaction of pepper with the bacterial spotty pathogen of pepper resulted in a scientific understanding of the plant defense response through overexpression in the model plant, Arabidopsis, And is the basis for genetic resources for the development of disease resistant transgenic plants expressing resistance-related genes in pepper plants.

When a plant is infected with a pathogen, the host plant activates a defense mechanism by activating various intracellular metabolic systems to counteract it. In addition to the recognition of host cells for these pathogenic small pathogens, it has been shown that intracellular Ca2 +, increase of active oxygen, callose deposition, production of secondary metabolites such as phenol-related antimicrobials, hypersensitivity reactions such as local cell death, And is known to produce a variety of defense-related proteins.

The production of secondary metabolites, especially in the course of signal transduction to express this series of resistive responses, is mediated by the phenylpropanoid pathway. The phenylpropanoid pathway is initiated by the catalytic action of the phenylalanine ammonia-lyase enzyme to convert phenylalanine to cinnamate, which undergoes a series of sub-processes to form anthocyanin, And the like.

As a background of the present invention, Korean Patent Registration No. 10-0982824 (Sep. 16, 2010) discloses a phenylalanine ammonia lyase gene and a cinnamoyl-coaillidicase gene of pine mushroom. The gene is called Tricholoma matsutake, Is known to be involved in the production of methyl cinnamate, which is known to be the main component of the fragrance. Also, NCBI Accession no. M83314.1 (May 28, 2010) discloses a tomato phenylalanine ammonia lyase gene, a promoter portion and the like.

However, the role of phenylalanine ammonia-lyase in pepper plants in function studies and disease resistance has not been elucidated. Studies on phenylalanine ammonia-lyase, which is involved in the plant immune response to external stress as well as plant growth, play an important role in the production of secondary metabolites within the cell. Therefore, Identification is needed to understand the pathogen - resistance mechanism of pepper plants and may be used as a major genetic resource for the production of disease - resistant transgenic plants.

Korean Patent Registration No. 10-0982824 (September 16, 2010)

NCBI Accession no. M83314.1 (2010.05.27)

The present invention for solving the problems of this prior art the same, and its object is pepper bacterial jeommunuibyeong (Xanthomonas campestris pv. vesicatoria ), which is one of the plant disease resistance genes, phenylalanine ammonia- lyase ( CaPAL1 : C apsicum a nnuum P henylalanine A mmonia - L yase 1 ) gene by sequencing and sequencing.

The present invention also provides a method for searching for resistance to plant disease using the CaPAL1 gene.

Furthermore, the present invention aims at producing transgenic plants resistant to plant diseases by introducing the genes into plants.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the invention there is phenylalanine ammonia as the resistance genes plant disease-of the gene CaPAL1 or (b) SEQ ID NO: 1 encoding a protein having (a) the amino acid sequence of SEQ ID NO: 2 encoding a license AIDS The gene CaPAL1 having the nucleotide sequence is provided.

Further, in accordance with another aspect of the present invention, the present invention provides a isolated protein CaPAL1 having the amino acid sequence of SEQ ID NO: 2.

According to still another aspect of the present invention, there is provided a recombinant vector comprising the gene.

According to still another aspect of the present invention, there is provided a transgenic plant transformed with said gene or said recombinant vector.

According to still another aspect of the present invention, there is provided a method for searching for disease resistance of a plant, comprising the step of isolating mRNA from a plant after inoculation with a pathogen and identifying the differential expression of the CaPAL1 gene.

Hereinafter, the configuration of the present invention will be described in detail with reference to the accompanying drawings.

The object of the present invention is to provide a process for producing annuum cv. Nockwang) was inoculated with a non-pathogenic bacterium ( Xanthomonas campestris pv. Vesicatoria strain Bv5-4a) accompanied by hypersensitive cell death, and a novel resistance-related gene CaPAL1 isolated from pepper leaves that caused hypersensitive cell death was identified, transformed to determine the sequence and search for them in each of the pepper plant tissue CaPAL1 expressed by the irradiation, and the pepper plant genes CaPAL1 is suppressed through VIGS and overexpression of this gene expression if the CaPAL1 with pathogens treatment The Arabidopsis thaliana transgenic Arabidopsis thaliana was identified by confirming the plant resistance resistance induction function of the CaPAL1 gene.

