CN106834337B - Method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using wheat gene - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using a wheat gene. And separating to obtain a gene TaMetRS capable of improving the DON tolerance capability and the gibberellic disease resistance of arabidopsis thaliana. A gene TaMetRS induced by DON is separated from a wheat variety by a method of screening a wheat suspension cell inhibition subtraction hybrid cDNA library and RACE clone gene full length. The gene is overexpressed in arabidopsis thaliana by utilizing an agrobacterium-mediated genetic transformation method, the DON tolerance capacity and the gibberellic disease resistance of transgenic arabidopsis thaliana are improved, and the research proves the new application of the gene as the function of resisting the gibberellic disease of plants. The nucleotide sequence of the gene is SEQ ID NO:1, and encodes 596 amino acids. The protein sequence coded by the gene is shown as SEQ ID NO: 2, respectively.

Description

Method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using wheat gene

Technical Field

The invention belongs to the technical field of wheat transgenosis. In particular to a method for improving DON tolerance and FHB resistance of arabidopsis by using wheat gene. The gene is separated and cloned from a TaMetRS gene, is proved to be a MetRS gene with new functions, and plays an important role in the defense reaction and detoxification process of plants. The TaMetRS gene is induced by DON, is positioned in a cell nucleus and participates in the regulation and control of cell defense reaction. The overexpression of the gene can improve the tolerance of arabidopsis thaliana to DON and the resistance of FHB. The gene of the invention is expected to improve the gibberellic disease resistance of plants and provide a new and safe gene resource for the disease-resistant breeding of transgenic wheat.

Background

Wheat is one of the most important grain crops in the world, wheat scab (FHB) is a fungal disease mainly caused by Fusarium graminearum, mainly occurs in warm and humid areas of the world, mainly occurs in middle and downstream areas of Yangtze river in China, seriously reduces the yield and quality of wheat, and threatens grain safety. Fusarium graminearum can infect wheat at seedling stage and flowering stage to cause seedling rot and ear rot and produce various mycotoxins including trichothecene, zearalenone, fumonisin and the like. As the most widely distributed Deoxyvalenol (DON) toxin in trichothecene toxins, it has become one of the main pollution sources of food and feed worldwide. The DON toxin can inhibit the biosynthesis of eukaryotic cell protein, and after a human or an animal eats the food containing the DON toxin, the DON toxin can cause strong vomiting and destroy the immune system, thereby seriously affecting the health of the human and the animal.

The basic conventional function of the MetRS gene is to catalyze the connection of methionine (methionin) and corresponding tRNA to form Met-tRNA_i ^MetPlays a crucial role in the biosynthesis of proteins. But at the same time MetRS has other important roles as well. MetRS probably plays an important role in the biosynthesis of rRNA, has the activity of inhibiting cancer cells in mammals, and is a target of an antiparasitic drug for human African trypanosomiasis. However, to date, there have been no reports of association of the MetRS gene with DON resistance and FHB resistance. In our earlier studies, a 390bp EST fragment was selected from a suppression differential hybridization (SSH) library of wheat suspension cells, strongly induced by DON, and subsequently cloned to the full length of the gene by 3 'RACE and 5' RACE, and named TaMetRS. As no report is available on whether the TaMetRS gene in wheat can improve the FHB resistance of a plant, the TaMetRS gene is separated from wheat and identified to have a new function, and after the TaMetRS gene is over-expressed in arabidopsis, the DON tolerance and the FHB resistance of arabidopsis can be improved, so that the TaMetRS gene has very important significance for breeding new wheat disease-resistant varieties.

Disclosure of Invention

The invention aims to relate to application of a wheat TaMetRS gene in controlling improvement of plant gibberellic disease resistance. The invention separates and applies a DNA segment containing TaMetRS gene, which endows the Arabidopsis seedling with DON resistance and FHB resistance in flowering phase. Wherein the nucleotide sequence of the TaMetRS gene is shown in a list SEQ ID NO:1, the sequence length is 2186bp, wherein the coding region of the gene is SEQ ID NO:1, and the protein sequence coded by the gene is shown in a list SEQ ID NO: 2, and encodes 596 amino acids.

Specifically, the technical scheme of the invention is as follows:

an application of wheat gene TaMetRS induced by mycotoxin Deoxynivalenol (DON) in improvement of plant scab resistance, wherein a nucleotide sequence of the gene is shown in a sequence table SEQ ID NO:1, 1-2186 bases.

