CN111961678A

CN111961678A - Application of wheat TaLCT1 gene silencing in regulation and control of wheat cadmium stress tolerance

Info

Publication number: CN111961678A
Application number: CN202010956074.8A
Authority: CN
Inventors: 于永昂; 李成伟; 胡海燕; 李东霄; 魏琦超
Original assignee: Henan Institute of Science and Technology
Current assignee: Henan Institute of Science and Technology
Priority date: 2020-09-11
Filing date: 2020-09-11
Publication date: 2020-11-20
Also published as: CN113862281A

Abstract

The invention belongs to the technical field of biological gene engineering, and particularly relates to application of wheat TaLCT1 gene silencing in regulation and control of cadmium stress tolerance of wheat. The invention discloses a nucleotide sequence of a wheat TaLCT1 gene and an RNA interference fragment thereof, and discloses an application of the RNA interference fragment and a vector thereof in regulation and control of wheat cadmium stress tolerance. Also discloses the application of the TaLCT1 gene or RNA interference fragment or vector in creating cadmium-tolerant transgenic wheat plants, cultivating cadmium-tolerant wheat varieties or improving cadmium tolerance of wheat. The invention constructs a gene silencing vector through the RNA interference fragment, inhibits the expression of the TaLCT1 gene in wheat, silences the TaLCT1 gene and improves the cadmium resistance of the wheat.

Description

Application of wheat TaLCT1 gene silencing in regulation and control of wheat cadmium stress tolerance

Technical Field

The invention belongs to the technical field of biological gene engineering, and particularly relates to application of wheat TaLCT1 gene silencing in regulation and control of cadmium stress tolerance of wheat.

Background

With the development and utilization of a large amount of mineral resources, the rapid development of industry, the irrigation of agricultural sewage and the use of a large amount of chemical fertilizers and pesticides, the heavy metal pollution of farmland soil is increasingly serious, and the exceeding rates of heavy metals of lead, zinc and cadmium respectively account for 1.5%, 7.0% and 0.9% of the exceeding rate of inorganic pollutant point positions, wherein the heavy metal of cadmium (Cd) is particularly prominent due to the relatively stable valence state and the relatively high toxicity. The united nations environmental planning agency also ranks cadmium as the 1 st hazardous substance among the 12 hazardous chemicals of global significance. Thus, the global influence and attention of cadmium pollution can be seen. Cadmium is used as a non-essential nutrient element, and the plants show that the absorption of nutrients and water is inhibited, the root growth is hindered, the respiratory intensity and the photosynthetic intensity are reduced, the carbohydrate metabolism is disordered and other a series of physiological metabolic disorders by damaging the respiration, the photosynthesis, the nutrient metabolism and the like of the plants, so that the growth of the plants is strongly inhibited, the growth quantity and the yield are reduced, and even the plants die. In addition, cadmium accumulated in plants is transmitted into animals and human bodies through food chains, which affects the absorption and metabolism of calcium and phosphorus, causes diseases such as osteodynia, affects the hematopoietic system, causes anemia, causes kidney damage and renal dysfunction, causes diseases such as diabetes, proteinuria, amino acid enuresis, emphysema and hypertension, even causes mutation, deformity and cancer in serious patients, and poses great threat to human health.

Wheat is one of plants with strong tolerance to Cd, has high enrichment efficiency on low-concentration Cd in acid soil and irrigation water, and can be accumulated in roots, stalks and grains. The current research on the Cd-resistant mechanism of plants shows that the plants can resist or weaken the toxic degree of Cd through regionalization, fixed passivation and metallothionein, phytochelatin, emergency action, exclusion action and the like. Has been identified at presentThe metal cation transporter family(s) of (2) include, mainly, the CDF family, the ZIP family, the NRAMP family, the heavy metal ATPases family, the ABC transporter family, and the low-affinity cation transporter (LCT). It was found that LCT1 is a non-selective cation transporter in yeast expression system and not only mediates K⁺Can also transport Na⁺ 、Rb⁺ 、Ca²⁺ 、Cd ² ⁺Other ions are added to Na⁺ 、Rb⁺And Ca²⁺Transport of (d) is low affinity).