First, the present invention provides a method for isolating mRNA from a green pepper cultivar which exhibits an irritable resistance to a non-pathogenic strain of a bacterium belonging to the genus Pseudomonas aeruginosa, and preparing a cDNA library from the mRNA. The leaves of a pepper plant inoculated with a non- The mRNA obtained from the red pepper plants was labeled with digoxigenin to make a probe. Differential hybridization was performed using the cDNA and probe to select clones presumed to be related to disease resistance, (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) of the phenylalanine ammonia- lyase coding gene of the pepper green color varieties designated as CaPAL1 (see FIG. 1).

The coding region (ORF) of the CaPAL1 cDNA consists of 2318 nucleotide sequences encoding 717 amino acids and has a phenylalanine ammonia-lyase domain at the center of the CaPAL1 protein sequence (amino acid sequence numbers 199-215) . The confirmed gene sequence of CaPAL1 and the amino acid sequence encoded by the above base sequence are shown in Fig. 1, and the amino acid sequence homology of other crops (tomato, potato, tobacco, and ipomoea) with CaPAL1 is shown in Fig.

The present invention also provides a recombinant vector comprising the gene and the transgenic plant into which the gene or the recombinant vector has been introduced.

The recombinant vector is preferably a recombinant plant expression vector. Such recombinant vectors include, but are not limited to, for example, pBIN35S: CaPAL1 , or pTRV2: CaPAL1 . The recombinant vector pTRV2: CaPAL1 was constructed by replacing the gene ( CaPAL1 ) with a Tobacco Rattle Virus 2 vector (Baulcombe DC (1999) Fast) which is a vector for virus-induced gene silencing (VIGS) (see FIGS. 4 to 6) by inserting the plasmid into the genome of the genome based on virus-induced gene silencing. Curr. Opin. Plant Biol. A transgenic plant was constructed using the recombinant vector pBIN35S: CaPAL1 and the gene was expressed (see Fig. 7).

In addition, the present invention provides a method for producing a plant in which a CaPAL1 gene is specifically inhibited in a red pepper plant by using the recombinant vector containing the CaPAL1 gene, and a method for confirming whether a plant transformed with the CaPAL1 gene is over- Thereby providing a method for producing a new disease resistant transformant plant and a material for resistant molecular breeding. More specifically, the present invention relates to a method for producing a VIGS plant which inhibits the expression of CaPAL1 gene (see FIGS. 4 to 6), a recombinant vector containing CaPAL1 gene (pBIN35S: CaPAL1 ) and Agrobacterium using tumefaciens strain GV3101) strain, Arabidopsis (Arabidopsis thaliana) Check the plant disease resistance gene activation function of CaPAL1 through transgenic expression in plants (Fig. 7 - Fig. 10) to provide disease resistant transgenic plants with it.

In the present invention, transformation of a plant means any method of transferring DNA to a plant. Any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable plant cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery.

Next, the present invention separates RNA from organs (leaves, stems, roots, flowers, blue fruits, red fruits) of plants and separates RNA after treating the pathogens on the leaf surface of the plants to discriminate the expression of CaPAL1 gene The method comprising the steps of: More specifically, the biological treatment may be exemplified by pathogenic bacteria such as pathogenic or non-pathogenic bacteria of the bacterium of the red pepper. In order to confirm the expression of CaPAL1 gene, various methods for measuring mRNA expression in addition to northern blotting and real-time RT-PCR can be used. Preferably, the present invention relates to a method for searching for disease resistance of a plant, wherein the RNA is isolated from plant leaves inoculated with pathogens, electrophoresed, transferred to a nylon membrane (Hybond N +), and treated with ³² P-dCTP And identifying the differential expression of the plant. It was experimentally confirmed that the CaPAL1 gene according to the present invention was differentially induced and expressed by a plant pathogen (see FIG. 3). Therefore, the CaPAL1 gene according to the present invention can be usefully used for searching resistance of plants.