An application of wheat gene TaMetRS induced by mycotoxin Deoxynivalenol (DON) in improvement of plant scab resistance, wherein a sequence of a protein coded by the gene is shown in a sequence table SEQ ID NO: 2, respectively.

The plant for which the invention is described is Arabidopsis thaliana.

The application of the invention comprises the following steps:

the coding region of a wheat gene TaMetRS is amplified by utilizing PCR, EcoRI enzyme cutting sites and BamHI enzyme cutting sites are respectively added at two ends of the coding region and are connected into an intermediate vector PTRAkc-VDM1-ERH to obtain a plant over-expression vector PTRAkc-35SS-TaMetRS, an arabidopsis thaliana is transformed by utilizing an agrobacterium-mediated genetic transformation method to obtain a transgenic arabidopsis thaliana with over-expression of the TaMetRS gene, and spore liquid of fusarium graminearum 5035 is inoculated by spraying to verify the gibberellic disease resistance of the transgenic arabidopsis thaliana. Wherein the plant overexpression vector PTRAkc-35SS-TaMetRS comprises SEQ ID NO:1, 70-1860 bases in sequence coding region.

The components and the mixture ratio of the culture medium are as follows:

agrobacterium culture medium (YEB): nutrient broth 5g + yeast extract 5g + peptone 5g + sucrose 5g, (15g/L agar) pH 7.0; 1/2MS screening Medium: MS bulk (20X) 25mL + MS organic (200X) 5mL + MS iron salt (200X) 2.5mL + MS micro (200X) 2.5mL +100mg/L inositol +20g/L sucrose +50mg/L Kana, (6.3g/L agar) pH 5.8.

After the components are added into the culture medium, distilled water is added to the culture medium to be constant volume of 1L, and the culture medium is sterilized for 18 minutes under high-pressure steam at the temperature of 121 ℃. The antibiotic in the culture medium is sterilized by filtration, and is added into the sterilized culture medium cooled to 60 deg.C under sterile environment in a clean bench.

The invention has the advantages that:

the cloned TaMetRS gene can improve the tolerance of arabidopsis thaliana plants to mycotoxin DON, and obviously improve the resistance of the transgenic arabidopsis thaliana plants to fusarium graminearum, a pathogen of scab.

The plant over-expression vector pTRAkc-35SS-TaMetRS used in the invention can efficiently express TaMetRS gene in Arabidopsis thaliana, so that the improvement of the gibberellic disease resistance of plants becomes possible.

The invention is further illustrated with reference to the following figures and examples.

Drawings

Sequence listing SEQ ID NO:1 is the nucleotide sequence of the cloned wheat gene TaMetRS (methionyl tRNA synthetase gene), the sequence length is 2186bp, and the corresponding amino acid sequence (namely the coding region) is SEQ ID NO:1, 70-1860, encodes 596 amino acids.

Sequence listing SEQ ID NO: 2 is a protein sequence encoded by the wheat gene TaMetRS (methionyl tRNA synthetase gene) of the present invention.

Sequence listing SEQ ID NO: 3 is the nucleotide sequence of the EST fragment of 390bp obtained by screening the inhibition subtraction hybrid library (SSH) of wheat suspension cells.

FIG. 1: is a general technical route map for separating and cloning TaMetRS genes and identifying functions.

FIG. 2: cloning of the full-length sequence of the TaMetRS gene. Description of reference numerals: panel A in FIG. 2 is the 3' RACE product; panel B in FIG. 2 is the 5' RACE product and panel C in FIG. 2 is the full-length cDNA of the TaMetRS gene.

FIG. 3 shows the expression patterns of TaMetRS gene after inoculation of DON, fusarium graminearum 5035 and Tri 5-spore liquid in two wheat varieties Zheng Mai 9023(Z9) and Su Mai No. 3 (S3). FIG. 3A is a graph showing the expression pattern of the TaMetRS gene after inoculation with DON toxin in wheat varieties Z9 and S3; FIG. 3B is a graph showing the expression patterns of wheat varieties Z9 and S3 inoculated with different Fusarium graminearum strains 5035 and Tri 5-.

FIG. 3 shows that the TaMetRS gene of the invention can be induced to express by DON and a toxigenic strain fusarium graminearum 5035, while a strain Tri 5-with a deletion of Tri5 gene has no influence on the expression of the TaMetRS gene.