Disclosure of Invention

To date, in wheat, no role for TaLCT1 based on its cadmium tolerance has been reported. The research on the application of the TaLCT1 gene in improving the cadmium tolerance of plants can more deeply disclose the cadmium tolerance mechanism of wheat and provide a theoretical basis for improving the cadmium tolerance of wheat and reducing the cadmium content in grains.

Aiming at the defects of the prior art, the invention aims to provide a method for improving the cadmium tolerance of plants by using a wheat TaLCT1 gene (from wheat variety Bainong 207), and experiments show that the cadmium tolerance of wheat can be effectively improved by silencing the TaLCT1 gene.

The invention aims to provide application of wheat TaLCT1 gene silencing in regulation and control of wheat cadmium stress tolerance.

Based on the purpose, the invention adopts the following technical scheme:

the first scheme claimed by the application is as follows: a TaLCT1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

The second scheme claimed by the application is as follows: the amino acid sequence of TaLCT1 protein expressed by the TaLCT1 gene is shown as SEQ ID NO. 3.

A protein having 80% or more homology to the above-mentioned amino acid sequence and having the same function; alternatively, fusion proteins obtained by attaching tags shown in Table 1 to the N-terminal and/or C-terminal of the above-mentioned proteins are also included in the scope of the TaLCT1 protein described herein.

The third scheme claimed by the application is as follows: an RNA interference fragment of a TaLCT1 gene, the nucleotide sequence of the cDNA of which is shown in SEQ ID NO.2, and the nucleotide sequence of the TaLCT1 gene is shown in SEQ ID NO. 1. The RNA interference fragment is prepared by the following method:

using cDNA of wheat as template to obtain RAN interference fragment aiming at gene shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO. 2.

The application also claims a vector containing the RNA interference fragment described in scheme III.

Further, the vector described above uses pTCK303 as a backbone vector.

Further, in the above vector, the RNA interference fragment is a forward insert and/or a reverse insert.

The carrier is obtained by the following method: the method comprises the following steps:

(1) designing an amplification primer, which is

TaLCT1-F:5-GGGGTACCACTAGTCTCTCGTGAAAGACTCGC-3

TaLCT1-R:5-CGGGATCCGAGCTCTCGGGGAAGCAGGACCAA-3；

(2) Obtaining RNAi fragments (RNA interference fragments) of the TaLCT1 gene by taking cDNA of wheat as a template, and carrying out PCR amplification reaction;

(3) carrying out first enzyme digestion and connection on the PCR product with the enzyme digestion site obtained in the step (2) and the pTCK303 vector fragment, and transforming by using escherichia coli to obtain a recombinant plasmid pTCK303-TaLCT 1-1;

(4) and (4) carrying out secondary enzyme digestion and connection on the pTCK303-TaLCT1-1 obtained in the step (3), and transforming by using escherichia coli to obtain a recombinant vector GV3101 with a TaLCT1 silent gene.

The application also claims application of the TaLCT1 gene or RNA interference fragment or vector in regulation and control of wheat cadmium stress tolerance.

The application also requests to protect the application of the TaLCT1 gene or RNA interference fragment or vector in creating cadmium-tolerant transgenic wheat plants, cultivating cadmium-tolerant wheat varieties or improving the cadmium tolerance of wheat.

The invention constructs a gene silencing vector through the RNA interference fragment, inhibits the expression of the TaLCT1 gene in wheat, silences the TaLCT1 gene and improves the cadmium resistance of the wheat. After cadmium treatment, phenotype of a wild wheat plant and a TaLCT1 gene silencing strain is significantly different, and the strain height of the TaLCT1 gene silencing strain (with consistent culture conditions) is significantly higher than that of a Wild (WT) plant and has better growth vigor which is 1.51 times and 1.58 times of that of a control; the root length of the TaLCT1-RNAi strain is 1.51 times and 1.78 times of that of the control strain respectively. Compared with WT control, the leaves of the TaLCT1-RNAi strain are slightly damaged, and the phenomena of yellowing and wilting are less and tillering is more; however, the leaves of WT wheat are seriously damaged, obviously curled and wilted, and the yellow leaves are in growth retardation, which indicates that the silencing TaLCT1 gene can improve the cadmium tolerance of wheat.