By the completion of the present invention, the phenylalanine ammonia- lyase CaPAL1 gene, which is a gene related to the plant disease resistance, which is involved in the defense reaction against the bacterium of the red pepper plant bacterium ( Xanthomonas campestris pv. Vesicatoria ) The present invention provides a method for searching for resistance to plant diseases by using the gene and contributing to the production of resistant plant breeding and transgenic plants.

Further, by confirming the reduction of resistance through inhibition of CaPAL1 gene according to the present invention and overexpressing the gene in Arabidopsis thaliana to confirm the resistance of the plant disease, CaPAL1 according to the present invention can be provided as a material for breeding of disease resistant plants .

The present invention is an extremely useful invention in the plant breeding industry because it has the effect of promoting the development of resistant cultivars.

1 is nokgwang pepper cultivars by the present invention (Capsicum accuum L. cm. Nockwang) and the pepper phenylalanine ammonia- lyase gene ( CaPAL1 : Capsicum annuum Phenylalanine Ammonia - Lyase 1 ) and an amino acid sequence encoded by the nucleotide sequence, wherein
FIG. 2 is a diagram comparing the amino acid sequence of the pepper phenylalanine ammonia-lyase according to the present invention and the amino acid sequence of phenylalanine ammonia-lyase in other plants,
FIG. 3 is a graph showing the distribution of CaPAL1 As a result of confirming the expression of the gene (upper drawing) and the bacterial coloring fungus ( Xanthomonas campestris pv. vesicatoria ), and the results of the expression of the CaPAL1 gene (bottom plot ) in the inoculated and non-inoculated leaves,
Figure 4 is a recombinant vector pTRV: the production and it Agrobacterium CaPAL1 tumefaciens strain GV3101, and then inoculated with the CaPAL1 gene silencing plant inoculated when the red pepper plants were in the cotyledon stage, to the bacterial spotty bacillus ( Xanthomonas campestris pv. vesicatoria ), and the bacterial growth in the infected plant tissues was measured (top right in Fig. 4), and the phenylalanine ammonia-PAL actvity was measured FIG. 4 is a view showing the result of the measurement (the bottom view in FIG. 4)
FIG. 5 is a graph showing the relationship between CaPAL1 Bacterial spotty germs in gene silencing plants ( Xanthomonas campestris pv. vesicatoria ), and then the relative expression pattern of the protective marker gene, CaPR1 , was examined.
FIG. 6 is a graph showing the results of measurement of the CaPAL1 Bacterial spotty germs in gene silencing plants ( Xanthomonas campestris pv. vesicatoria ), the accumulation of H ₂ O ₂ and ion conductivity were measured.
Fig. 7 shows the results of Arabidopsis ( Arabidopsis thaliana) overexpressing the CaPAL1 gene through a recombinant vector (pBIN35S: CaPAL1) thaliana) CaPAL1 expression in the plant, and bacterial heukbanbyeong pathogens (Pseudomonas syringae pv. tomato DC3000) inoculated with a pathogenic and non-pathogenic strain,
FIG. 8 is a graph showing the expression of the CaPAL1 -overexpressed plant prepared in FIG. 7 in a bacterial black rot pathogen ( Pseudomonas syringae pv. tomato DC3000) at a concentration of 5 x 10 ⁴ cfu ml ^-1 and observing plant changes with H ₂ O ₂ accumulation and ionic conductivity.
FIG. 9 is a graph showing the results obtained by comparing the CaPAL1 overexpressed plants prepared in FIG. 7 with the bacterial pathogens Pseudomonas syringae pv. tomato DC3000) and observing differences in the expression of disease resistance-related genes, and FIG.
FIG. 10 is a graph showing the results obtained by comparing the transformed plants prepared in FIG. 7 with the nosocomial bacterium Hyaloperonospora Noco2 parasitica Noco 2). The results are shown in Fig.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

[ Example  One] CaPAL1  Determination of base / amino acid sequence of gene

Phenylalanine ammonia- lyase ( CaPAL1 : C apsicum) of pepper plants, which is one of the disease resistance-related proteins for pepper blight spotty disease a nnuum P henylalanine A mMonia - L yase 1 ) protein coding sequence and the amino acid sequence deduced therefrom.