FIG. 4: structural map of intermediate vector PTRAkc-VDM 1-ERH.

FIG. 5: the invention relates to a structural map of a plant over-expression vector PTRAkc-35SS-TaMetRS constructed by the invention.

FIG. 6: molecular identification and expression analysis of transgenic arabidopsis thaliana. . Description of reference numerals: FIG. 6A is PCR identification of transgenic Arabidopsis thaliana with primers TaMetRS-F2/TaMetRS-R2 and target product size of 1800 bp; FIG. 6B is a diagram showing the analysis of expression level of TaMetRS gene in transgenic Arabidopsis thaliana, the primer for expanding TaMetRS gene is TaMetRS-F3/TaMetRS-R3, and the size of the target fragment is bp; the amplification primer of the reference gene Actin is Actin-F/Actin-R, and the size of the target fragment is 135 bp.

FIG. 7: t2 transgenic Arabidopsis seedlings were treated for phenotype after 2 weeks at different concentrations of DON (0ppm, 5ppm, 10ppm and 15 ppm).

FIG. 8: 7-day and 10-day phenotypes of T3 Arabidopsis thaliana after inoculation with Fusarium graminearum 5035 spore liquid

Detailed Description

The following examples define the invention and describe the method of the invention in isolating clones containing the complete coding segment of the TaMetRS gene and verifying the function of the TaMetRS gene. From the following description and these examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Example 1: the full-length sequence of the cloned TaMetRS gene is isolated.

A390 bp EST fragment was selected from a suppressed differential hybridization library (SSH) of wheat suspension cells and strongly induced by DON (Applicant's previous work, unpublished), and the sequence is as follows:

AAAAGATGTCTTGCAACAGCTGAATCTCTGTCCGAATGAGCATATTTCTTTTGCCGATGAAAAGGGGGAGAGTGACAAGGCGAAAAGGCCTTGGGATCTTATACCATCAAACCACAGGATTGGGAAAATTGTGCCTTTGTTCACAGAGTTGAAAGATGATGCAGTGGATAGCTTCAGGGAAACATTTGCAGGCAGTCAGGCCGAAAGAAACGCAAGGGCTAATTAAAGAAGCCAATGAAGTTGTTGCCTAACTGGAAGCTGCAAAACATTTCTTGCAAAGTTGATCACAATACTTAATCAAATGACATTGAGATCCAGAAATGTGAGTTCGAAGGATGAATCACAATGTATATTTTACTGATTATTAGTGATGATGCATTCAGAAAATGT

based on this sequence, the applicants designed two upstream primers and two downstream primers, 3 'RACE-F1/3' RACE-F2 and 5 'RACE-R1/5' RACE-R2 (see Table 1), respectively, and following the procedures of the RACE kit (available from Clontech Inc.) protocol, the total volume of the PCR reaction system was 50. mu.L, 1uL (ca. 100ng) of cDNA template, 5uL of 10 XKOD plus buffer enzyme reaction buffer, 2.5mM dNTP 5uL, 1.5uL of 10uM primer, 1uL of KOD enzyme, and double distilled water to 50. mu.L. The reaction procedure is as follows: denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, denaturation at 60 deg.C for 30s, and elongation at 72 deg.C for 5min in 35 cycles. The PCR amplification result is shown in FIG. 2, the 3 'RACE obtains a 501bp fragment (FIG. 2A), the 5' RACE obtains a 1858bp fragment (FIG. 2B), the 2186bp fragment (the sequence is shown in SEQ ID NO: 1) is obtained after the two are spliced, and primers TaMetRS-F1/TaMetRS-R1 (Table 1) are designed to amplify the full length of TaMetRS and sequence to obtain a 2186bp fragment (FIG. 2C).

TABLE 1 primers used for Gene cloning

Description of table 1: english letters F and R after the name of the primer represent a forward primer and a reverse primer, respectively.