Drawings

FIG. 1 is a GUS staining status diagram of wild plants and infected transformed positive wheat plants;

FIG. 2 is a diagram showing the results of PCR identification of infected transformed positive wheat, 1-11 are specific bands of PCR products of infected transformed positive wheat, and 12 are wild wheat;

FIG. 3 is a plot of the results of qRT-PCR analysis of wild plants and infected transformed positive wheat plants;

FIG. 4 is a graph comparing growth status of wild type wheat and TaLCT1 gene silenced wheat under cadmium stress;

FIG. 5 is a statistical chart of plant height and root length of wild type wheat and TaLCT1 gene-silenced wheat.

Detailed Description

The techniques of molecular biology used in the following examples include RNA extraction and reverse transcription, PCR amplification, digestion of PCR products and vectors, ligation, transformation of competent E.coli, etc., and are generally performed according to conventional methods, unless otherwise specified, and specifically described in the molecular cloning protocols (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peyer et al, 2002, Beijing: scientific Press), or according to the conditions recommended by the manufacturers.

Test material, pTCK303 vector and gene

Plant material: selecting and extracting wheat leaves at a seedling stage of the wheat variety Bainong 207, and starting a dip-dyeing experiment.

2. Framework carrier: pTCK303 vector.

Silencing the target gene: the nucleotide sequence of the wheat TaLCT1 gene is shown in SEQ ID No.1 and is derived from wheat transcriptome data.

A method for improving cadmium stress tolerance of a plant by using a wheat TaLCT1 gene specifically comprises silencing TaLCT1 gene expression in wheat.

EXAMPLE 1 construction of TaLCT1 Gene silencing recombinant vector

The method for constructing the TaLCT1 gene silencing recombinant vector comprises the following steps:

1.1 extracting total RNA of wheat leaves, and carrying out reverse transcription to obtain cDNA.

1.2 taking the cDNA obtained in the step 1.1 as a template, wherein the nucleotide sequence of the cDNA is shown as SEQ ID No.2, selecting an RNAi fragment aiming at a TaLCT1 gene, and carrying out PCR amplification by using primers TaLCT1-F and TaLCT1-R to obtain a PCR product with an enzyme digestion site; the primer is

TaLCT1-F:5-GGGGTACCACTAGTCTCTCGTGAAAGACTCGC-3

TaLCT1-R:5-CGGGATCCGAGCTCTCGGGGAAGCAGGACCAA-3 。

1.3 PCR products were constructed in two steps onto pTCK303 vector. The first digestion of pTCK303 plasmid and RNAi fragment (PCR product) of TaLCT1 with cleavage sites with Spe I (restriction endonuclease) and Sac I (restriction endonuclease) was carried out as follows:

pTCK303/TaLCT1 10μL

10×QuickCut Buffer 2μL

Spe I 1μL

Sac I 1μL

ddH₂O to 20μL

after reacting for 20min at 37 ℃, gel electrophoresis gel recovers the target fragment.

1.4 the PCR fragment obtained in step 1.3 is connected with the vector fragment by adopting T4 ligase, and the specific system is as follows:

PCR fragment digestion product 3. mu.L

1 mu L of pTCK303 enzyme digestion product

10×T4 DNA Ligase Buffer 1μL

T4 DNA Ligase 1μL

ddH₂O to 10μL

The reaction was carried out overnight at 16 ℃ and E.coli transformation was carried out.