[Step 1]

Capsicum annuum cv. Nockwang) were sprayed with red pepper bacillus fungi ( Xanthomonas campestris pv. vesicatoria ) and treated for 15 hours in a humidified condition. Then, the plants exhibiting the susceptible cell death response, which is a resistant disease, were taken out of the wet and the leaves were collected.

Next, mRNA was extracted from the leaf sample and reverse transcribed to prepare a cDNA library. Individual cDNA clones were prepared from the prepared cDNA library and adsorbed constantly on a nylon membrane (Hybond N +). Then, the leaves of the pepper plants inoculated with the non-pathogenic strains of the red pepper bacillus fungus and the leaves of healthy pepper plants The total mRNA extracted from the cells was labeled with digoxigenin to prepare probes, and then differential hybridization was performed.

As a result of the hybridization, the gene showing intensively amplified only for the mRNA probe of the non-pathogenic strain inoculated plant was estimated as a gene related to disease resistance and a clone was obtained.

After sequencing the obtained clones, the CaPAL1 protein coding gene was identified by comparing the sequence with a gene database registered in GenBank using a blast program and named as a phenylalanine ammonia- lyase ( CaPAL1 ) gene. The gene sequence (SEQ ID NO: 1) of CaPAL1 identified and the amino acid sequence (SEQ ID NO: 2) encoded by the nucleotide sequence thereof are shown in FIG.

[ Example  2] After inoculation of pathogens in pepper plants CaPAL1  Exploration of gene expression

In order to confirm the use of the CaPAL1 gene obtained in Example 1 for the search for disease resistance, the following test was conducted.

[Step 1]

First, in order to present the resistance search method concretely, the pathogenic bacteria such as red pepper bacterial spotty pathogen ( Xanthomonas campestris pv. vesicatoria ) and non-pathogenic strain Bv5-4a, which showed a non-pathogenic reaction, were inoculated at the concentration of 10 ⁸ cfu / Later, it was wet treated at 28 ° C and 100% relative humidity for 15 hours. After the inoculation, the leaves were sampled at each time point to isolate the RNA, electrophoresed on formaldehyde gel, and transferred to a nylon membrane (Hybond N).

Next, the CaPAL1 gene obtained in Example 1 was labeled with α- ³² P [dCTP] having an isotope using a Klenow enzyme, and the resultant was added to the reaction solution [0.25 M phosphate buffer, 7% SDS, mM EDTA, 5% dextran sulfate) at 65 ° C for 24 hours to perform hybridization. When the isotope-labeled DNA probe is attached to the mRNA attached to the nylon membrane (Hybond N +) and the X-ray film is placed on the nylon membrane (Hybond N +), So that the presence and the degree of the expression can be recognized.

The results of the above experiment are shown in FIG. 3. As a result, CaPAL1 gene was strongly expressed 5 hours after the inoculation of the non-pathogenic capsicum spot fungus .

[ Example  3] CaPAL1  Changes in disease resistance due to inhibition of gene expression

In order to investigate whether the expression of CaPAL1 gene was specifically inhibited in pepper plants and whether or not induction of other genes related to disease development and the collapse of resistance to disease, the CaPAL1 gene obtained in Example 1 was transfected with a virus inducing gene silencing The recombinant vector TRV2: CaPAL1 was prepared by introducing CaPAL1 gene into TRV2 vector using TRV (Tobacco Rattle Virus) used in virus-induced gene silencing (VIGS).