Example 2: detection of expression pattern of TaMetRS gene in wheat variety

Applicants selected two wheat varieties, Zheng Mai 9023 (for FHB susceptibility, Country breed, Country Mai 2003027, see Cheng et al, Tissue-specific and pathogen-induced expression of a fusion proteinaceous a Fusarium-specific antibody and a fungal protease protection while wheat strain and myPlant Biotechnology journal.2015.doi:10.1111/pbi.12289) and Sumai No. 3 (resistant to FHB, bred by the agricultural department of the Jiangsu region in 1970, highly resistant to gibberellic disease, see Cheng et al, Tissue-specific and pathogen-induced expression of a fusion protein containing a Fusarium-specific antibody and an antibiotic protease inhibitors with a broad age against an gibberellic disease, plant Biotechnology journal.2015.doi:10.1111/pbi.12289) as materials for expression profiling. After pregermination, the seeds were placed in a refrigerator at 4 ℃ for treatment of spring flowers (pregermination and spring flower treatment are common knowledge in the art) for 2 weeks and transplanted into a greenhouse. Selecting wheat ear with consistent growth state at the early stage of wheat poplar flower, shearing off the wheat stem of wheat ear at the middle part of wheat ear with scissors, injecting 10uL, 5 × 10 with microsyringe⁵Each strain is inoculated with a marked middle spikelet, the middle spikelet is covered with a transparent plastic bag and is taken off after being kept wet for 3 days, the spikelets inoculated with the spore liquid are respectively sampled for 24h, 48h, 72h and 96h, and the spikelets inoculated with the DON toxin are sampled for 4h, 12h, 24h and 48 h. The samples were first frozen in liquid nitrogen and then stored in a freezer at-80 ℃. Total RNA was extracted using Trizol (available from Invitrogen) reagent (experimental procedures were performed according to Trizol reagent instructions). Using reverse transcriptase SuperScript^TMIII (from Invitrogen) was reverse transcribed to synthesize cDNA (according to Invitrogen's reverse transcriptase reagent instructions) under the following reaction conditions: 5min at 65 ℃, 60min at 50 ℃ and 10min at 70 ℃. The cDNA synthesized by the above reverse transcription was used as a template, and the TaMetRS-F3/TaMetRS-R3 (see Table 1) gene was subjected to specific PCR amplification using primers. Meanwhile, the primer Actin-F/Actin-R is used for carrying out specific amplification (the length of an amplification product is 135bp) on the wheat Actin gene (AB181991) to be used as an internal reference gene for carrying out quantitative analysis. The reaction conditions are as follows: 5min at 95 ℃; 95 ℃ 10sec, 60 ℃ 5sec, 72 ℃ 34sec, 45 cycles. Real-time quantitative analysis of fluorescence detection is performed during the reaction (real-time quantitative analysis of fluorescence detection is a method commonly used in the art and is described in Li et al, Resistance to Fusarium head light and safety in floor isolated with activity of a cytochrom P450gene, phytopathology 2010.100: 183-191). The results show (FIG. 3), TaThe MetRS gene is strongly induced by DON toxin, and the induction expression is 43 times and 22 times in Z9 and S3 after inoculation for 4h, reaches the induction peak value at 24h, and is 700 times and 600 times respectively, and the induction expression begins to reduce at 48 h. The TaMetRS gene is also induced by the toxigenic fungus of Fusarium graminearum 5035 (a highly pathogenic strain of Fusarium graminearum isolated and stored in Wuhan 1999 in the laboratory of the Applicant, see Xu et al, division of the human synthase Chs1from Fusarium particulate bacteria in an alternate construction of cell walls and reduced virus. fungal and biological biology 2010.47:205-215), but by the non-toxigenic fungus Tri5^－(A mutant strain of the deletion of the Tri5 gene of Fusarium graminearum constructed and maintained by the laboratory of the Applicant, see Xu et al, partition of the chitinum synthesis gene Chs1from Fusarium particulate culture in an alternate structure of cell walls and reduced virus. fungal Genetics and biology.2010.47: 205-. After fusarium graminearum 5035 starts producing toxin in the ear (36h), the tamitrs gene starts to be induced and expressed, and the induced expression of the gene is only related to DON and has no relation to the wheat variety and FHB resistance (i.e. genetic background) thereof.