1.5 plasmid extraction:

and (3) carrying out plasmid extraction on the successfully transformed escherichia coli in the step 1.4 by using a plasmid extraction kit, and naming the successfully transformed escherichia coli as pTCK303-TaLCT 1-1.

1.6 the pTCK303-TaLCT1-1 plasmid extracted in step 1.5 and RNAi fragment (PCR product) of TaLCT1 with cleavage site are subjected to secondary cleavage with BamH I and Kpn I, and the cleavage system is as follows:

pTCK303-TaLCT1-1 10μL

10×QuickCut Buffer 2μL

BamH I 1μL

Kpn I 1μL

ddH₂O to 20μL。

1.7 the PCR fragment obtained in step 1.6 is connected with the vector fragment by adopting T4 ligase, and the specific system is as follows:

PCR fragment digestion product 3. mu.L

1 mu L of pTCK303-TaLCT1-1 enzyme digestion product

10×T4 DNA Ligase Buffer 1μL

T4 DNA Ligase 1μL

ddH2O to 10μL

The reaction was carried out overnight at 16 ℃ to transform Escherichia coli, and the plasmid was extracted.

1.8 transforming the plasmid extracted from the step 1.7 with Agrobacterium tumefaciens GV3101 to obtain the GV3101 recombinant vector.

Example 2 transformation of wheat by Agrobacterium infection

The GV3101 recombinant vector prepared in example 1 is used for agrobacterium infection transformation of wheat, and the method comprises the following steps:

2.1 inoculation of Agrobacterium tumefaciens into LB solid

Agrobacterium tumefaciens was activated 2 times on a medium plate, and then a single colony of the strain was picked and inoculated into 5ml of a medium containing 20 mg. multidot.L^-1Rifampicin and 50 mg. L^-1Culturing in LB liquid culture medium containing kanamycin at 26 deg.C under oscillation speed of 160-200rpm for 5-8 hr, inoculating 1ml to 50ml of LB liquid culture medium containing 20 mg/L^-1Rifampicin, 50 mg. L^-1Kanamycin and 110umol L^-1Culturing in LB liquid culture medium of acetosyringone at 26 deg.C and oscillation speed of 160-200rpm for 12-16 hr until A600 value is 0.75-1.0;

2.2 selecting plump wheat seeds, wrapping the seeds with gauze, quickly washing the seeds with tap water, soaking the seeds in 70% ethanol for 2 minutes, then soaking the seeds in 0.1% mercuric chloride (mercuric chloride) for 3 to 5 minutes, continuously stirring the seeds during the soaking period to ensure that the surfaces of all the seeds achieve a sterilization effect, and then washing the seeds with sterile water for 5 to 6 times to prepare for infection;

2.3, transferring the sterilized mature wheat seeds into a sterile triangular flask of the prepared agrobacterium tumefaciens bacterial liquid, sealing the bottle mouth by a sealing film based on the amount of the agrobacterium tumefaciens bacterial liquid just immersed in the wheat seeds, placing the bottle mouth in a shaking table, and carrying out shaking culture for 10-12 hours at the temperature of 26 ℃ and the shaking rotation speed of 160-200 rpm; taking out from the shaking table, placing in an ultra-clean workbench, pouring out the bacteria solution, adding sterile water, washing for 3 times, and culturing for 3 days under dark condition at 25 ℃; the co-culture is carried out by adding 110 umol.L-1 acetosyringone into sterile water, and the pH value is 5.83-5.85;

2.3 transferring the co-cultured wheat seeds to pressure screening culture

Culturing for 1 month to obtain resistant plants; the pressure screening culture is carried out by adding 250 mg.L into sterile water^-1Cef and 25 mg.L^-1Damp mouldInoculating the survived resistant plants after the screening of the vegetarian group on a rooting culture medium for rooting and propagation, and culturing in an artificial climate box with the illumination intensity of 2000lx and the illumination time of 12day/8night for 30-40 days; adding 250 mg.L into 1/2MS solid culture medium as rooting culture medium^-1Cef and 25 mg.L^-1Hygromycin composition;

2.4 when the root length of the obtained plant reaches about 10cm, the seedling is clamped out by using tweezers and transplanted into flower soil, the soil humidity is kept about 80% within 1 to 2 weeks after the transplantation, the plant is placed in a shade place with certain illumination and cannot be directly irradiated by sunlight, and after 2 weeks, the plant is planted into a flowerpot and cultivated in a greenhouse, and seeds are harvested.