The TRV2 vector was digested with Eco RI, ethanol precipitation, dissolved in sterilized water, and DNA was dephosphorylated with alkaline phosphatase. The restriction enzyme Eco RI (GAATTC) sequence was attached to both 22 nucleotides (caaattcttcaatttcatcagc; SEQ ID NO: 3) of the 5'-untranslated region of CaPAL1 and amplified by polymerase chain reaction (PCR). PCR reaction conditions were 94 ° C for 5 minutes, 94 ° C for 1 minute, 52 ° C for 1 minute and 72 ° C for 30 seconds, and finally 72 ° C for 10 minutes. Was inserted into the pCR2.1-TOPO vector provided by Invitrogen. The TOPO vector was digested with restriction enzyme Eco RI, and the resulting fragment was inserted into a TRV2 vector using ligase to generate a pTRV2: CaPAL1 recombinant vector. TRV2, a non-inserted vector, was used as a control (Baulcombe DC (1999) Fast forward genetics based on virus-induced gene silencing. Curr Opin. Plant Biol.

The thus-prepared recombinant vector TRV2: CaPAL1 was introduced into Agrobacterium tumefaciense strain GV 3101 through electrophoresis, and then the GV3101 strain containing the recombinant vector was introduced into the cotyledon of pepper seedling Using a syringe, it was inoculated by infiltration method and introduced into a red pepper plant to produce CaPAL1 And the effect of suppressing gene expression was confirmed by real-time RT-PCR (see FIG. 5)

[Step 1]

In order to investigate the change in resistance to bacterial diseases in plants in which expression of CaPAL1 was suppressed, the pepper plants in which the expression of CaPLP1 gene was suppressed, and the pepper seedlings inoculated with TRV2: 00 vector as a control, ( Xanthomonas campestris pv. Vesicatoria ) and the non-pathogenic strain Bv5-4a were inoculated at a concentration of 10 ⁷ and 10 ⁸ cfu ml ^-1 , 10 < ⁴ > cfu ml < ^{-1 &} gt ;, and bacterial growth in the infected plant tissue was measured at day 0 and 3 after inoculation (Fig. And 10 ⁷ cfu ml ^{- 1} of the pathogen, and the phenylalanine ammonia - lyase activity (PAL actvity) was measured by time zone after inoculation (the bottom view of FIG. 4). In addition, RNA was extracted from the infected leaves of the experimental group and the control group at 12 and 24 hours after inoculation at a concentration of 10 ⁷ cfu ml ^{-1 of the} pathogen, and the specific gene suppression effect of CaPAL1 was detected by real-time RT-PCR And the expression of disease resistance-related genes was observed at the time of inoculation with the control plants (Fig. 5). And 10 ⁷ cfu ml ^-1 of pathogens. H ₂ O ₂ , a plant-resistant signal transduction related substance, was quantitated by time course after inoculation and the apoptosis of plant tissue, which is a expression of resistance response, was quantified by ionic conductivity measurement 6).

As shown in FIG. 4, in the plants in which the expression of CaPAL1 was inhibited by VIGS, the pathogenic strain Ds1 and the non-pathogenic strain Bv5-4a were observed after inoculation. As a result, when the pathogenic strain was inoculated, And necrotic phenomena were observed. In the non - pathogenic strain, cell death was observed in the control plants at 2 days after local resistance reaction, but the local apoptosis was delayed in the plants in which the expression of CaPAL1 was inhibited.

As shown in FIG. 4, bacterial growth of pathogenic bacteria and non-pathogenic bacteria was measured in the infected tissues. As a result, more bacterial growth was observed in the plants in which the expression of CaPAL1 was inhibited compared with the control. In addition, the PAL activity in the plants with inhibited expression of CaPAL1 was found to decrease from 12 hours after inoculation compared with the control.

Real-time Alti-fish know the test results as shown in FIG. 5, CaPAL1 is effectively suppressed plants was observed that the inhibition of CaPAL1 gene that appears, less pathogenic and non-pathogenic strains inoculated upon expression of the dependent representative resistant CaPR1 gene-related genes in acid Respectively.

As shown in FIG. 6, accumulation of H ₂ O ₂ and ionic conductivity were decreased in all the pathogenic and non-pathogenic strains in plants in which CaPAL1 was inhibited compared with the control plants.