Example 3: construction of TaMetRS gene overexpression vector and transformation of Arabidopsis thaliana

Construction of plant expression vector PTRAkc-35SS-TaMetRS

In order to better analyze the function of TaMetRS gene, the applicant overexpresses TaMetRS gene in Arabidopsis thaliana, the function of the gene is studied from the phenotype of transgenic plants, the overexpression vector is constructed by using cDNA reverse transcription from total RNA after 12h treatment with Zheng wheat 9023(Z9) DON as a template, using primer TaMetRS-F2/TaMetRS-R2 (please see Table 1), amplifying cDNA fragment containing the complete coding region of TaMetRS gene (see sequence shown in SEQ ID NO:1 of sequence listing), adding EcoRI and BamHI cleavage sites at both ends of the cDNA fragment, respectively, under the reaction conditions of pre-denaturation at 94 ℃ for 5min, pre-denaturation at 94 ℃, 30sec at 58 ℃, 1min at 72 ℃, 35 cycles, extension at 72 ℃ for 5min, cutting target fragment 1800 min after electrophoresis, using DNA fragment recovery kit (purchased from DNA company), adding 3 times of DE-A buffer (from TaMet gel), dissolving the PCR product at 75 min, adding PCR product into the gel 12010 rpm, adding PCR buffer solution after centrifugation, adding PCR product into the gel, adding PCR buffer solution, recovering PCR product, adding PCR buffer solution, recovering the PCR product, centrifuging the PCR product, recovering the PCR product, adding the PCR buffer solution after centrifugation at 12000-1, adding the PCR buffer solution, recovering the PCR solution, recovering the buffer solution, recovering the PCR solution, recovering the buffer solution, recovering the.

Genetic transformation and screening identification of transgenic plants

Genetic transformation of the TaMetRS gene

The overexpression vector PTRAkc-35SS-TaMetRS described above was transferred into Arabidopsis thaliana by Agrobacterium-mediated genetic transformation method, which was reported by reference to Zhang Xiuren et al (Zhang Xiuren et al, Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method, Nature protocols, 1: 641) -646, 2006). The specific operation steps are as follows: when Arabidopsis thaliana was grown to about 3cm of terminal inflorescence, the terminal inflorescence was removed to stimulate the growth of the lateral inflorescence. And (4) carrying out transformation when the lateral inflorescence grows to 6-10 cm. Before transformation, the soil is allowed to absorb sufficient water, and pollinated flowers and young siliques are removed. And carrying out streak culture on the agrobacterium tumefaciens until a single colony appears, picking the single colony to 5ml of YEB culture medium, carrying out shake culture at the temperature of 28 ℃ and at the speed of 200r/min for 40h, and carrying out shake culture according to the ratio of 1: inoculating 100 proportion into 50ml YEB culture medium, shaking at 28 deg.C and 200r/min to OD₆₆₀The bacterial strain is collected by centrifugation at 6000r/min for 15min to reach about 0.8Resuspend the pellet with an equal volume of the transformed resuspension. The part above the rosette leaves of Arabidopsis plants was immersed in the resuspension for 15 sec. The transformed plants were placed flat in a tray with wetted filter paper, covered with a preservative film to maintain humidity, and after 1h, treated again in the same manner. Keeping the plants in the dark for 24h, taking the plants upright, and culturing the plants at 22 ℃ under 8h of light. And harvesting seeds after the plants normally bloom and seed, drying and storing at-20 ℃ for later use. Putting the harvested seeds into a centrifugal tube, treating the seeds with 70% alcohol for 1min, then treating the seeds with 0.15% hypochlorous acid solution for 2min, and washing the seeds with sterile water for a plurality of times; the seeds were sown on 1/2MS medium (pH 5.7, containing Kan 50mg/ml) to screen positive transformants, about 1000 seeds per dish were vernalized at 4 ℃ for 3-4 days, and then cultured at 22 ℃ under 8h of light. The plant which can grow normally is transplanted into nutrient soil after 5 or 6 leaves grow.

Molecular identification and expression quantity analysis of transgenic positive plants

DNA was extracted from fresh leaves of transgenic T0 plants (obtained from Tiangen Biochemical technology, Beijing, Ltd. using a plant genomic DNA extraction kit), and PCR positive test was performed using the target gene primers TaMetRS-F2/TaMetRS-R2, and the results are shown in panel A of FIG. 6.