Example 3 identification of transgenic plants

The seeds harvested in example 2 are used for cultivating transformed wheat plants, when the transformed wheat plants grow to three leaves and one heart, young and tender single plant leaves are cut and respectively placed into a 0.2mL sterilization centrifuge tube, corresponding identification is carried out, then GUS staining fluid is added to submerge the plant leaves, a 37 ℃ incubator is placed for 6-12h, the sample is rinsed by 50%, 75% and 100% ethanol in sequence, the sample is soaked for 5min each time, then 100% ethanol is added to be soaked until complete decolorization is achieved, the GUS expression condition is observed under a stereomicroscope, and photographing record is carried out. As shown in FIG. 1, the wild control did not have a blue color, while

transformants

2, 3, and 4 were all able to be stained blue, indicating that the gene of interest had integrated into the genomes of these several plants.

In order to further identify positive plants, GUS-dyed blue positive plant DNA is extracted by a CTAB method, and TaLCT-test-F: GACGCACAATCCCACTATCC and TaLCT-test-R: ATGGCTGTCCACTCCTATTCC specific PCR was performed to identify positive shoots. As a result, the sizes of the PCR products of the transformed wheat 1-11 are consistent with the expected sizes, and the wild wheat 12 has no specific band (figure 2), and the results show that all the identified individuals are positive plants.

And detecting the expression condition of the TaLCT1 gene by utilizing a qRT-PCR technology. The results are shown in FIG. 3, compared with WT, the expression levels of TaLCT1 genes in the T2-1 and T2-2 positive transgenic plants are significantly reduced by 36.4% and 85.9%, respectively, which indicates that TaLCT1 is effectively silenced in the transgenic plants and is normally expressed in the control lines.

Example 4 evaluation of cadmium tolerance of transgenic wheat

Sterilizing wild type and TaLCT1 gene silencing wheat seeds with 0.5% NaClO solution for 20min, repeatedly washing with sterile water, soaking the seeds in 50mL of distilled water for 12h, placing the seeds in a germination box paved with 2 layers of filter paper, and culturing in an incubator until the three-leaf stage, wherein the conditions of the incubator are 12h under illumination and 25 ℃, and 12h under darkness and 25 ℃. After the culture was completed, CdCl2 (100 mg/kg) was treated for 14 days (cadmium stress process). The plant height and root length of wild type and TaLCT1 gene silencing wheat were measured separately.

As can be seen from fig. 4 and fig. 5, after cadmium treatment, the phenotypes of the two plants are significantly different, and the plant height of the tamct 1 gene silencing line (with the same culture conditions) is significantly higher than that of the WT plant and grows better, which is 1.51 times and 1.58 times of that of the control; the root length of the TaLCT1-RNAi strain is 1.51 times and 1.78 times of that of the control strain respectively. Compared with WT control, the leaves of the TaLCT1-RNAi strain are slightly damaged, and the phenomena of yellowing and wilting are less and tillering is more; the WT wheat leaves are severely damaged, obviously curled and wilted, and the leaves are yellow and grow and are stopped. The result shows that the silencing of the TaLCT1 gene can improve the cadmium tolerance of wheat.

Various corresponding changes and modifications can be made by those skilled in the art based on the above technical solutions and concepts, and all such changes and modifications should be included in the protection scope of the present invention.