[ Example  4] CaPAL1  Production of transgenic plants using genes CaPAL1  Variation of disease resistance of Arabidopsis plants by overexpression of genes

In order to investigate whether induction of genes involved in the development of other diseases and increase of resistance to diseases occurred in overexpression of CaPAL1 gene in Arabidopsis plants used as model plants, CaPAL1 gene obtained in Example 1 was added to pBIN35S vector introduced by pBIN35S: after producing the CaPAL1 this recombinant the recombinant vector of pBIN35S: that introduced through the electroporation method (electroporation) in the CaPAL1 Agrobacterium tumefaciens (Agrobacterium tumefaciense strain GV 3101) and the recombinant vector, and re-enter GV3101 By introducing the strain into Arabidopsis plants via floral dipping method, CaPAL1 Transgenic Arabidopsis thaliana inducing overexpression of the gene was constructed and the following test was carried out. Overexpression of the CaPAL1 gene was confirmed by RT-PCR and real-time RT-PCR (see Figures 7 and 9)

[Step 1]

As described above, CaPAL1 overexpressed plants were infected with bacterial black rot pathogen ( Pseudomonas syringae pv. tomato DC3000) was inoculated at a concentration of 5 x 10 ⁴ cfu ml ^-1 and the changes of the plant were observed. As shown in FIG. 7, in plants overexpressing CaPAL1 , resistance to both pathogenic and non-pathogenic strains was increased as compared with wild type. As shown in Fig. 8, accumulation of H ₂ O ₂ was higher after the inoculation of the pathogenic and non-pathogenic bacteria than the control, and the ionic conductivity was also higher after the inoculation with the pathogenic and non-pathogenic bacteria.

[Step 2]

RNA was extracted from the infected leaves of the experimental group and the control group at 24 hours and 48 hours after inoculation with 10 ⁷ cfu ml ^- 1 of pathogenic and non ^- pathogenic bacteria, and real - time RT - PCR was performed using the real - time RT - The expression of disease resistance-related genes was observed in comparison with plants, and the results are shown in FIG.

[Step 3]

To the plants overexpressing CaPAL1 , a plant- derived parasitic infestation of hyaloperonospora Noco2 ( Hyaloperonospora parasitica Noco 2) was inoculated and the change of disease resistance was observed. In the cotyledon phase of CaPAL1 overexpressed and wild type control plants not overexpressing, Haialoparonospora paracytica Noco2 was inoculated by spraying at a concentration of 5 x 10 ⁴ spores ml ^{- 1} . After inoculation, the cells were subjected to wet treatment at a temperature of 17 캜.

As a result, it was observed that the resistance of the transgenic Arabidopsis plants overexpressing CaPAL1 was increased, the mycelial growth of the eutrophic bacterium was inhibited, the spore growth and the number of spores were lower than that of the wild type, and the phenylalanine ammonia-LIA activity And the results are shown in Fig.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is obvious that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. It is therefore intended that the scope of the present invention be defined by the appended claims and their equivalents.

Attach an electronic file to a sequence list

Claims (5)

As a plant-resistance-resistance-related gene, a phenylalanine ammonia- lyease 1 gene ( Capsicum annuum Phenylalanine Ammonia- lyase 1 gene having a nucleotide sequence of SEQ ID NO: 1 encoding a pepper phenylalanine ammonia-lyase having an amino acid sequence of SEQ ID NO: A plant disease resistant composition against a plant disease caused by a bacterial pathogenic bacterium ( Pseudomonas syringae pv. Tomato DC3000) or a red pepper bacterium ( Xanthomonas campestris pv. Vesicatoria ), which contains Lyase 1, CaPAL1 . delete delete A plant which is transformed by the composition of claim 1 and is resistant to a plant disease caused by a bacterial pathogenic bacterium ( Pseudomonas syringae pv. Tomato DC3000) or a bacterium ( Xanthomonas campestris pv. Vesicatoria ). ( Pseudomonas syringae pv. Tomato DC3000) or Xanthomonas campestris pv. Vesicatoria , which comprises isolating mRNA from the plant after inoculation of the pathogen and confirming differentiation of the gene of claim 1 Of resistance to plant diseases caused by.

Images