Analysis of expression quantity of TaMetRS gene of transgenic positive plant

Total RNA of the transgenic positive plants MetRS-1 and MetRS-2 was extracted using Trizol (purchased from Invitrogen) (test procedures were performed according to Trizol reagent instructions). Using reverse transcriptase SuperScript^TMIII (from Invitrogen) was reverse transcribed to synthesize cDNA (according to Invitrogen's reverse transcriptase reagent instructions) under the following reaction conditions: 5min at 65 ℃, 60min at 50 ℃ and 10min at 70 ℃. The cDNA synthesized by the above reverse transcription was used as a template, and the TaMetRS-F3/TaMetRS-R3 (see Table 1) gene was subjected to specific PCR amplification using primers. Meanwhile, a primer Actin-F/Actin-R is used for carrying out specific amplification (the length of an amplification product is 135bp) on the wheat Actin gene (AB181991) so as to be used as an internal reference gene for carrying out semi-quantitative analysis. The reaction conditions are as follows: 5min at 95 ℃; 95 ℃ 10sec, 60 ℃ 5sec, 72 ℃ 34sec, 28 cycles. The concentration of the PCR product was detected by electrophoresis. The results show (see FIG. 6, panel B), that TaThe MetRS gene is expressed in a large amount in transgenic plants.

Example 4: TaMetRS overexpression transgenic T₂/T₃Growth conditions of the generation lines under DON stress

This example selects the overexpressed T of the TaMetRS transgenic Gene of the invention₂The strain generation (MetRS-1) was subjected to DON stress tests at different concentrations. The method comprises the following specific steps: the seeds of the overexpression transgenic strain (MetRS-1) are disinfected by a conventional method (firstly treated by 70% alcohol for 1min, then treated by 0.15% hypochlorous acid solution for 2min, washed by sterile water for several times), germinated on 1/2MS culture medium containing 50mg/L kanamycin, wild type Arabidopsis (non-transgenic, abbreviated as WT) is sowed on 1/2MS culture medium without kanamycin, vernalized at 4 ℃ for 2 days, placed at 20 ℃, and after 7 days of growth, seeds which are well germinated and have consistent growth are selected and transferred to 1/2MS culture medium containing four DONs with different concentrations of 0ppm, 5ppm, 10ppm and 15 ppm. After 2 weeks of growth, the root length and fresh weight of the transgenic and wild-type plants were measured and the test was repeated 3 times with 20 seedlings per line. The test results show (FIG. 7) that under the conditions of DON concentrations of 0ppm and 5ppm, the root length and fresh weight of wild type and transgenic plants are not obviously different, but DON can inhibit the growth of Arabidopsis. At concentrations of 10ppm and 15ppm DON, growth was inhibited in both wild type and transgenic plants, but root length and fresh weight of transgenic plants were significantly higher than wild type, and the difference was greatest at 15ppm DON. Therefore, applicants selected a concentration of 15ppm DON for subsequent DON stress tests.

Different transgenic lines (numbered MetRS-1 and MetRS-2) T₂/T₃Stress test of strains at 15ppm DON concentration. The method comprises the following specific steps: overexpression of transgenic lines (MetRS-1 and MetRS-2) T₂/T₃Sterilizing seeds (70% ethanol for 1min, 0.15% hypochlorous acid for 2min, and washing with sterile water for several times), germinating on 1/2MS culture medium containing 50mg/L kanamycin, sowing wild type Arabidopsis (WT) on 1/2MS culture medium without kanamycin, vernalizing at 4 deg.C for 2 days, standing at 20 deg.C, growing for 7 days, selecting germinated and uniformly grown seeds, and transferring to concentrated solution containing 15ppm DONDegree 1/2MS medium. After 2 weeks of growth, the root length and fresh weight of the transgenic and wild-type plants were measured and the test was repeated 3 times with 20 seedlings per line. The test results show (Table 2) that different transgenic lines (MetRS-1 and MetRS-2) T₂/T₃The root length and fresh weight of the material are higher than those of a wild type at the concentration of 15ppmDON, which shows that the over-expression of the TaMetRS gene can really improve the DON tolerance of a transgenic plant, and specific results are shown in Table 2.

TABLE 2 transgenic lines (MetRS-1 and MetRS-2) T₂/T₃Root length and fresh weight of material treated at 15ppm DON concentration for 2 weeks

a indicates significant difference at 0.05 level

b indicates significant difference at 0.01 level

Example 5: TaMetRS overexpression transgenic T₂FHB resistance analysis of Generation lines