Sequence listing

<110> institute of science and technology of Henan

Application of wheat TaLCT1 gene silencing in regulation and control of cadmium stress tolerance of wheat

<160> 3

<170> SIPOSequenceListing 1.0

<210> 2

<211> 1725

<212> DNA

<213> wheat (2 Ambystoma latex x Ambystoma jeffersonianum)

<400> 2

atgacggcgc cgccgcctcc tcctcttcct ccgactgctc ggtggtccgt ggccggccac 60

ggcagtttga tgacggcacc gcctcctcct cctcctcctc ctgctcggtg gtccgtggcc 120

ggcgacggca gtttgatgac gacgccgcct cctcctcctc ccactgctcg gtggtccgtg 180

gccggcgacg gcagtttgat gaaggcgccg cctcctcctc ctcctcctcc tcctccgact 240

gctcggtggt ccgtggccgg cggcggcagt ttgatgaggg ctccgccgat cccactctct 300

cgtgaaagac tcgctctacc ataccaggac ggtgagccac cggccacgac cgacgaccta 360

agcatgaggc cgacatcctc tccgccacca accagcgctg aagaaacaca aggagcacgg 420

cgttcttccg tttcgccggc acccgtcacc acggggatgg ccacctctcg cgggccgtct 480

accctcatcg aggccgagga gggtcgtgca actgagagga aggagattgt ggtgaaattg 540

cttaaagcca gggccaagga caacctcgag ctcggcggca tagccgccat ctttggtttc 600

gctgtgctgt ttggttggtc ctgcttcccc gaggagatga agcgccccgg caacttgaaa 660

ttcatcttct ccttgctgct ggcaatcgca accttcttca gcggcacggc cctcacgctc 720

ctcagcatga acatcgtcgg cctgccggag agcctcgtct ccgccggcca gctggtcgcc 780

tccaagtgcc tatttctcat ctgcaccgcg ctgtccgcca tgactctggt tagtctcctg 840

gccctcctgc cgagcatgct ctacctgtgc cttggcctcg tcgtgatgac ggtagtcgtg 900

ctgccggcca tcgtggtaca ctgttacatg cgacggcaca cagagggagg agacgaggca 960

gcggcactcg aggagcataa ggaggagctg gaggccgcat caaagatcac ctcgtgcgtc 1020

accaactcgg cgttcggggg actggtcggt gtgctgttta gcgcatccaa gtccaaggtc 1080

tccggcgccc cgacggccgt ttacacggct atgtttttca tgttctccac cgccatcttc 1140

ggcatggtcg tcatgacaat gtcgaagaaa gtatcgaagg tcgccaatcg gaggctccgg 1200

cagttgctcg tctgggcgat caggctcgcc aacgcctttt tgctctgctc gctggcgtgc 1260

gcagcgttcg cagcatcgtt cgcggtcatc agatgccaaa tttttgcggc gttcgggccg 1320

ttggccatta cggctgtgat ctgtttgatc ctccatcatt gtactgtccg ccctggcgaa 1380

gccgacccga gaaaccagga gaatcaaaag gcccggctca aagtaatgga ggacatggcg 1440

agcaaggtga cggcggcgac gttgggggcg atcatgagcg ttctcgcagg ctctgtcggg 1500

gaggaacacc acgagaagaa gggggctacg gatgcattca tggttgtcct gacatcgacc 1560

tttgtctcaa gctttggatt catgcttctc gccgccgcgc cgagctcagc gagggtgtac 1620

cttgcaccgg tctccaaggt gctcatctgg tcgtcggtgg ccttgtttgg agccaccgcc 1680

gtctctgttt atagcgcaga gatctccagg gcagttagcc agtag 1725

<210> 2

<211> 336

<212> DNA

<213> wheat (2 Ambystoma latex x Ambystoma jeffersonianum)

<400> 2

ctctcgtgaa agactcgctc taccatacca ggacggtgag ccaccggcca cgaccgacga 60

cctaagcatg aggccgacat cctctccgcc accaaccagc gctgaagaaa cacaaggagc 120

acggcgttct tccgtttcgc cggcacccgt caccacgggg atggccacct ctcgcgggcc 180

gtctaccctc atcgaggccg aggagggtcg tgcaactgag aggaaggaga ttgtggtgaa 240

attgcttaaa gccagggcca aggacaacct cgagctcggc ggcatagccg ccatctttgg 300

tttcgctgtg ctgtttggtt ggtcctgctt ccccga 336

<210> 3

<211> 300

<212> PRT

<213> wheat (2 Ambystoma latex x Ambystoma jeffersonianum)