In this example, different transgenic lines (numbered MetRS-1 and MetRS-2) T of the invention were selected₂/T₃Inoculating fusarium graminearum 5035 spore liquid with the concentration of 5 multiplied by 10⁵After each/ml, plants were analyzed for disease. The method comprises the following specific steps: overexpression of transgenic lines (MetRS-1 and MetRS-2) T₂/T₃The seeds were sterilized (1 min with 70% alcohol, 2min with 0.15% hypochlorous acid, several washes with sterile water), germinated on 1/2MS medium containing 50mg/L kanamycin, wild type Arabidopsis (WT) was sown on 1/2MS medium without kanamycin, vernalized at 4 ℃ for 2 days, placed at 20 ℃, grown for 7 days and then transplanted into small pots. The soil used for the test is carbon soil: vermiculite: perlite is 2: 1: 1 (weight ratio). Growing for about 35 days at 20 ℃ under short illumination (8-hour illumination/16 darkness), wherein the arabidopsis flowers vigorously, selecting plants with consistent growth states, carrying out spray inoculation on fusarium graminearum 5035 spores, and uniformly spraying once on each plant. The specific inoculation method is as follows: adding 0.001% of spore solution with adjusted concentrationSilwet L-77, selecting a small sprayer with a good spraying effect, uniformly spraying the sprayer to the inflorescence part of the arabidopsis, and shaking the sprayer at any time to uniformly suspend the spore liquid and avoid the precipitation of the spore liquid; covering the arabidopsis thaliana subjected to spray inoculation with a large plastic cover for moisturizing, keeping the arabidopsis thaliana in the dark for 2 days, and fully germinating spores with the relative humidity of 100 percent by spraying water every day for moisturizing; after 2 days, the cultivation is carried out by illumination, and water spraying and moisture preservation are continued; the disease was investigated on day 7 and 10 after inoculation. Each time 20 strains were inoculated, three replicates.

Arabidopsis thaliana surveys mainly count The occurrence of inflorescences (F), old horns (OS) and new horns (NS), and The final occurrence index (FAD) is The sum of The three, namely FAD value F + NS + OS specific scoring criteria are shown in Table 3(Urban et al, Arabidopsis Suspendable to The central early bright genes Fusarium graminearum and Fusarium cumorum, The plant journal 32: 961-.

TABLE 3 investigation statistical method of inoculating fusarium graminearum 5035 to arabidopsis thaliana

The results show that the FAD values of transgenic plants were lower than those of wild type at both day 7 and day 10 (table 4). Wherein, T₂The generation transgenic line MetRS-1 has FAD values of 6.59 and 8.41 at day 7 and day 10, which are respectively reduced by 41% and 38% compared with WT, while MetRS-2 has FAD values of 5.10 and 5.91 at day 7 and day 10, which are respectively reduced by 55% and 57% compared with WT, and the FAD value of the T3 generation transgenic line is also obviously reduced (FIG. 8). Therefore, the results show that the TaMetRS gene is overexpressed in Arabidopsis thaliana, so that the FHB resistance of the plant can be improved.

TABLE 4 investigation of the disease index (FAD) after inoculation of Arabidopsis with Fusarium graminearum 5035

b indicates significant differences at the 0.01 level.

Claims (5)

1. An application of wheat gene TaMetRS induced by mycotoxin Deoxynivalenol (DON) in improvement of plant scab resistance is characterized in that a nucleotide sequence of the gene is shown in a sequence table SEQ ID NO:1, 1-2186 bases.

2. The application of wheat gene TaMetRS induced by mycotoxin Deoxynivalenol (DON) in improvement of plant scab resistance is characterized in that a protein sequence coded by the gene is shown in a sequence table SEQ ID NO: 2, respectively.

3. Use according to claim 1 or 2, wherein the plant is arabidopsis thaliana.

4. The application of claim 1, wherein said application comprises the steps of:

amplifying a coding region of a wheat gene TaMetRS by using PCR, adding EcoRI and BamHI enzyme cutting sites at two ends respectively, connecting the coding region and the enzyme cutting sites to an intermediate vector PTRAkc-VDM1-ERH to obtain a plant over-expression vector PTRAkc-35SS-TaMetRS, transforming arabidopsis thaliana by using an agrobacterium-mediated genetic transformation method to obtain transgenic arabidopsis thaliana with over-expression TaMetRS gene, and inoculating a spore liquid of fusarium graminearum 5035 to verify the gibberellic disease resistance of the transgenic arabidopsis thaliana;

wherein

The plant over-expression vector PTRAkc-35SS-TaMetRS comprises a sequence table SEQ ID NO:1, between bases 70-1860.

5. The use according to claim 1, comprising constructing a plant over-expression vector to transform a host, wherein: the plant over-expression vector PTRAkc-35 SS-tamitrs used to transform the host comprises the sequence listing SEQ ID NO: 1.

Images