<400> 3

Met Thr Ala Pro Pro Pro Pro Pro Leu Pro Pro Thr Ala Arg Trp Ser

1 5 10 15

Val Ala Gly His Gly Ser Leu Met Thr Ala Pro Pro Pro Pro Pro Pro

20 25 30

Pro Pro Ala Arg Trp Ser Val Ala Gly Asp Gly Ser Leu Met Thr Thr

35 40 45

Pro Pro Pro Pro Pro Pro Thr Ala Arg Trp Ser Val Ala Gly Asp Gly

50 55 60

Ser Leu Met Lys Ala Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro Thr

65 70 75 80

Ala Arg Trp Ser Val Ala Gly Gly Gly Ser Leu Met Arg Ala Pro Pro

85 90 95

Ile Pro Leu Ser Arg Glu Arg Leu Ala Leu Pro Tyr Gln Asp Gly Glu

100 105 110

Pro Pro Ala Thr Thr Asp Asp Leu Ser Met Arg Pro Thr Ser Ser Pro

115 120 125

Pro Pro Thr Ser Ala Glu Glu Thr Gln Gly Ala Arg Arg Ser Ser Val

130 135 140

Ser Pro Ala Pro Val Thr Thr Gly Met Ala Thr Ser Arg Gly Pro Ser

145 150 155 160

Thr Leu Ile Glu Ala Glu Glu Gly Arg Ala Thr Glu Arg Lys Glu Ile

165 170 175

Val Val Lys Leu Leu Lys Ala Arg Ala Lys Asp Asn Leu Glu Leu Gly

180 185 190

Gly Ile Ala Ala Ile Phe Gly Phe Ala Val Leu Phe Gly Trp Ser Cys

195 200 205

Phe Pro Glu Glu Met Lys Arg Pro Gly Asn Leu Lys Phe Ile Phe Ser

210 215 220

Leu Leu Leu Ala Ile Ala Thr Phe Phe Ser Gly Thr Ala Leu Thr Leu

225 230 235 240

Leu Ser Met Asn Ile Val Gly Leu Pro Glu Ser Leu Val Ser Ala Gly

245 250 255

Gln Leu Val Ala Ser Lys Cys Leu Phe Leu Ile Cys Thr Ala Leu Ser

260 265 270

Ala Met Thr Leu Val Ser Leu Leu Ala Leu Leu Pro Ser Met Leu Tyr

275 280 285

Leu Cys Leu Gly Leu Val Val Met Thr Val Val Val

290 295 300

Claims

1. A TaLCT1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

2. A TaLCT1 protein expressed by the TaLCT1 gene of claim 1, wherein the amino acid sequence of the protein is shown as SEQ ID NO.3, and the nucleotide sequence of the TaLCT1 gene is shown as SEQ ID NO. 1.

3. An RNA interference fragment of a TaLCT1 gene, the nucleotide sequence of the cDNA of which is shown in SEQ ID NO. 2.

4. A vector comprising the RNA interference fragment of claim 3.

5. The vector of claim 4, wherein pTCK303 is used as a backbone vector.

6. The vector of claim 4, wherein the RNA interference fragment is a forward insert and/or a reverse insert.

7. Use of the TalCT1 gene of claim 1, the RNA interference fragment of claim 3, or the vector of any one of claims 4-6 for regulating the tolerance of wheat to cadmium stress.

8. Use of the TalCT1 gene of claim 1, the RNA interference fragment of claim 3, or the vector of any one of claims 4-6 for creating a cadmium-tolerant transgenic wheat plant, breeding a cadmium-tolerant wheat variety, or improving cadmium tolerance in wheat.